CN112662793A - Primer and kit for detecting mycoplasma pneumoniae - Google Patents

Abstract

The invention discloses a loop-mediated isothermal amplification primer group for detecting mycoplasma pneumoniae, which consists of the following three pairs of primers: MP2-F3, MP2-B3, MP2-FIP, MP2-BIP, MP2-LF and MP 2-LP; the nucleotide sequence of the MP2-F3 is shown as SEQ ID No.1, the nucleotide sequence of the MP2-B3 is shown as SEQ ID No.2, the nucleotide sequence of the MP2-FIP is shown as SEQ ID No.3, the nucleotide sequence of the MP2-BIP is shown as SEQ ID No.4, the nucleotide sequence of the MP2-LF is shown as SEQ ID No.5, and the nucleotide sequence of the MP2-LP is shown as SEQ ID No. 6. The primer group can obviously improve the detection efficiency, shorten the detection time to within 30 minutes, shorten the time by more than half than 60 minutes compared with the existing loop-mediated isothermal amplification method, can be used for quickly detecting mycoplasma pneumoniae infection, provides powerful help for clinical early diagnosis and treatment, and provides time for timely isolating infectors and controlling infection diffusion.

Description

Primer and kit for detecting mycoplasma pneumoniae

Technical Field

The invention relates to a primer group for detecting mycoplasma pneumoniae, in particular to a fluorescent loop-mediated isothermal amplification primer group and a kit for detecting mycoplasma pneumoniae.

Background

Mycoplasma pneumoniae (abbreviated MP) is the major pathogen causing Mycoplasma Pneumoniae Pneumonia (MPP), which accounts for roughly 20-30% of all pneumonia worldwide and tends to rise year by year. MP is also a major pathogen causing respiratory infections in children. MP infection not only causes upper and lower respiratory diseases, but also can affect other systems of human body, and causes extrapulmonary complications such as liver function damage, brain damage, myocarditis, arthritis and the like, and the degree is mild or severe, and even serious complications threatening life can occur.

Laboratory diagnosis is crucial to diagnosis and treatment of suspected MP infected patients, but the laboratory detection methods widely applied in clinic at present have insufficient support. The MP culture, which is a standard for laboratory diagnostic gold, requires about 2 weeks and is not sensitive enough. Traditional serological diagnosis requires a comparison of the acute and convalescent serum in duplicate, which is clearly not in line with the requirements of outpatient timely diagnosis. Especially children, are very reluctant to take two blood samples. If IgM is detected alone, it may indicate an existing infection, but the sensitivity of IgM detection in children has been controversial. The PCR detection has the advantages of high sensitivity, high specificity, shorter time required by serology detection and the like, but expensive instruments are required, not all laboratories are provided with PCR instruments, and meanwhile, the defects of complicated operation steps, high false positive and the like also restrict clinical application.

In 2000, Notomi et al developed a specific and efficient circular isothermal DNA amplification technique, i.e., LAMP. The method mainly utilizes 4 specific primers to test 6 specific regions on a target gene and DNA polymerase with strand displacement activity, and performs amplification reaction under a constant temperature condition, wherein the amplification efficiency can reach 108-1010 copies. Due to the sensitivity and specificity which can be compared with PCR, countless researches are based on LAMP technology, various pathogen detection methods are successfully developed, and the method is widely applied to clinical detection. Meanwhile, various new LAMP methods such as real-time fluorescence LAMP and the like are derived on the basis of the initial nephelometry LAMP.

The LAMP reaction experiment does not include the early stage sample preparation, the reaction time is about 60 minutes, and the detection time is about half shorter than that of the PCR reaction. However, with the development of PCR technology in the future, the reaction time is shortened, and the advantage of LAMP is not as obvious as that of the prior art. And because the clinical detection at present needs a lot, especially in autumn and winter mycoplasma pneumoniae high-incidence season, the detection amount can be greatly increased, the shorter the detection time is, the earlier treatment can be strived for patients, especially for children patients, the earlier treatment can inhibit the development of diseases and the injury to human bodies. Since the detection efficiency can be improved by shortening the detection time, it has been the focus of research by those skilled in the art to provide a detection technique with high sensitivity and specificity.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides a fluorescence loop-mediated isothermal amplification primer set which can effectively shorten the detection time and detect mycoplasma pneumoniae with sensitivity and specificity.

Another technical problem to be solved by the present invention is to provide an application of the primer set.

The invention also provides a detection kit containing the primer group.

In order to achieve the purpose, the invention adopts the following technical scheme:

a loop-mediated isothermal amplification primer group for detecting mycoplasma pneumoniae consists of the following three pairs of primers: MP2-F3, MP2-B3, MP2-FIP, MP2-BIP, MP2-LF and MP 2-LP; the nucleotide sequence of the MP2-F3 is shown as SEQ ID No.1, the nucleotide sequence of the MP2-B3 is shown as SEQ ID No.2, the nucleotide sequence of the MP2-FIP is shown as SEQ ID No.3, the nucleotide sequence of the MP2-BIP is shown as SEQ ID No.4, the nucleotide sequence of the MP2-LF is shown as SEQ ID No.5, and the nucleotide sequence of the MP2-LP is shown as SEQ ID No. 6.

Preferably, the molar ratio of each primer in the primer group is: MP2-F3, MP2-B3, MP2-FIP, MP2-BIP, MP2-LF, MP2-LP ═ 1:1:4:4:2: 2.

The primer group is applied to the preparation of a loop-mediated isothermal amplification reagent or a kit for detecting mycoplasma pneumoniae.

A fluorescent loop-mediated isothermal amplification reagent for detecting mycoplasma pneumoniae, the reagent comprising strand displacement DNA polymerase, buffer, Mg +, dNTPs, betaine, and the primer set of claim 1 or 2.

Wherein preferably said strand displacement type DNA polymerase is Bst DNA polymerase or a large fragment of said Bst DNA polymerase.

Preferably, the reagent further comprises a fluorescent color developing agent.

The reagent is used for preparing a loop-mediated isothermal amplification kit for detecting mycoplasma pneumoniae.

A fluorescence loop-mediated isothermal amplification kit for detecting mycoplasma pneumoniae, which comprises the following a) and b):

a) a positive control plasmid and/or a negative control;

b) the primer set described above or the amplification reagent described above.

The negative controls of the present invention were: pure water. The positive controls were: mycoplasma pneumoniae standard strain FH DNA.

Standard strains: the strain which is preserved by domestic or international strain preservation institutions, has confirmed and guaranteed genetic characteristics and is traceable, such as the strain with the preservation number of ATCC 15531.

The application of the primer group, the reagent or the kit in detecting and/or assisting in detecting whether a sample to be detected contains mycoplasma pneumoniae also belongs to the protection scope of the invention.

The real-time fluorescent isothermal amplification specific primer for detecting the mycoplasma pneumoniae provided by the invention has high specificity and sensitivity, and is simple and convenient to operate. The invention can obviously improve the detection efficiency, shorten the detection time to within 30 minutes, shorten the detection time by more than half in comparison with the existing loop-mediated isothermal amplification method by more than 60 minutes, can be used for the rapid detection of the mycoplasma pneumoniae infection, provides powerful help for the early clinical diagnosis and treatment, and provides time for timely isolating an infected person and controlling the infection diffusion.

Drawings

FIG. 1a is a graph showing the first amplification curve of several primer sets designed in the initial stage of the present invention;

FIG. 1b is a graph showing the amplification curves of several primer sets designed in the initial stage of the present invention;

FIG. 1c is a third graph showing the amplification of several primer sets designed in the early stage of the present invention; different primer sets are designed and synthesized according to different gene sequences in the MP gene for carrying out amplification experiments, many of the primers can not be amplified or have poor amplification efficiency, and the primers are eliminated

FIG. 2 is a preferred primer set amplification curve of the present invention, after a large number of screening experiments, a primer set with MP2 number was found to have a much better amplification efficiency than other primer sets;

FIG. 3 is a melting curve of a preferred primer set of the present invention, after the amplification efficiency of MP2 is found to be relatively high, the amplification of MP2 can be seen to be specific by the melting curve, which is around 87 ℃;

FIG. 4 shows the results of the sensitivity detection of the primer set in the present invention, in which the DNA extracted and purified from the MP standard strain FH culture medium was diluted 10-fold at the same ratio and used in the fluorescence LAMP reaction system, so that each reaction system contained 0.6, 6, 60, 600, 6000, and 60000 copies, respectively. The amplification has a standard amplification curve, and the minimum detection concentration is 60 copies;

FIG. 5 is a melting curve diagram of the primer set in the present invention, and when melting curve analysis is performed on each amplification curve, the reaction system with the amplification curve can be seen, and although the time for the amplification to occur is different, almost overlapped melting curves exist at about 87 ℃, which indicates that the amplification occurred in the fluorescence LAMP detection MP is specific amplification;

FIG. 6 shows the result of specific amplification of the primer set of the present invention, which shows that only MP of the standard strain FH shows positive amplification;

FIG. 7 is a primer set lysis curve graph illustrating specific amplification with only amplification occurring in the FH set lysis curve graph;

FIG. 8 is a graph showing the amplification curve of a case in which a clinical specimen is tested and verified by using the primers of the present invention, wherein a portion of the sample shows an amplification curve similar to that of a standard strain, and the shape of each amplification curve is almost the same;

FIG. 9 is a graph showing the analysis of a melting curve of a sample showing an amplification curve, wherein the melting curves are all around 87 ℃, and samples having a standard amplification curve and a correct melting curve are judged to be positive samples.

Detailed Description

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The following examples use equipment sources: OptiGene fluorescent LAMP apparatus (OptiGene, uk).

And (3) reagent sources:

an isotermal Master Mix comprising: 10 XBst buffer, Bst enzyme, MgSO4, dNTPs, betaine, and SYBGR components, all from Flora (Beijing) Biotechnology Ltd

The primers were all synthesized ordered from: england Weiji (Shanghai) trade Limited

Example 1 design and screening of fluorescent Loop-mediated isothermal amplification primer set for detection of Mycoplasma pneumoniae in the present invention

The primer is designed and prepared according to the following method: an outer primer (F3 and B3), an inner primer (FIP and BIP) and two loop primers for accelerating amplification reaction are designed by taking a Mycoplasma pneumoniae SDC1 gene sequence (GenBank accession No. M35024) as a template and are artificially synthesized.

The optimization and screening process of the primer group comprises the following steps:

in order to develop amplification primers which meet clinical requirements and are suitable for a fluorescent LAMP system, dozens of groups of primers with different sequences are designed for different amplification fragments, four primers F3, B3, FIP and BIP of the primary screening primers are synthesized, then standard strain DNA is used for amplification test, amplification is not performed at all in some cases, the amplification time is too long in some cases, the primer groups which are not amplified or have low efficiency are eliminated, and the primer groups with higher amplification efficiency are selected and used for subsequent verification experiments.

And an optimal primer group is screened out according to the verification sensitivity and specificity, and finally two loop primers are designed aiming at the four basic primers, so that the reaction speed is further improved, and the detection time is shortened.

As shown in FIG. 1a, FIG. 1b and FIG. 1c, several different primer sets were designed and synthesized according to different gene sequences in MP gene for amplification experiments, many of the primers in FIG. 1a, FIG. 1b and FIG. 1c could not be amplified or the amplification efficiency was not good, and those primers with poor amplification effect were eliminated.

As shown in FIG. 2, after the previous screening experiments, we prefer six primer sets with better amplification effect for further experiments, and the sequences of the six primer sets are shown in the following table.

TABLE 1

Primer name: mp2	SEQ ID No.	Sequence of
			F3	1	TTGGTGGAAAACACGGCC
B3
		2	GTTGAGTGGGCTGGCATTA
FIP				3	CTCCCCCCTTTCATCCCACTCATGGCTTGTTTACCCTGCTC
	BIP	4	AGTGCAAACGACTTACCCGGTTAAGGAGGCAATTTTGGCGG

TABLE 2

Primer name: mp6	SEQ ID No.	Sequence of
			F3	7	CGGTGGGGTATGATATGACG
B3	8	GGGGTCACATACGCAAAGG
			FIP	9	TGTACCCCCCATCACTGTCCAACTTCGACCTACAACCAAGCA
BIP	10	TTGGTGGAAAACACGGCCGGGTCGAGCAGGGTAAACAAGC

TABLE 3

TABLE 4

TABLE 5

TABLE 6

As shown in FIG. 2, it was finally found that the amplification efficiency of the primer set with the accession number of MP2 is much better than that of the other primer sets. As shown in FIG. 3, after the amplification efficiency of MP2 was found to be relatively high, it was found that the amplification of MP2 was specific, around 87 ℃ as seen by the melting curve. Finally, a fluorescent loop-mediated isothermal amplification primer group MP2 of the mycoplasma pneumoniae protected by the invention is screened, two primers for accelerating amplification reaction are designed according to the four primers, and three pairs of primers form the amplification primer group protected by the invention, wherein the primer sequences are as follows:

1. outer primers MP2-F3 and MP 2-B3:

the nucleotide sequence of MP2-F3 is shown as SEQ ID No. 1:

the nucleotide sequence of MP2-B3 is shown as SEQ ID No. 2:

2. inner primers MP2-FIP and MP 2-BIP:

the nucleotide sequence of MP2-FIP is shown in SEQ ID No. 3:

the nucleotide sequence of MP2-BIP is shown in SEQ ID No.4

3. And (3) accelerating amplification reaction loop primers MP2-LF and MP 2-LP:

the nucleotide sequence of MP2-LF is shown in SEQ ID No. 5:

the nucleotide sequence of MP2-LP is shown in SEQ ID No. 6:

TABLE 7 Loop primer sequences for accelerated amplification reactions

Primer name	SEQ ID No.	Sequence of
			MP2-LF	5	GGGTCACATACGCAAAGGTGT
MP2-LP	6	CAAGTCCGACCAAAAGGCC

Example 2 sensitivity and specificity test of primer set in the present invention

After the screening of example 1, the primer set of MP2 was selected for the first screening and the subsequent verification experiment was performed.

The sensitivity detection of the primer group in the invention is as follows:

1. the detection method comprises the following steps: genomic DNA of MP standard strain FH strain (ATCC15531) was extracted and diluted 10-fold in TE buffer at equal ratio to serve as a template in the fluorescent LAMP reaction system. Each reaction system contains 0.6, 6, 60, 600, 6000, 60000 copies of the DNA template for MP. The experiment was repeated 3 times.

2. The detection result of the sensitivity of the primer group is as follows:

the DNA extracted and purified from MP standard strain FH culture solution is diluted by 10 times in equal ratio and used in fluorescent LAMP reaction system, so that each reaction system contains 0.6, 6, 60, 600, 6000 and 60000 copies. Amplification gave a standard amplification curve with a minimum detection concentration of 60 copies, as shown in FIG. 4. Melting curve analysis of each amplification curve revealed that the reaction system in which the amplification curve appeared had almost overlapped melting curves at about 87 ℃ although the time for the appearance of amplification was different, indicating that the amplification occurred in the fluorescence LAMP detection MP as a specific amplification, as shown in FIG. 5.

Second, evaluation of the specificity of the primer set in the present invention:

1. the detection method comprises the following steps: the methodological specificity test was carried out using mycoplasma hominis (MH: M. hominis), mycoplasma pyriformis (Mpi: M. pirum), ureaplasma urealyticum (UU: Ureapasum), mycoplasma fermentans (Mf: M. ferteminas), Klebsiella pneumoniae (KP: K. penioniae), Pseudomonas aeruginosa (PA: P. aeruginosa), Escherichia coli (EC: E. coli), Neisseria (NC: N.coccus), Staphylococcus aureus (SA: S.aureus), Streptococcus pneumoniae (SP: S.pneumaoniae), and the test was repeated 3 times.

2. The primer group specificity detection result in the invention is as follows:

the primer group simultaneously detects MP, MH, Mpi, UU, Mf, KP, PA, EC, NC, SA and SP strains. The results show that only MP standard strain FH showed positive amplification as shown in fig. 6, and a single melting curve at 87 ℃, as shown in fig. 7, and no amplification of other strains, suggesting that the fluorescence LAMP detection MP established by us has good specificity.

Example 3 application of primer set of the present invention to detection of Mycoplasma pneumoniae

247 clinical specimens were tested and verified using the kit of the present invention.

1. Sample source: 247 patients at pediatric clinics and hospitalizations in a hospital were selected, and pharyngeal swab specimens were collected from the patients, placed in 2ml MP transfer medium, and frozen at-20 ℃ for future use.

2. And (3) inclusion standard: has fever (body temperature is more than or equal to 38 ℃), is accompanied with one of respiratory tract infection symptoms such as cough or pharyngalgia, has the course of illness within 7 days, and is mainly community-acquired pneumonia or mycoplasma pneumonia.

3. Exclusion criteria: patients with pulmonary tuberculosis, lung tumor, noninfectious pulmonary interstitial pneumonia, pulmonary edema, pulmonary atelectasis, pulmonary embolism, lung eosinophilic infiltration disease, low immunity, etc.

4. The kit comprises the following components and a reaction system:

the primer mix is the primer group SEQ ID No. 1-6.

The detection method for detecting the mycoplasma pneumoniae by using the kit comprises the following steps:

(1) extracting total DNA of a sample by using a limited utilization commercial DNA extraction kit;

(2) carrying out isothermal amplification by using the kit disclosed by the invention, wherein the isothermal amplification program of the kit disclosed by the invention comprises the following steps:

the reaction conditions at the initial stage of the experiment were set as follows: constant temperature amplification at 65 ℃ for 60 minutes, and annealing at 80 ℃ for 5 minutes. After the optimal primer of the invention is screened out, the high amplification efficiency is observed, the reaction time is set to be enough for 30 minutes, then according to the characteristics of the primer group, the reaction condition is set to be constant temperature amplification at 65 ℃ for 30 minutes, and annealing at 80 ℃ for 5 minutes.

The final amplification procedure of the kit of the invention is:

amplifying at constant temperature of 65 ℃ for 30min, and annealing at 80 ℃ for 5 min.

4. And (3) judging the result standard of the amplification product: a specific amplification curve appears and is a single peak at the correct Tm value.

5. Detection results of clinical specimens

(1) The fluorescence LAMP detection method developed in the invention is used for detecting and verifying 247 clinical specimens. As shown in FIG. 8, some samples exhibited similar amplification curves to the standard strain, and the shapes of the amplification curves were almost the same for each sample. The samples showing the amplification curve were subjected to the lysis curve analysis at around 87 ℃ and those samples having the standard amplification curve and the correct lysis curve were judged as positive samples, as shown in FIG. 9. 105 positive samples and 142 negative samples are finally detected, and the positive rate is 42.5%.

(2) By applying the fluorescent LAMP detection method developed in the research to verify the detection timeliness of clinical specimens, the results of all positive specimens can be clarified in about 30 minutes, the dissolution curve analysis of the positive results is carried out, the positive results are all near 87 ℃, and no non-specific amplification is seen.

Compared with the prior art, the LAMP method has the advantages that 2 loop primers are added on the basis of 4 conventional LAMP primers, so that the reaction efficiency is greatly improved, the LAMP reaction time is shortened to about 30 minutes, compared with the reaction time of PCR, the LAMP reaction time is shortened to about one fourth, and the advantages of the LAMP method are remarkably improved.

Sequence listing

<110> affiliated Beijing friendship hospital of capital medical university

<120> primer and kit for detecting mycoplasma pneumoniae

<160> 26

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ttggtggaaa acacggcc 18

<210> 2

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gttgagtggg ctggcatta 19

<210> 3

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctcccccctt tcatcccact catggcttgt ttaccctgct c 41

<210> 4

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agtgcaaacg acttacccgg ttaaggaggc aattttggcg g 41

<210> 5

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gggtcacata cgcaaaggtg t 21

<210> 6

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caagtccgac caaaaggcc 19

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggtggggta tgatatgacg 20

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggggtcacat acgcaaagg 19

<210> 9

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tgtacccccc atcactgtcc aacttcgacc tacaaccaag ca 42

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ttggtggaaa acacggccgg gtcgagcagg gtaaacaagc 40

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cggtggggta tgatatgacg 20

<210> 12

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cactcacggg ggtcacat 18

<210> 13

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

gtacccccca tcactgtcca accgacctac aaccaagcac tc 42

<210> 14

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gaaaacacgg ccgggctcaa gcaaaggtgt cgagcagg 38

<210> 15

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gacgactgat tcgagcgc 18

<210> 16

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ggggtcacat acgcaaagg 19

<210> 17

<211> 42

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gtacccccca tcactgtcca actcgaccta caaccaagca ct 42

<210> 18

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

ttggtggaaa acacggccgg gtcgagcagg gtaaacaagc 40

<210> 19

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

cggtggggta tgatatgacg 20

<210> 20

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 20

ggggtcacat acgcaaagg 19

<210> 21

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 21

catcactgtc caacccggcc gcgcttcgac ctacaacc 38

<210> 22

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 22

ttggtggaaa acacggccgg tgtcgagcag ggtaaacaag 40

<210> 23

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 23

cggtggggta tgatatgacg 20

<210> 24

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 24

ccctttcatc ccactcacg 19

<210> 25

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 25

ccttgtaccc cccatcactg tcctacaacc aagcactcgc c 41

<210> 26

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 26

gaaaacacgg ccgggctcaa tcacatacgc aaaggtgtcg 40

Claims (8)

1. A loop-mediated isothermal amplification primer group for detecting mycoplasma pneumoniae is characterized by consisting of the following three pairs of primers: MP2-F3, MP2-B3, MP2-FIP, MP2-BIP, MP2-LF and MP 2-LP; the nucleotide sequence of the MP2-F3 is shown as SEQ ID No.1, the nucleotide sequence of the MP2-B3 is shown as SEQ ID No.2, the nucleotide sequence of the MP2-FIP is shown as SEQ ID No.3, the nucleotide sequence of the MP2-BIP is shown as SEQ ID No.4, the nucleotide sequence of the MP2-LF is shown as SEQ ID No.5, and the nucleotide sequence of the MP2-LP is shown as SEQ ID No. 6.

2. The primer set of claim 1, wherein: the molar ratio of each primer in the primer group is as follows: MP2-F3, MP2-B3, MP2-FIP, MP2-BIP, MP2-LF, MP2-LP ═ 1:1:4:4:2: 2.

3. Use of the primer set according to claim 1 or 2 in the preparation of a loop-mediated isothermal amplification reagent or kit for detecting mycoplasma pneumoniae.

4. A fluorescence loop-mediated isothermal amplification reagent for detecting mycoplasma pneumoniae is characterized in that: the amplification reagents include strand displacement DNA polymerase, buffer, Mg +, dNTPs, betaine, and the primer set of claim 1 or 2.

5. The amplification reagent of claim 4, wherein: the strand displacement type DNA polymerase is Bst DNA polymerase or a large fragment of the Bst DNA polymerase.

6. The amplification reagent of claim 4 or 5, wherein: the amplification reagent also comprises a fluorescence color developing agent.

7. Use of the amplification reagent according to claim 6 in the preparation of a loop-mediated isothermal amplification kit for the detection of Mycoplasma pneumoniae.

8. A fluorescence loop-mediated isothermal amplification kit for detecting mycoplasma pneumoniae is characterized in that: the kit comprises the following a) and b):

a) a positive control plasmid and/or a negative control;

b) the primer set according to claim 1 or 2 or the reagent according to claim 6.

Images