CN112662746B - Quality control product for genotyping detection and preparation method thereof - Google Patents
Quality control product for genotyping detection and preparation method thereof Download PDFInfo
- Publication number
- CN112662746B CN112662746B CN201910980422.2A CN201910980422A CN112662746B CN 112662746 B CN112662746 B CN 112662746B CN 201910980422 A CN201910980422 A CN 201910980422A CN 112662746 B CN112662746 B CN 112662746B
- Authority
- CN
- China
- Prior art keywords
- quality control
- sample
- control product
- solution
- blood
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a quality control product and a preparation method thereof, wherein the quality control product is a crude blood extract and comprises white blood cells and buffer solution, the white blood cells are from a sample with a target gene as a heterozygote, and a Ct value obtained by fluorescence PCR measurement is within a preset Ct value range. The quality control product and the preparation method thereof can be used for effective quality control of blood direct-amplification genotyping products, and the precision and the stability of the quality control product meet the industrial requirements of the quality control product.
Description
Technical Field
The invention belongs to the technical field of biological products, and particularly relates to a preparation method of a quality control product for genotyping detection.
Background
With the continuous development and promotion of precise medical treatment, genotyping detection and products thereof have been approved by clinical diagnosis, and more genotyping products are continuously released to the market. With the continuous deepening of such products, the control of the detection method is very important, and therefore, the preparation and application of the quality control product are gradually concerned and paid attention. At present, two main detection targets of a gene typing detection product are genome DNA and crude extracts of blood or blood. The invention is mainly directed to a method or a product which takes blood or crude blood extract as a detection target. For such products, the quality control products adopted in the past are mainly artificially constructed plasmids, but the main problems of adopting the constructed plasmids as the quality control products are that the medical inspection mainly aims at detecting human blood or crude blood extracts, the plasmids as substitutes have incomparability, and especially unpredictable interference factors exist in the blood or crude blood extracts, which are not possessed by the plasmids.
Therefore, it is very important to find a quality control product with higher comparability and a preparation method thereof aiming at the detection method or product taking blood or crude blood extract as a detection target. In order to maximize the comparability of quality control products, we often use substances consistent with the detection target, i.e., crude blood or blood extracts in the art. Because the blood has instability in the processes of preservation, use and the like, the invention takes the crude extract of the blood as a quality control product and explains the performance of the quality control product and the preparation of the quality control product.
Disclosure of Invention
The invention aims to solve the technical problem of providing a quality control product which can be suitable for effectively controlling the quality of a blood direct-amplification genotyping product and a preparation method thereof.
The quality control product suitable for the genotyping product comprises leukocytes isolated from a sample in which the target gene is heterozygous.
Further, the Ct value of the quality control product is measured by using fluorescence PCR, and the Ct value is within the preset Ct value range for quality control product verification.
Further, the buffer solution A is also included, and the formula of the buffer solution A comprises:
Tris-HCl:5-8mmol/L
EDTA:0.5-1.5mmol/L
NP-40 (volume/mass percentage)
BSA：0.1-0.5mg/ml。
Further, the set method for verifying the Ct value range of the quality control product comprises the following steps: sequencing a clinical blood sample to screen out a sample with a target gene detection site as a heterozygote; screening a heterozygote sample with the leukocyte concentration in a specified range, processing the heterozygote sample to obtain a leukocyte solution, evaluating the Ct value of the leukocyte solution by using fluorescence PCR, and determining the preset Ct value range for quality control product verification.
More specifically, the preset Ct value range is 22-28.
Specifically, the white blood cells are obtained by the following method:
(1) Adding purified water or TE solution into the whole blood, and vortexing;
(2) And (4) centrifuging to settle the white blood cells, and removing supernatant to obtain the white blood cells.
The invention also provides a preparation method of the quality control product suitable for the blood direct amplification genotyping product, which comprises the confirmation of the screening condition of the quality control product and the preparation of the quality control product, wherein the confirmation of the screening condition of the quality control product comprises the following steps: firstly, designing and synthesizing a sequencing primer aiming at a target detection site; then, sequencing a clinical blood sample to screen out a sample with a target detection site as a heterozygote; finally, screening a heterozygote sample with the leukocyte concentration within a specified range, processing the heterozygote sample to obtain a leukocyte solution, evaluating the Ct value of the leukocyte solution by using fluorescence PCR, and determining the preset Ct value range of quality control product verification;
the preparation of the quality control product comprises the following steps: sequencing by using the sequencing primer, screening a heterozygous sub-sample with the leukocyte concentration within a specified range, then processing the heterozygous sub-sample to obtain a leukocyte solution, and determining the Ct value of the leukocyte solution by using fluorescence PCR; if the Ct value is within the preset Ct value range of the quality control product verification, the cell-coated solution is used as the quality control product for subsequent application;
the heterozygous daughter sample processing method comprises the following steps:
(1) Adding a red blood cell disruption reagent to the whole blood sample to disrupt red blood cells and release hemoglobin;
(2) Centrifuging the treatment solution obtained in the step (1) to precipitate leukocytes, and removing a supernatant;
(3) Buffer a solution was added to resuspend the leukocytes.
Further, the specified range refers to the range of leukocyte concentration in the blood sample of 4 × 10 9 -10×10 9 And (2) per liter.
Further, the processing method of the sample for fluorescence PCR comprises the following steps: (1) adding purified water with the volume of 5-10 times into EDTA (ethylene diamine tetraacetic acid) anticoagulated whole blood, and whirling for 30s; (2) centrifuging at 12000 Xg for 1min to allow the leukocytes to settle, and removing the supernatant; (3) add an equal volume of whole blood to resuspend in buffer A solution.
Further, the formula of the buffer solution A comprises: 5-8mmol/L Tris-HCl,0.5-1.5mmol/L EDTA,0.5-1% NP-40,0.1-0.5mg/ml BSA.
Furthermore, the template used for sequencing is selected from genomic DNA or blood.
The blood direct amplification is short for blood direct amplification.
The quality control product and the preparation method thereof can be used for effective quality control of blood direct-amplification genotyping products, and the precision and the stability of the quality control product meet the industrial requirements of the quality control product.
Drawings
FIG. 1 results of stability test at 37 ℃ in example 3.
FIG. 2 the results of the stability test at 2-8 ℃ in example 3.
FIG. 3 stability test results at-20 ℃ in example 3.
Detailed Description
The present invention will be described in further detail by taking the typing detection of SLCO1B1 (388A > -G) site mutation as an example.
Taking a buffer solution A as a quality control product storage solution, wherein the formula of the buffer solution A comprises:
Tris-HCl:5-8mmol/L
EDTA:0.5-1.5mmol/L
NP-40 (volume/mass percentage)
BSA：0.1-0.5mg/ml
Example 1 preparation method of quality control Material
With the purpose of detecting the typing of SLCO1B1 (388A > G) site mutation, the quality control product is prepared by the following steps:
(1) Designing and synthesizing a sequencing primer aiming at SLCO1B1 (388A > -G) locus, wherein the primer sequence is as follows:
SLCO1B1 (388A >: 5' GTGTTGTTAATGGGCGAACTGT-3
SLCO1B1 (388A >: 5' AATGGTGCAAATAAAGGGGAAT-3
(2) The sequencing primer is used for carrying out blood direct amplification, and after an amplification product is obtained, the amplification product is sent to a sequencing company for Sanger sequencing so as to screen heterozygotes. The specific blood direct expansion system and procedure were as follows:
an amplification system:
| components | Dosage of | Final concentration | |
| 2× | 10μl | 1× | |
| Upstream sequencing primer (10. Mu.M) | 0.8μl | 0.4μM | |
| Downstream sequencing primer (10. Mu.M) | 0.8μl | 0.4μM | |
| Whole blood | 2μl | / | |
| Purified water | Up to 20μl | / |
And (3) amplification procedure:
(3) In the above-selected heterozygote, a leukocyte concentration of 4X 10 was further selected 9 -10×10 9 The white blood cell concentration of each sample, 126 cases in total, was 4X 10 in clinically normal humans 9 -10×10 9 Per liter, i.e. the white blood cells are selected to be within the normal range and SLCO1B1 (388A) thereof>G) The gene locus is a sample of heterozygotes. And (3) carrying out sample processing on the screened 126 samples meeting the requirements, wherein the processing method comprises the following steps:
(1) to 100. Mu.l of EDTA-anticoagulated whole blood, 1ml of purified water or TE solution was added and vortexed for 30 seconds.
(2) The white blood cells were sedimented by centrifugation at 12000 Xg for 1min, and the supernatant was removed.
(3) Add 100. Mu.l of buffer A solution for resuspension.
Wherein the formula of the buffer solution A comprises:
Tris-HCl:6.5mmol/L
EDTA:1.1mmol/L
NP-40:0.8％
BSA：0.3mg/ml
(4) Fluorescence PCR amplification (SLCO 1B1 (388A > -G) primer and probe sequences as described below) yielded Ct values for each sample. The fluorescent PCR amplification system and procedure were as follows:
the sequence of the upstream primer is as follows: 5' TAAACAAGTGGATAAGGTCGATGTTG-one 3
The sequence of the downstream primer is as follows: 5' AGATAATGGTGCAAATAAAGGGGAAT-3
Wild-type probe sequence: 5 '-FAM-TCCCCTATATTCCACGAAGCA-MGBNFQ-3'
Mutant probe sequence:
5’-VIC-AATGTTTAAAATGAAACACTCTCTTATC-MGBNFQ-3’
an amplification system:
| name of material | Amount added (μ l) | Final concentration |
| 2 × Premix buffer (dNTP free) | 10 | 1× |
| dNTP Mix(10mM) | 0.4 | 200μM |
| ROX reference dye (0.5. Mu.M) | 0.8 | 0.02μM |
| Formamide DMF | 0.15 | / |
| Upstream primer (10. Mu.M) | 0.8 | 0.4μM |
| Downstream primer (10. Mu.M) | 1.6 | 0.8μM |
| Wild type probe (10. Mu.M) | 0.4 | 0.2μM |
| Mutant probe (10. Mu.M) | 0.9 | 0.45μM |
| Enzyme(6U/μl) | 0.4 | 1× |
| Form panel | 2 | / |
| Purified water | Up to 20 | / |
Fluorescent PCR amplification procedure:
(5) The Ct values were analyzed by SPSS software, as shown in Table 1.
TABLE 1
| N | Minimum value | Maximum value | Mean value | Standard deviation of | |
| Leukocyte concentration (. Times.109/L) | 126 | 4.05 | 10.00 | 6.6997 | 1.65566 |
| Ct(FAM) | 126 | 22.62 | 27.53 | 25.1644 | 1.12487 |
| Ct(VIC) | 126 | 22.64 | 27.93 | 25.5420 | 1.19340 |
| Effective N (List State) | 126 |
According to the table above, the Ct value range is determined to be 22-28.
(6) Screening for leukocytes at a concentration of 4X 10 9 -10×10 9 And (3) carrying out heterozygote sequencing verification on the heterozygote sample of each L in the same steps (1) and (2).
(7) And (4) processing the sample screened in the step (6), wherein the processing method is as follows:
(1) to 100. Mu.l of EDTA-anticoagulated whole blood was added 1ml of purified water, and vortexed for 30 seconds.
(2) The white blood cells were sedimented by centrifugation at 12000 Xg for 1min, and the supernatant was removed.
(3) Add 100. Mu.l of buffer A solution for resuspension.
Wherein the formula of the buffer solution A comprises:
Tris-HCl:5mmol/L
EDTA:0.5mmol/L
NP-40:0.5％
BSA：0.1mg/ml
(8) And (3) performing fluorescence PCR amplification to obtain a corresponding Ct value, observing whether the Ct value range is between 22 and 28, if so, taking the tube product as a quality control product, and if not, discarding the tube product.
The above steps (1) to (5) can be regarded as the quality control screening condition confirmation step. The steps (6) to (8) may be regarded as quality control preparation steps according to quality control screening conditions.
The sample sequencing method in the quality control screening condition confirmation step and the quality control preparation step may be performed after amplification using genomic DNA as a template, or may be performed after amplification using blood as a template. In this example, the sequencing after amplification was performed using blood as a template.
Example 2 precision measurement of quality control Material
1. Experimental method
The same lot of quality control samples prepared in example 1 were each continuously measured 10 times with reference to the industry Standard (YY/T1182-2010) for nucleic acid amplification assay reagent (kit), and the average value of the measurement results was calculated
And standard deviation S 1 Calculating the variation coefficient in the tube according to the following formula>
2. The index requirement is as follows: CV is less than or equal to 5 percent
3. The experimental results are as follows: see Table 2 below
TABLE 2
4. Description of the results
The precision of the quality control product in the batch is less than or equal to 5 percent.
Example 3 stability test of quality control Material
1. Experimental methods
The quality control products prepared in example 1 were subjected to stability tests at 37 deg.C, 2-8 deg.C and-20 deg.C, respectively, wherein 37 deg.C is a thermal stability test, 2-8 deg.C is a temporal stability test (to evaluate whether short-term use can be temporally stored at 2-8 deg.C to avoid repeated freeze thawing), and-20 deg.C is an expiration stability test.
The above-mentioned treated quality control products were subjected to fluorescent PCR amplification (SLCO 1B1 (388A >) with the following primer and probe sequences) to analyze Ct values. The specific amplification system and procedure were as follows:
the sequence of the upstream primer is as follows: 5' TAAACAAGTGGATAAGGTCGATGTG
The sequence of the downstream primer is as follows: 5' AGATAATGGTGCAAATAAAGGGGAAT-3
Wild-type probe sequence: 5'-FAM-TCCCCTATTCCACGAAGCA-MGBNFQ-3'
Mutant probe sequence:
5’-VIC-AATGTTTAAAATGAAACACTCTCTTATC-MGBNFQ-3’
an amplification system:
| name of material | Addition amount (μ l) | Final concentration |
| 2 × Premix buffer (dNTP free) | 10 | 1× |
| dNTP Mix(10mM) | 0.4 | 200μM |
| ROX reference dye (0).5μM) | 0.8 | 0.02μM |
| Formamide DMF | 0.15 | / |
| Upstream primer (10. Mu.M) | 0.8 | 0.4μM |
| Downstream primer (10. Mu.M) | 1.6 | 0.8μM |
| Wild type probe (10. Mu.M) | 0.4 | 0.2μM |
| Mutant probe (10. Mu.M) | 0.9 | 0.45μM |
| Enzyme(6U/μl) | 0.4 | 1× |
| Form panel | 2 | / |
| Purified water | Up to 20 | / |
And (3) amplification procedure:
2. results of the experiment
The results of the above three conditions were analyzed and shown in FIGS. 1 to 3. The result shows that the quality control product prepared in the example 1 has better thermal stability for 15 days at 37 ℃; under the condition of 2-8 ℃, the stability of the temporary storage is good for 8 weeks; the shelf life stability of the product is good at 24 months under the condition of-20 ℃.
SEQUENCE LISTING
<110> Hangzhou Baimai biological shares Ltd
<120> quality control material for genotyping detection and preparation method thereof
<130> 201902
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence
<400> 1
gtgttgttaa tgggcgaact gt 22
<210> 2
<211> 22
<212> DNA
<213> Artificial sequence
<400> 2
aatggtgcaa ataaagggga at 22
<210> 3
<211> 26
<212> DNA
<213> Artificial sequence
<400> 3
taaacaagtg gataaggtcg atgttg 26
<210> 4
<211> 26
<212> DNA
<213> Artificial sequence
<400> 4
agataatggt gcaaataaag gggaat 26
<210> 5
<211> 19
<212> DNA
<213> Artificial sequence
<400> 5
tcccctattc cacgaagca 19
<210> 6
<211> 28
<212> DNA
<213> Artificial sequence
<400> 6
aatgtttaaa atgaaacact ctcttatc 28
Claims (10)
1. A quality control material suitable for a genotyping product, comprising leukocytes isolated from a sample in which the target gene is heterozygous, and a buffer A, wherein the buffer A comprises: 5-8mmol/L Tris-HCl,0.5-1.5mmol/L EDTA,0.5-1% volume mass percent NP-40 and 0.1-0.5mg/ml BSA.
2. The quality control product according to claim 1, wherein the Ct value of the quality control product is measured by fluorescence PCR and is within a preset Ct value range for quality control product verification.
3. The quality control product of claim 2, wherein the set quality control product verification Ct value range method comprises: sequencing a clinical blood sample to screen out a sample with a target gene detection site being a heterozygote; screening a heterozygote sample with the leukocyte concentration within a specified range, processing the heterozygote sample to obtain a leukocyte solution, evaluating the Ct value of the leukocyte solution by using fluorescence PCR, and determining the preset Ct value range for quality control product verification.
4. The quality control product according to claim 1, wherein the leukocytes are obtained by:
(1) Adding purified water or TE solution into the whole blood, and vortexing;
(2) And (4) centrifuging to settle the white blood cells, and removing supernatant to obtain the white blood cells.
5. A preparation method of quality control products suitable for blood direct amplification genotyping products comprises the confirmation of quality control product screening conditions and the preparation of the quality control products, and is characterized in that,
the quality control product screening condition confirming step comprises the following steps: firstly, designing and synthesizing a sequencing primer aiming at a target detection site; then sequencing the clinical blood sample to screen out a sample with heterozygote as a target detection site; finally, screening a heterozygote sample with the leukocyte concentration within a specified range, processing the heterozygote sample to obtain a leukocyte solution, evaluating the Ct value of the leukocyte solution by using fluorescence PCR, and determining the preset Ct value range of quality control product verification;
preparing a quality control product: sequencing by using the sequencing primer, screening a heterozygous sub-sample with the leukocyte concentration within a specified range, then processing the heterozygous sub-sample to obtain a leukocyte solution, and determining the Ct value of the leukocyte solution by using fluorescence PCR; if the Ct value is within the preset quality control product verification Ct value range, the leukocyte solution is used as a quality control product for subsequent application;
the heterozygous son sample processing method comprises the following steps:
(1) Adding a red blood cell disruption reagent to the whole blood sample to disrupt red blood cells and release hemoglobin;
(2) Centrifuging the treatment solution obtained in step (1) to precipitate leukocytes, and removing the supernatant;
(3) Adding a buffer solution A to resuspend the white blood cells, wherein the formula of the buffer solution A comprises: 5-8mmol/L Tris-HCl,0.5-1.5mmol/L EDTA,0.5-1% volume mass percent NP-40 and 0.1-0.5mg/ml BSA.
6. The method of claim 5, wherein the specified range is a range of 4 x 10 leukocyte concentration in the blood sample 9 -10×10 9 And (2) per liter.
7. The method of claim 5, wherein the sample processing method for fluorescence PCR comprises: (1) adding purified water with the volume of 5-10 times into EDTA (ethylene diamine tetraacetic acid) anticoagulated whole blood, and whirling for 30s; (2) centrifuging at 12000 Xg for 1min to allow the leukocytes to settle, and removing the supernatant; (3) adding whole blood into an equal volume of buffer solution A for resuspension, wherein the formula of the buffer solution A comprises: 5-8mmol/L Tris-HCl,0.5-1.5mmol/L EDTA,0.5-1% volume mass percent NP-40 and 0.1-0.5mg/ml BSA.
8. The method of claim 5, wherein the template used for sequencing is selected from the group consisting of genomic DNA or blood.
9. The method according to claim 5, wherein the erythrocyte lysis reagent comprises purified water or TE solution.
10. Use of the quality control material according to any one of claims 1 to 4 for quality control of a blood direct-amplification genotyping product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910980422.2A CN112662746B (en) | 2019-10-15 | 2019-10-15 | Quality control product for genotyping detection and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910980422.2A CN112662746B (en) | 2019-10-15 | 2019-10-15 | Quality control product for genotyping detection and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112662746A CN112662746A (en) | 2021-04-16 |
| CN112662746B true CN112662746B (en) | 2023-04-11 |
Family
ID=75400085
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910980422.2A Active CN112662746B (en) | 2019-10-15 | 2019-10-15 | Quality control product for genotyping detection and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662746B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011240A (en) * | 2016-05-19 | 2016-10-12 | 合肥艾迪康临床检验所有限公司 | Fusion gene indoor quality control product, manufacturing method and recipe of fixing solution of fusion gene indoor quality control product |
| CN106978501A (en) * | 2017-05-02 | 2017-07-25 | 陈超 | A kind of method of the direct real-time fluorescence PCR of whole blood |
| CN108070636A (en) * | 2016-11-16 | 2018-05-25 | 天津安必森生物技术有限公司 | A kind of processing method and kit of fluorescent PCR amplified sample |
Family Cites Families (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102749238B (en) * | 2012-07-04 | 2014-10-01 | 烟台卓越生物技术有限责任公司 | Blood station negative-filtered leukocyte eluting and fixing method and dedicated filter therefor |
| GB201414350D0 (en) * | 2014-08-13 | 2014-09-24 | Progenika Biopharma Sa | Consensus-based allele detection |
| CN106399560A (en) * | 2016-11-21 | 2017-02-15 | 武汉海吉力生物科技有限公司 | Primer, probe and kit for detecting gene polymorphism of CYP2C9 and VKORC1 |
| CN106520979A (en) * | 2016-11-30 | 2017-03-22 | 武汉海吉力生物科技有限公司 | Nucleic acid, kit and method for detecting G1165C polymorphism of human ADRB1 gene |
| CN108192965B (en) * | 2017-12-30 | 2021-09-10 | 北京中科唯新生物医学研究所有限公司 | Method for detecting heterogeneity of mitochondrial genome A3243G locus |
| CN109536597A (en) * | 2018-08-28 | 2019-03-29 | 天津安必森生物技术有限公司 | A kind of kit and its PCR method of the ApoE Genotyping detection of compatible blood genomic DNA sample |
-
2019
- 2019-10-15 CN CN201910980422.2A patent/CN112662746B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106011240A (en) * | 2016-05-19 | 2016-10-12 | 合肥艾迪康临床检验所有限公司 | Fusion gene indoor quality control product, manufacturing method and recipe of fixing solution of fusion gene indoor quality control product |
| CN108070636A (en) * | 2016-11-16 | 2018-05-25 | 天津安必森生物技术有限公司 | A kind of processing method and kit of fluorescent PCR amplified sample |
| CN106978501A (en) * | 2017-05-02 | 2017-07-25 | 陈超 | A kind of method of the direct real-time fluorescence PCR of whole blood |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662746A (en) | 2021-04-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103890191A (en) | Methods of amplifying whole genome of a single cell | |
| CN111020031A (en) | Method for detecting tumor gene mutation by combining sequence specific blocker with specific PCR (polymerase chain reaction) program | |
| CN110577987A (en) | Detection method of CGG (glutamic acid G) repetitive sequence of FMR1 gene and application thereof | |
| CN111690748B (en) | Probe set for detecting microsatellite instability by using high-throughput sequencing, kit and microsatellite instability detection method | |
| CN114574557B (en) | General type preclinical biodistribution detection kit for NK cell therapy products | |
| Zhang et al. | RNA analysis from newborn screening dried blood specimen | |
| CN110777154A (en) | Mutant gene for drug resistance detection of mycobacterium tuberculosis, and detection method and kit thereof | |
| CN112662746B (en) | Quality control product for genotyping detection and preparation method thereof | |
| CN105803050B (en) | Primer and method for detecting CHO cell DNA | |
| CN115820837A (en) | PCR (polymerase chain reaction) detection kit for corneal dystrophy and application thereof | |
| CN110894524A (en) | Method for rapidly preparing gene mutation reference substance | |
| CN113462783B (en) | Brain glioma chromosome lp/19q detection method based on MassArray nucleic acid mass spectrum and application thereof | |
| CN115418394A (en) | Composition, kit and method for detecting CHO cell genome DNA | |
| Antunes et al. | Developmental Validation of the ForenSeq® Kintelligence Kit, MiSeq Fgx® Sequencing System and ForenSeq Universal Analysis Software | |
| CN114908147A (en) | RT-qPCR detection method for distribution of human mesenchymal stem cells in mouse and application thereof | |
| CN109897822B (en) | Establishment and application of human immortalized B lymphocyte cell line | |
| CN113249441A (en) | Reference substance for detecting pathogenic microorganisms infected with blood influenza and preparation method thereof | |
| CN112899365A (en) | Detection method and kit for lung cancer gene mutation site | |
| TWI646198B (en) | Method for screening high risk of liver cancer by using hepatitis B virus gene sequence | |
| CN112094842B (en) | Annular blocking probe, amplification blocking mutation system containing annular blocking probe and application of amplification blocking mutation system | |
| CN117737233B (en) | UAP oligonucleotides, kits and methods for detecting HLA-A29 alleles | |
| Tatarkina et al. | Isolation of highly purified genomic material from mitochondria of muscle tissue cells | |
| CN113667744A (en) | Gene polymorphism detection kit for rocuronium bromide metabolic marker and detection method and application thereof | |
| CN117417987A (en) | Primer pair for quantitatively detecting size distribution of PG13 cell DNA fragment and detection method | |
| EP3880850A1 (en) | New methods for species identification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |