CN112662778A - Potential biological marker for diagnosing and treating renal clear cell carcinoma - Google Patents
Potential biological marker for diagnosing and treating renal clear cell carcinoma Download PDFInfo
- Publication number
- CN112662778A CN112662778A CN202110113272.2A CN202110113272A CN112662778A CN 112662778 A CN112662778 A CN 112662778A CN 202110113272 A CN202110113272 A CN 202110113272A CN 112662778 A CN112662778 A CN 112662778A
- Authority
- CN
- China
- Prior art keywords
- cell carcinoma
- clear cell
- renal clear
- detection agent
- quantitative detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to a potential biological marker for diagnosing and treating renal clear cell carcinoma. The invention finds that the circular RNA circ0058792 is highly expressed in kidney cancer tissues and cells, is related to lesion size, pathological grading, clinical staging and the like, and prompts that the circ0058792 can be used as a kidney cancer diagnosis or prognosis marker. The invention is helpful to solve the defect that ccRCC is difficult to be predicted accurately in time clinically, and can screen candidate drugs for predicting the prognosis of renal clear cell carcinoma by detecting the expression level of circ0058792, thereby providing a new means for diagnosis and treatment of renal clear cell carcinoma.
Description
Technical Field
The invention relates to the technical field of biological medicines, in particular to a potential biological marker for diagnosing and treating renal clear cell carcinoma.
Background
The incidence of Renal Cell Carcinoma (RCC) has increased year by year (approximately 7%) over the past few years. Clear cell renal cell carcinoma (ccRCC) preceded mortality among the RCC subtypes (position 1). Although clinical treatment of renal cell carcinoma has progressed, the prognosis of advanced renal cell carcinoma is still poor, and the expected efficacy of targeted therapy is not ideal due to drug resistance and serious adverse reactions. Therefore, elucidation of the molecular mechanism of ccRCC and screening for effective biomarkers is imminent.
Circular RNA (circRNAs) is a novel endogenous non-coding RNA (a subset of non-coding RNA) that is a covalently closed loop joined by 5 '-CAPS and 3' -poly (A) tails. Recently, circRNAs were found to play a key role in diseases including cancer. Aberrant expression of circRNAs may lead to malignancies such as glioblastoma and hepatocellular carcinoma. Furthermore, various functions of the circular loop have been established, in particular circRNAs can also regulate genes as competitive endogenous rnas (cerrnas) via sponge mirnas.
Journal literature (Cheng, Yang En, Jiang Hao Wen. research on the role of circular RNA in renal clear cell carcinoma [ J ].2020,43(10):634-639.) describes the synthesis and function of and the role and clinical value of circRNAs in renal clear cell carcinoma, such as circABCB10, circPCNXL2, circZNF609, circATP2B1, hsa-circ-0001451, circHIAT1, circ-000926, circRAPGEF5, circAKT3, circNRIP1, hsa-circ-0072309 in ccRCC, including cancer promotion or inhibition. Patent document CN111334509A, published Japanese 2020.06.26, discloses that circSPECC1 is found based on YB-1 gene of human kidney cancer OS-RC-2 cell, through interaction with miR-615, expression of HIP1 and Caspase 9 gene is controlled in a targeted mode, so that the gene plays an important role in invasion and proliferation of human kidney cancer, and inhibition of circSPECC1 can effectively inhibit proliferation and invasion capacity of human kidney cancer OS-RC-2 cell.
However, there is no report of circ0058792 for diagnosis and treatment of renal clear cell carcinoma.
Disclosure of Invention
The invention aims to overcome the defects in the prior art and provides a potential biological marker for diagnosing and treating renal clear cell carcinoma.
In a first aspect, the invention provides the use of circ0058792 as a biomarker in the manufacture of a renal clear cell carcinoma diagnostic reagent or kit.
In some embodiments, the reagent or kit comprises a quantitative detection agent for circ0058792, the quantitative detection agent comprising reagents suitable for use in at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescent quantitative PCR, sequencing or biomass spectrometry.
In some embodiments, the quantitative detection agent is a probe or primer that is capable of specifically binding to the cDNA corresponding to circ0058792 or circ 0058792.
In some embodiments, the reagents or kits comprise an internal reference primer pair.
In some embodiments, the reference primer pair comprises one or more of a β -actin amplification primer pair, a GAPDH amplification primer pair, and an 18S rRNA amplification primer pair.
In some embodiments, the reagents or kits further comprise at least one of RNA extraction reagents, PCR reaction buffers, dNTPs, and DNA polymerase.
In some embodiments, the circ0058792 has the nucleotide sequence shown as SEQ ID No. 1.
In a second aspect, the invention provides the use of circ0058792 as a biomarker in the preparation of a renal clear cell carcinoma prognostic reagent or kit.
In some embodiments, the reagent or kit comprises a quantitative detection agent for circ0058792, the quantitative detection agent comprising reagents suitable for use in at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescent quantitative PCR, sequencing or biomass spectrometry.
In some embodiments, the quantitative detection agent is a probe or primer that is capable of specifically binding to the cDNA corresponding to circ0058792 or circ 0058792.
In some embodiments, the reagents or kits comprise an internal reference primer pair.
In some embodiments, the reference primer pair comprises one or more of a β -actin amplification primer pair, a GAPDH amplification primer pair, and an 18S rRNA amplification primer pair.
In some embodiments, the reagents or kits further comprise at least one of RNA extraction reagents, PCR reaction buffers, dNTPs, and DNA polymerase.
In some embodiments, the circ0058792 has the nucleotide sequence shown as SEQ ID No. 1.
In a third aspect, the invention provides the use of an inhibitor of circ0058792 in the manufacture of a medicament for the treatment of renal cancer.
In some embodiments, the renal cancer is renal clear cell carcinoma, papillary renal cell carcinoma, chromophobe renal cell carcinoma, or Bellini collecting duct carcinoma.
In some embodiments, the circ0058792 has the nucleotide sequence shown as SEQ ID No. 1.
In some embodiments, the inhibitor is an inhibitor that reduces the expression of circ0058792 or inactivates or reduces the activity of circ 0058792.
In some embodiments, the inhibitor is selected from a small molecule compound or a biological macromolecule.
In a fourth aspect, the present invention provides a method for screening potential substances for treating renal clear cell carcinoma, comprising:
(1) treating a system expressing circ0058792 with a candidate substance;
(2) detecting the expression of circ0058792 in the system; if the candidate substance reduces the expression of circ0058792 this is an indication that the candidate substance is a desired potential substance and vice versa this is an indication that the candidate substance is an undesired potential substance.
The invention has the advantages that:
1. the invention discovers that circ0058792 is highly expressed in kidney cancer tissues and cells and is related to lesion size, pathological grading, clinical staging and the like, and the invention prompts that circ0058792 can be used as a kidney cancer diagnosis or prognosis marker, and is helpful for solving the defect that ccRCC is difficult to predict in time and accurately in clinic.
2. Based on high expression of circ0058792 in kidney cancer tissues and cells, a candidate drug for predicting renal clear cell carcinoma prognosis can be screened by detecting the expression level of the circ 0058792.
Drawings
FIG. 1: pcDNA3.1-EGFP overexpression vector map.
FIG. 2: expression of circ0058792 in different cell lines: except for the down-regulation of the expression in 769-p, the expression of other renal cancer cell lines is up-regulated.
FIG. 3: circ0058792 chromosome localization and splicing pattern, circ0058792 is located on chromosome 2 and confirmed by sequencing to verify looping.
FIG. 4: the number of the cells which are over-expressed with circ0058792 and are positive to EDU is obviously increased.
FIG. 5: overexpression of circ0058792 inhibited apoptosis in renal cancer cells.
Detailed Description
In order that the invention may be more fully understood, a more particular description of the invention will now be rendered by reference to specific embodiments thereof that are illustrated in the appended drawings. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete.
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.
The term "quantitative detection agent for circ 0058792" in the present invention should not be construed as a detection agent for circ0058792 only, but should include the remaining detection agents known to those skilled in the art to reflect the expression level of circ 0058792. For example, the cDNA reverse transcription of circ0058792 can be detected quantitatively, or the expression level of circ0058792 can be detected indirectly.
Herein, circbase number hsa _ circ _0058792 of circ0058792, the sequence is: TGTTAAAAGATCACTGAAGTTGGATGGTCTGTTAGAAGAAAATTCATTTGATCCTTCAAAAATCACAAGGAAGAAAAGTGTTATAACTTATTCTCCAACAACTGGAACTTGTCAAATGAGTCTATTTGCTTCTCCCACAAGTTCTGAAGAGCAAAAGCACAGAAATGGACTATCAAATGAAAAGAGAAAAAAATTGAATCACCCCAGTTTAACTGAAAGCAAAGAATCTACAACAAAAGACAATGATGA (SEQ ID NO: 1).
Circ0058792 useful as a marker in the present invention is intended to include full-length ribonucleotide sequences, or naturally occurring variants thereof, or fragments of both full-length and variants, particularly fragments that can be detected and determined for a particular sequence, more preferably fragments that are distinguishable from other RNA sequences in kidney tissue. Preferably at least 7, 8, 9, 10, 11, 12, 15 or 20 consecutive ribonucleotides of said full-length ribonucleotide sequence.
One skilled in the art will recognize that ribonucleotides released by cells or present in the extracellular matrix may be damaged (e.g., during inflammation) and may be degraded or cleaved into such fragments. As will be appreciated by the skilled artisan, RNA or fragments thereof may also be present as part of the complex. Such complexes may also be used as markers in the sense of the present invention.
By "naturally occurring variant" it is understood that the genes of higher animals are often associated with a high frequency of polymorphisms. There are also many molecules that produce isoforms containing amino acid sequences that differ from each other during splicing. Any gene associated with a cancer-related disease having an activity similar to that of the marker gene is included in the marker gene even if it has a nucleotide sequence difference due to polymorphism or isotype.
As the quantitative detection agent for RNA, there can be used a known agent known to those skilled in the art, for example, a nucleic acid capable of hybridizing with the RNA and labeled with a fluorescent label; the detection agent for RNA can be selected from primers for RT-PCR and primers for amplification of cDNA, the product of RT-PCR in common.
The following detailed description of the present invention will be made with reference to the accompanying drawings.
Example 1
First, experiment method
1. Human tubular epithelial cells (HK-2) were used as a control, and the expression of HK-2, A498, ACHN, 786-O, 769-p, caki-1, OS-RC-2, Ketr-3, and other cell lines was examined by real-time PCR. Internal reference beta-actin. The circ0058792 primer sequence is as follows:
F：5’-GTCTTCCAGGACGATGCCTT-3’(SEQ ID NO:2)；
R：5’-GCTGGCCAAGTTACCCACAA-3(SEQ ID NO:3)。
2. constructing over-expression plasmid, vector and target gene information: the map of pcDNA3.1-EGFP overexpression vector is shown in FIG. 1, and the promoter EF1 is followed by the MCS (multiple cloning site) region.
3. Cell transfection: the hsa _ circ _0058792cDNA was synthesized by Henkel, Guangzhou, China and cloned into pcDNA3.1. Plasmids or their control groups were transfected into cells via liposomes 2000.
4. Sequencing and cyclization: the circular structure of circ0058792 was confirmed by Sanger sequencing and RNase R treatment. In the RNase treatment, the expression of circagap1 and linear AGAP1 mRNA was detected by quantitative real-time PCR (qrt-PCR) to evaluate the stability of circ0058792(AGAP 1).
5. Overexpression of circ0058792 to observe the effects on proliferation and apoptosis of renal cancer cell lines ACHN and A498
(1) And (3) detecting cell proliferation: this study investigated the incorporation of the cytometric kit-8 (CCK-8) and 5-ethynyl-20-deoxyuridine (EDU). In the CCK-8 assay, cells were seeded in 3000 cells/well in 96-well plates. Then, 10. mu.l of CCK-8 was added to each well and OD450 was measured daily until day 5, and the EDU experiment was completed according to the kit protocol supplied by Ruibo, Guangzhou.
(2) And (3) detecting cell apoptosis: Annexinv-FITC/PI detection kit was used, stained with Annexinv-FITC and Propidium Iodide (PI). Briefly, cells were suspended in 200. mu.l of binding buffer and incubated with 5. mu.l of Annexinv and 5. mu.l of pi for 15min at room temperature. These procedures were performed according to the instructions of the kit. Stained cells and apoptotic results of ACHN and a498 cell lines were analyzed by FACS flow cytometry.
6. Clinical specimen analysis of circRNA biomarkers of renal clear cell carcinoma malignancy and invasiveness
(1) Inclusion criteria were:
the pathological examination proves that the cancer is renal cell carcinoma;
② the first time, the second time, the third time, the first time, the second time, the third time, the fourth time;
and thirdly, the existing medical history, the personal history, the family history, the physical examination data are detailed, and the postoperative pathological data are complete.
(2) Exclusion criteria:
excluding other chromophobe cancers except renal clear cell carcinoma, renal papillary carcinoma, etc.
All experiments were performed under the supervision of the ethical committee of the affiliated college hospital of college university, and patients (or family members of patients) were signed on informed consent.
(3) From the eligible renal clear cell carcinoma database, 64 cases were randomly selected, of which 40 men, 24 women, aged 42-71 years, and the average age was 55.3 ± 7.2 years. All patients were clearly diagnosed by pathology examination. Besides the clinical routine examination, the age, sex, disease course, tumor location, tumor maximum diameter, histological type, differentiation degree, clinical stage, infiltration depth, lymph node metastasis, growth pattern, surgical plan and post-operative treatment (such as immunotherapy, radiotherapy and chemotherapy) should be recorded in detail, and all examination results are based on the first result after hospital admission.
(4) All procedures were signed on informed consent. After the specimen is separated from the body, the specimen is washed clean by normal saline, fresh cancer tissues and normal tissues beside the cancer are cut from the cancer tissue specimen, the necrotic bleeding part is avoided as much as possible, the fresh cancer tissues and the normal tissues are divided into 2 parts, and one part is preserved in formalin solution for immunohistochemistry. One part is immediately put into a freezing tube, then 5-10 times of RNAlater in volume is added to prevent RNA enzyme from polluting and degrading, the mixture is stored for 24 hours at 4 ℃ and is transferred to a minus 80 ℃ or a liquid nitrogen tank for long-term storage, and the mixture is used for qPCR and western blot experiments. We used 4 pairs of samples for chip analysis of circRNA, and the remaining 60 pairs of samples for quantitative real-time PCR (qRT-PCR) validation.
Total RNA was extracted using TRIzol. RNA quality and concentration were determined from OD 260/280 readings and verified using quantitative real-time PCR methods. Reverse transcription was performed using Primescript RT kit. The realtome PCR reaction is specifically as follows: add 8. mu.l of the mixture to each corresponding well of the PCR plate. The corresponding 2. mu.l of cDNA was added. Sealing Film Sealing Film was carefully glued on and briefly mixed by centrifugation. The prepared PCR plate was placed on ice before setting up the PCR program. All the indexes were carried out according to the following procedures: pre-denaturation: at 95 ℃ for 3 min; denaturation: 95 ℃ for 10 seconds; fluorescence was collected at 60 ℃ for 60 seconds (40 PCR cycles). After the amplification reaction is finished, the following circulation conditions are adopted: 95 ℃ for 10 seconds; 60 seconds at 60 ℃; after completion of the reaction at 95 ℃ for 15 seconds and slowly heating from 60 ℃ to 99 ℃, the amplification curve and the melting curve were confirmed to prepare a standard curve. Beta-actin as an internal reference, 2-△△CtThe method calculates the expression changes of circ0058792 in renal clear cell carcinoma tissues relative to paracarcinoma tissues.
Results analysis the expression change values of the circRNAs are expressed by measuring the difference between the Ct values of the circs 0058792 gene of interest and the beta-actin gene of the reference gene, delta CT. According to the formula RQ 2-△△CTConversion was performed, where Δ CT (target gene-internal reference) is expressed as mean ± standard deviation (mean ± SD) for a control group (paracancer group) of a sample to be tested- (target gene- β -actin), and t-test was performed to determine whether there was a significant difference in the expression level between cancer tissue and the corresponding paracancer tissue, and P was used as P<A difference of 0.05 is statistically significant.
Second, result in
1.Circ0058792 was found to be up-regulated (P < 0.05) at 498, ACHN, 786-0, caki-1, OS-RC-2, Ketr-3 and down-regulated (P < 0.05) at 769-P compared to HK-2 cells. The difference was statistically significant (P < 0.05) (FIG. 2). A498 and ACHN were selected for the next study.
2. circ0058792 cyclisation site sequencing analysis
has _ circ0058792 is located on chromosome 2, the gene is marked as AGAP1, and then the external amplification product of circ0058792 is subcloned into a vector for recombinant cloning screening, and the sequencing result is shown in FIG. 3, which confirms that the circular RNA really exists.
3. The circ0058792 over-expression plasmid was purchased from Jiman organisms in the Shanghai. The constructed plasmid circ0058792-pcDNA3.1-EGFP is cut by EcoRI and BamHI enzyme and sequenced, which shows that the plasmid is constructed completely.
4. Effect of overexpression of circ0058792 on proliferative Capacity of Kidney cancer cells
The overexpression group showed a significant increase in EDU-positive cells in both renal cancer cell lines compared to the control group, with statistical significance for the difference (P <0.01) (fig. 4).
5. Effect of overexpression of circ0058792 on apoptosis of ACHN, A498
Compared with the control group, the apoptosis of the two renal cancer cell lines is reduced in the overexpression group.
6.circ0058792 is highly expressed in renal cancer tissues and cells and is associated with lesion size, pathological grading, clinical staging, etc., suggesting that circ0058792 is significantly associated with poor clinical pathology factors (table 1).
TABLE 1 correlation of the expression level of circ0058792 in 60 versus renal clear cell carcinoma (ccRCC) with clinical parameters
Correlation between hsa_circ_0005875expression and clinical parameters.
The above description is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, several modifications and additions can be made without departing from the method of the present invention, and these modifications and additions should also be regarded as the protection scope of the present invention.
SEQUENCE LISTING
<110> Shanghai city Hospital of same economic nature
NORTH CAMPUS, HUASHAN HOSPITAL AFFILIATED TO FUDAN University
SHANGHAI FIRST PEOPLE'S Hospital
<120> a potential biological marker for diagnosing and treating renal clear cell carcinoma
<130> /
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 249
<212> DNA
<213> circ0058792
<400> 1
tgttaaaaga tcactgaagt tggatggtct gttagaagaa aattcatttg atccttcaaa 60
aatcacaagg aagaaaagtg ttataactta ttctccaaca actggaactt gtcaaatgag 120
tctatttgct tctcccacaa gttctgaaga gcaaaagcac agaaatggac tatcaaatga 180
aaagagaaaa aaattgaatc accccagttt aactgaaagc aaagaatcta caacaaaaga 240
caatgatga 249
<210> 2
<211> 20
<212> DNA
<213> Artificial sequence
<400> 2
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence
<400> 3
Claims (10)
- Use of circ0058792 as biomarker in the preparation of renal clear cell carcinoma diagnostic reagents or kits.
- 2. The use according to claim 1, wherein the reagent or kit comprises a quantitative detection agent for circ0058792, the quantitative detection agent comprising reagents suitable for use in at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescent quantitative PCR, sequencing or biomass spectrometry.
- 3. The use of claim 2, wherein the quantitative detection agent is a probe or primer capable of specifically binding to the cDNA corresponding to circ0058792 or circ 0058792.
- 4. The use of claim 1, wherein the reagent or kit comprises an internal reference primer pair.
- 5. The method according to claim 1, wherein the circ0058792 has the nucleotide sequence as shown in SEQ ID No. 1.
- Application of circ0058792 as biomarker in preparation of renal clear cell carcinoma prognostic reagent or kit.
- 7. The use according to claim 6, wherein the reagent or kit comprises a quantitative detection agent for circ0058792, the quantitative detection agent comprising reagents suitable for use in at least one of the following methods: fluorescent dye method, digital PCR, resonance light scattering method, real-time fluorescent quantitative PCR, sequencing or biomass spectrometry.
- 8. The method according to claim 6, wherein the circ0058792 has the nucleotide sequence as shown in SEQ ID No. 1.
- Use of an inhibitor of circ0058792 in the manufacture of a medicament for the treatment of renal cancer.
- 10. A method of screening for potential agents for treating renal clear cell carcinoma, comprising:(1) treating a system expressing circ0058792 with a candidate substance;(2) detecting the expression of circ0058792 in the system; if the candidate substance reduces the expression of circ0058792 this is an indication that the candidate substance is a desired potential substance and vice versa this is an indication that the candidate substance is an undesired potential substance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110113272.2A CN112662778B (en) | 2021-01-27 | 2021-01-27 | Potential biological marker for diagnosing and treating renal clear cell carcinoma |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110113272.2A CN112662778B (en) | 2021-01-27 | 2021-01-27 | Potential biological marker for diagnosing and treating renal clear cell carcinoma |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112662778A true CN112662778A (en) | 2021-04-16 |
| CN112662778B CN112662778B (en) | 2022-09-06 |
Family
ID=75414736
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110113272.2A Active CN112662778B (en) | 2021-01-27 | 2021-01-27 | Potential biological marker for diagnosing and treating renal clear cell carcinoma |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662778B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971851A (en) * | 2019-01-22 | 2019-07-05 | 宁波大学 | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases |
-
2021
- 2021-01-27 CN CN202110113272.2A patent/CN112662778B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109971851A (en) * | 2019-01-22 | 2019-07-05 | 宁波大学 | Purposes of the MiR-125b-2-3p as the molecular marker of antidiastole different subtypes renal cell carcinomas and its in metastases |
Non-Patent Citations (1)
| Title |
|---|
| XIYI WEI等: "Construction of circRNA-based ceRNA network to reveal the role of circRNAs in the progression and prognosis of metastatic clear cell renal cell carcinoma", 《AGING》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662778B (en) | 2022-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DiFeo et al. | Roles of KLF6 and KLF6-SV1 in ovarian cancer progression and intraperitoneal dissemination | |
| US20160177316A1 (en) | Methods and Compositions for Increasing the Efficacy of Doxorubicin Treatment in the Treatmentof Prostate Related Disorders using miR-106b-25 Cluster | |
| CN109097477B (en) | circRNA marker for breast cancer diagnosis and application thereof | |
| EP2499258B1 (en) | Signature for the diagnosis of breast cancer aggressiveness and genetic instability | |
| KR101872965B1 (en) | Method for the diagnosis, prognosis and treatment of prostate cancer metastasis using c-maf | |
| JP2012500389A (en) | MicroRNA-based compositions and methods for diagnosis, prognosis and treatment of multiple myeloma | |
| WO2010011642A2 (en) | Methods and compositions using splicing regulatory proteins involved in tumor suppression | |
| EP2318544A2 (en) | Method for predicting and detecting tumor metastasis | |
| Pyle-Chenault et al. | VSGP/F-spondin: a new ovarian cancer marker | |
| CN107519193B (en) | Molecular diagnostic marker for early stage esophageal squamous carcinoma and application thereof | |
| JP2008535474A (en) | Method for diagnosis and treatment of cancer using β-catenin splice variant | |
| CN111485020A (en) | L INC01419 application as marker for diagnosing and treating liver cell cancer | |
| WO2008132167A2 (en) | Diagnostic, prognostic and/or predictive indicators of breast cancer | |
| Shibata et al. | Detection of novel fusion genes by next-generation sequencing-based targeted RNA sequencing analysis in adenoid cystic carcinoma of head and neck | |
| WO2015085164A2 (en) | Uveal melanoma prognosis | |
| CN112662778B (en) | Potential biological marker for diagnosing and treating renal clear cell carcinoma | |
| CN111334577A (en) | Laryngeal squamous carcinoma molecular marker hsa _ circ _0004547, detection method and application | |
| CN108192977B (en) | Molecular marker related to occurrence and development of gastric cancer | |
| CN110468134B (en) | tRF related to NSCLC and application thereof | |
| JP2007082433A (en) | Malignant brain tumor marker gene and use of the same | |
| KR101441013B1 (en) | Biomarker for diagnosing breast cancer | |
| CN111534587A (en) | Molecular marker 5-tRF-His, breast cancer detection kit and application thereof | |
| CN113699233B (en) | Application of TROAP in preparation of renal cell carcinoma prognosis products and therapeutic drugs | |
| CN112980953B (en) | Clear cell carcinoma of kidney circRNA biomarker, screening method and diagnostic kit | |
| CN110541034B (en) | Application of LINC01992 in breast cancer diagnosis and treatment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |