CN112662798B

CN112662798B - InDel molecular marker for identifying seed purity of muskmelon floral bovine variety and application thereof

Info

Publication number: CN112662798B
Application number: CN202011511900.4A
Authority: CN
Inventors: 付秋实; 王怀松; 胡志程
Original assignee: Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Current assignee: Institute of Vegetables and Flowers Chinese Academy of Agricultural Sciences
Priority date: 2020-12-18
Filing date: 2020-12-18
Publication date: 2022-04-15
Anticipated expiration: 2040-12-18
Also published as: CN112662798A

Abstract

The invention discloses an InDel marker for identifying the seed purity of a muskmelon floral bovine variety and application thereof. The sequence of the marker is as follows: C46-F: TTGGTGCAACTCCTCCAACT, C46-R: GCCCAACCACGTGACATTAT, the marker has specific amplification products of male parent 14500 and female parent 14503 in the first generation of hybrid. The marker is used for detecting the sample of the floral beef variety, the purity result of the detection is completely consistent with the purity result of the field planting identification, and the marker can be used for rapidly detecting the seed purity of the floral beef melon variety.

Description

InDel molecular marker for identifying seed purity of muskmelon floral bovine variety and application thereof

Technical Field

The invention belongs to the field of molecular biotechnology assisted breeding, and relates to an InDel molecular marker for identifying seed purity of a muskmelon floret variety and application thereof.

Background

The melon belongs to annual vine herbaceous plant of melon of Cucurbitaceae. The cow flower is a variety with excellent field agronomic characters. The variety is obtained by hybrid seed production, the female parent needs to be manually castrated before the male parent pollen is pollinated, but if the female parent castration is not thorough or the castration is missed, false hybrid is generated, and the seed production purity is seriously influenced.

The traditional method for identifying the purity of the hybrid seeds of the melons is mainly to observe the plant field shape through field planting, and calculate the seed purity according to the plant field shape. However, this method has many disadvantages, such as large workload, long cycle, susceptibility of phenotype to environmental impact, etc., and the phenotype identification method requires the identification personnel to be familiar with the phenotype difference between the variety and its parent, which requires high requirements for the identification personnel. Therefore, the development of an accurate and rapid purity identification method is one of the problems to be solved urgently in the production process of the melons.

With the development of sequencing technology and molecular biology, the molecular level difference between the variety and its parent identified by molecular markers is gradually applied to the purity identification work. The molecular marker is used for identifying the purity of the hybrid seeds, so that the workload can be reduced, the period can be shortened, the method has the advantages of rapid detection, simple and convenient operation and high accuracy, and the detection result is not influenced by environmental factors. The InDel markers are abundant in quantity and stable in heredity, and are widely applied to the work of genetic linkage map construction, gene positioning, purity identification and the like.

Disclosure of Invention

Aiming at the defects of the prior art, the invention performs resequencing on male parent 14500 (short rod type, dark green spot on lime green peel, light red pulp, crisp and sweet pulp) and female parent 14503 (ox horn type, lime green peel, green pulp, crisp and sweet pulp and good fruit setting), designs 150 pairs of primer pairs for identifying InDel markers according to sequencing comparison results, wherein 13 pairs of polymorphic markers are arranged in the male parent and the female parent, 8 pairs of markers with clear bands are selected for performing seed purity verification in 198 cow flower varieties, and the accuracy rate of the marker C46 is only 100%. Therefore, the invention provides the InDel molecular marker for identifying the seed purity of the muskmelon florae variety based on the genome re-sequencing of the parents and the InDel marker designed according to the insertion deletion sites of the two parents in the genome, and the InDel molecular marker has the advantages of good polymorphism, simple typing, accurate result, simple and easy operation and the like, and can accurately and quickly identify the seed purity of the muskmelon florae variety by utilizing the marker.

Firstly, the invention provides an InDel molecular marker primer for identifying the seed purity of a muskmelon floral variety, wherein the primer sequence is as follows:

C46-F：TTGGTGCAACTCCTCCAACT，

C46-R：GCCCAACCACGTGACATTAT。

meanwhile, the invention also provides application of the InDel marker primer in identifying the purity of the seeds of the muskmelon floral bovine variety, which mainly comprises the following steps:

(1) extracting genome DNA of a melon seed to be detected;

(2) using the DNA as a template and carrying out PCR amplification by using the InDel marker;

(3) performing polyacrylamide gel electrophoresis detection on the amplification result;

(4) analyzing the detection result, and calculating the proportion of the number of the hybrid seeds to the number of the samples to obtain the seed purity.

The muskmelon beef flower variety is registered by non-main crop varieties in agricultural rural departments in 2019 in 4 months, and is number 157 of the public republic of China agricultural rural bulletin; certificate number GPD melon (2019) 110062.

Wherein, preferably, the genomic DNA of the melon seeds to be detected is extracted by using the improved CTAB method in the step (1).

In a specific embodiment, the electrophoresis in step (3) is used for detecting: the gel was separated by electrophoresis at 150V power for 2h 15min using 8% polyacrylamide gel, and then developed by silver staining.

Wherein, the male parent in the step (4) has 1 characteristic band, the size is 219bp, the female parent has 1 characteristic band, the size is 253bp, the first generation of hybrid has two characteristic bands of the male parent and the female parent at the same time, and the seed purity calculation formula is as follows: purity ═ number of hybrids/total number of sample seeds × 100%.

The invention has the following positive effects:

the ' cow flower ' thin-skin melon variety is bred by vegetable and flower research institute of Chinese academy of agricultural sciences, and is registered by non-main crop varieties in agricultural rural areas in 2019 in 4 months (No. 157 of bulletin of agricultural rural areas of the people's republic of China; certificate No. GPD melon (2019) 110062). The variety is a hybrid variety, and has been widely popularized and applied in Shandong, Henan and other places. The purity identification is carried out through the molecular marker, the identification speed and accuracy can be accelerated, and the purity and quality of the seeds are ensured. The InDel marker is used for testing a sample of the cow flower variety, the marker has specific amplification products of a male parent 14500 and a female parent 14503 in a first hybrid generation, and the purity result of the test is completely consistent with the purity result of field planting identification, which shows that the marker has accurate detection result on the melon cow flower variety, and the InDel marker can be used for conveniently and rapidly identifying the purity of the cow flower variety in a standardized, large-scale manner.

Drawings

FIG. 1 is a DNA band characteristic of a melon product, a floral bouquet, and its parents.

FIG. 2 is a banding pattern of a sample to be tested of a melon floral cow variety No. 1.

FIG. 3 is a banding pattern of a sample to be tested of a melon floral bouquet variety No. 2.

FIG. 4 is a banding pattern of a sample to be tested of a melon floral cow variety No. 3.

FIG. 5 is a banding pattern of a sample to be tested of a melon floral cow variety No. 4.

Detailed Description

The first embodiment is as follows: screening for molecular markers

The male parent 14500 (short rod type, dark green spot on peel, light red pulp, crisp and sweet meat) and the female parent 14503 (horn type, grey green peel, green pulp, crisp and sweet fruit setting) are subjected to re-sequencing, 150 pairs of InDel markers are designed according to sequencing comparison results, wherein 13 pairs of polymorphic markers are arranged in the male parent and the female parent, 8 pairs of markers with clear bands (primer sequences are shown in the table 1) are selected for carrying out seed purity verification in 198 cow flower varieties, and the results are shown in the table 2, and only the accuracy of the marker C46 is 100%. The male parent identified by the marker C46 has a 219bp characteristic band, the female parent has a 253bp characteristic band, and the hybrid seed has both the male parent and the female parent (see FIG. 1.)

TABLE 18 pairs of tagged primer sequences

Table 2.8 accuracy of seed purity identification of the floral bouquet marked on the cow

Example two: application of molecular marker

The specific operation steps for identifying the purity of the seeds of the muskmelon floral beef variety by using the InDel molecular marker are as follows:

(1) extracting DNA of sample to be tested and its parent and female parent

Accelerating germination of melon seeds to be tested, placing the melon seeds in a hole tray for germination and emergence of seedlings, and taking 3cm seedlings when the seedlings grow to be flattened of cotyledons²Placing cotyledon in 2ml centrifuge tube, quick freezing with liquid nitrogen, grinding to powder, adding 800 μ l CTAB buffer solution, mixing, and water bathing at 65 deg.C for 1 hr, wherein one sample is mixed every 15minAdding beta-mercaptoethanol into CTAB in advance, and mixing uniformly;

adding 800 μ l chloroform/isoamyl alcohol mixture (24:1), shaking on a shaking table for 5min, and centrifuging at 12000rpm for 10 min; sucking 450 mu l of supernatant into a 2ml centrifuge tube, and repeating the operation once;

sucking 450 μ l of supernatant into a 1.5ml centrifuge tube, adding 450 μ l of precooled absolute ethyl alcohol, gently mixing, standing at-20 deg.C for at least 30min, centrifuging at 12000rpm for 10min, removing supernatant, retaining precipitate, adding 500 μ l of 75% alcohol, and washing for 2 times;

blow-drying DNA on a clean bench, adding 100. mu.l ddH₂O dissolution, DNA dissolution, adding 1. mu.l (10ng/L) of RNAse, water bath at 37 ℃ for 30min, removing RNA, measuring each DNA concentration by using NanoDrop 2000, detecting each DNA quality by using 1% agarose gel electrophoresis, and storing the DNA sample with qualified quality at-20 ℃.

(2) The PCR amplification was carried out using the above-mentioned extracted DNA as a template and the marker (C46-F: TTGGTGCAACTCCTCCAACT, C46-R: GCCCAACCACGTGACATTAT), and the PCR reaction system and reaction program were set as follows:

the PCR reaction system is as follows: 50ng of forward primer and 50ng of reverse primer respectively

Green Master Mix 5μL，DNA 5ng，ddH₂O was supplemented to 10. mu.L.

The PCR reaction program is: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 15s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 30s, and 35 cycles; keeping the temperature at 72 ℃ for 5min, and keeping the temperature at 4 ℃ for forever.

(3) And (3) carrying out polyacrylamide gel electrophoresis detection on the amplification result, wherein the specific operations are as follows:

preparing a gel solution according to an 8% polyacrylamide gel preparation system, pulling out a comb after the gel is solidified, vertically fixing a glass plate in an electrophoresis tank by using a clamp, and adding a proper amount of 0.5 xTBE electrophoresis solution; sample application; the electrophoresis program is 150V, 2h 15 min.

Fixing with stationary liquid for 6 min; after silver staining for 12min, washing with distilled water and sodium thiosulfate solution for 30s respectively; after the sodium hydroxide is developed until the bands are clear, the strips are washed by distilled water. And (5) horizontally placing the adhesive on a film observation lamp for observation, photographing and storing, and counting the strips.

(4) Obtaining the characteristic band types of the sample to be detected and the male parent and the female parent by utilizing the steps (the male parent has a characteristic band of 219bp, the female parent has a characteristic band of 253bp, and the hybrid seeds simultaneously have the characteristic bands of the male parent and the female parent), analyzing the detection result, calculating the proportion of the quantity of the hybrid seeds to the quantity of the sample, and obtaining the seed purity, wherein the calculation formula is as follows:

purity ═ number of hybrids/total number of sample seeds × 100%.

In this example, a total of 4 experimental replicates of the floral bouquet variety nos. 1-4 were set. The sample to be detected of the cow flower variety No. 1 has 63 strains, wherein 58 strains are hybridized, 5 strains are pseudohybridized, and the purity of InDel marker identification is 91.7%, please refer to FIG. 2; the sample to be detected of the cow flower variety No. 2 has 63 strains in total, wherein 60 strains are hybridized, 3 strains are pseudohybridized, the purity of InDel marker identification is 95.2%, please refer to figure 3; the number of the samples to be detected of the cow flower variety No. 3 is 64 in total, wherein 61 hybrid seeds exist, 3 pseudo hybrid seeds exist, the purity of InDel marker identification is 95.3%, please refer to the figure 4; the sample to be tested of the cow flower variety No. 4 has 63 strains in total, wherein 59 strains are hybridized, 4 strains are pseudohybridized, and the purity of InDel marker identification is 93.5%, please refer to FIG. 5. The seed purity of the muskmelon cow flower variety identified by the InDel marking method in the 4 experimental repetitions is completely consistent with the purity result of field identification (samples used for InDel marking identification are planted in the field when the samples are planted in the field at four leaves and one center and are used for field identification) (see Table 3 for details).

TABLE 3 comparison table of InDel molecular marker purity identification and field purity identification results

Claims

1. An InDel molecular marker primer for identifying the seed purity of a melon floral bovine variety is characterized in that the primer sequence is as follows:

C46-F：TTGGTGCAACTCCTCCAACT，

C46-R：GCCCAACCACGTGACATTAT。

2. the use of the InDel molecular marker primer of claim 1 to identify seed purity of a Cucumis melo floral bovine variety.

3. Use according to claim 2, characterized in that it essentially comprises the following steps:

(1) extracting genome DNA of a melon seed to be detected;

(2) carrying out PCR amplification by using the InDel molecular marker primer by using the DNA as a template;

4. The use according to claim 2 or 3, wherein the variegated Boletus is Notice 157 of agricultural rural Notice of the people's republic of China; certificate number GPD melon (2019) 110062.

5. Use according to claim 3, characterized in that: in the step (1), the genomic DNA of the melon seeds to be detected is extracted by using an improved CTAB method.

6. Use according to claim 3, characterized in that: and (3) carrying out electrophoresis detection: the gel was separated by electrophoresis at 150V power for 2h 15min using 8% polyacrylamide gel, and then developed by silver staining.

7. Use according to claim 3, characterized in that: in the step (4), the male parent has 1 characteristic band with the size of 219bp, the female parent has 1 characteristic band with the size of 253bp, the first generation of hybrid has two characteristic bands of the male parent and the female parent at the same time, and the seed purity calculation formula is as follows: purity = number of hybrids/total number of sample seeds × 100%.

8. A kit for identifying the purity of seeds of a muskmelon floral bovine variety is characterized by comprising the following primer pairs:

C46-F：TTGGTGCAACTCCTCCAACT，

C46-R：GCCCAACCACGTGACATTAT。

9. the kit of claim 8, wherein: also comprises a reagent for extracting the genome DNA of the melon seeds to be detected.

10. The kit of claim 9, wherein: also comprises a reagent for electrophoretic detection.