CN112662664A - Screening method of specifically-bound sarafloxacin hydrochloride aptamer - Google Patents
Screening method of specifically-bound sarafloxacin hydrochloride aptamer Download PDFInfo
- Publication number
- CN112662664A CN112662664A CN202110114246.1A CN202110114246A CN112662664A CN 112662664 A CN112662664 A CN 112662664A CN 202110114246 A CN202110114246 A CN 202110114246A CN 112662664 A CN112662664 A CN 112662664A
- Authority
- CN
- China
- Prior art keywords
- magnetic beads
- magnetic
- buffer
- washing
- value
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A screening method of a specifically-bound sarafloxacin hydrochloride aptamer relates to the technical field of chemical analysis. The invention provides a nucleic acid aptamer which has higher affinity specificity than a protein antibody, has no immunogenicity, can be chemically synthesized, has small molecular weight and stable property and can be used for detecting sarafloxacin hydrochloride. The invention adopts SELEX technology, uses sarafloxacin hydrochloride as a target material, and screens out an aptamer specifically combined with the sarafloxacin hydrochloride.
Description
Technical Field
The invention relates to the technical field of chemical analysis, in particular to a screening method of a specific binding sarafloxacin hydrochloride aptamer.
Background
Aptamers (also known as aptamers) are artificially synthesized ssDNA or RNA fragments that can specifically bind to a target molecule, which are screened by the exponential enrichment of ligand systems evolution (SELEX) technique. The aptamer has the advantages of wide target molecules, strong affinity, easy modification and the like, and is widely applied in the aspects of molecular chemistry, food safety, clinical diagnosis, treatment and the like.
SELEX is a new technology for screening target nucleic acid aptamer by constructing an artificially synthesized random oligonucleotide library in vitro by using the principle of combinatorial chemistry and through the specific combination of a sequence in the library and a target. Because the random library contains a large number of single-stranded oligonucleotide fragments with different primary structures, different spatial structures can be formed when the single-stranded oligonucleotide fragments meet target molecules in a solution, and due to the diversity of the spatial structures, the target molecules can be screened out nucleic acid sequences with high affinity and specificity by a conformation matching mode.
Sarafloxacin is a very highly effective antibacterial agent, however, it may be a residue in milk and animal derived foods. These residues may cause health problems in humans, affect the respiratory tract, urinary tract, gastrointestinal tract and skin, and may also contribute to the development of antibiotic-resistant pathogens. Due to the toxicity of the sarafloxacin, the use of the sarafloxacin in a large amount by poultry and fishes can cause antibiotic residues, thereby bringing about extremely serious consequences to the food safety of people. The use of sarafloxacin in large quantities by poultry and fish can cause antibiotic residues, which bring extremely serious consequences to the food safety of people. Corresponding residual standards are already established in some countries such as the United states, European Union (EU), the Maximum Residual Limit (MRL) of the sarafloxacin in chicken is specified to be 10 mug/kg, and the highest content of the sarafloxacin in animal-derived food specified by the Ministry of agriculture in China is not more than 80 mug/kg. Two ssDNA aptamers capable of being specifically combined with sarafloxacin hydrochloride are obtained by a SELEX technology (Mag-SELEX) based on magnetic separation in the experiment.
Disclosure of Invention
The invention aims to overcome the defects of the existing detection technology and provide the aptamer which has higher affinity specificity than a protein antibody, no immunogenicity, can be chemically synthesized, has small molecular weight and stable property and can be used for detecting the sarafloxacin hydrochloride. The invention adopts SELEX technology, uses sarafloxacin hydrochloride as a target material, and screens out an aptamer specifically combined with the sarafloxacin hydrochloride.
The above purpose is realized by the following technical scheme:
1. the original random ssDNA (single-stranded DNA) library and primers shown by the following sequences were synthesized:
original random ssDNA library:
5’-AAGGAGCAGCGTGGAGGATA-N40-TTAGGGTGTGTCGTCGTGGT-3’；
an upstream primer: 5'-AAGGAGCAGCGTGGAGGATA-3'
A downstream primer 1: 5'-ACCACGACGACACACCCTAA-3'
A downstream primer 2: 5 '-bio-ACCACGACGACACACCCTAA-3'
SELEX screening of specific aptamers
2.1 solutions required for the Experimental procedures
(1) A100 mL screening solution Selection Buffer preparation method comprises the following steps: 0.037g KCl, 0.011g CaCl2，0.5844g NaCl，0.019g MgCl20.24g of Tris, 20 mu L of Tween 20, adjusting the pH value to 7.6, and supplementing 100mL of deionized water;
(2) a100 mL cleaning solution Washing Buffer preparation method comprises the following steps: 21g Urea, 0.48g Tris, 0.37g EDTA Na220 mu L of Tween 20, adjusting the pH value to 8.0, and supplementing 100mL of deionized water;
(3) configuration method of 100mL Binding and Washing (BW) Buffer of combined eluent: 0.12g Tris, 0.037g EDTA Na211.68g of NaCl, adjusting the pH value to 7.4, and supplementing 100mL of deionized water;
(4) the preparation method of 100mL amino magnetic bead coupling buffer solution comprises the following steps: 1.95g of 2-morpholine ethanesulfonic acid, adjusting the pH value to 4.0, and supplementing 100mL of deionized water;
(5) preparation method of 100mL amino magnetic bead blocking buffer: 2.4g Tris, adjusting the pH value to 8.0, and supplementing 100mL with deionized water;
(6) preparation method of 100mL streptavidin magnetic bead binding buffer solution: 5.84g NaCl, 0.24g Tris, 0.037g EDTA Na220 mu L of Tween 20, adjusting the pH value to 7.8, and supplementing 100mL of deionized water;
2.2 amino-magnetic bead-coupled Sarafloxacin hydrochloride
(1) Before use, the amino magnetic beads were shaken on a magnetic separator for 20 seconds and mixed well. Pipette 50. mu.L of magnetic beads into a 1.5mL centrifuge tube, wash the magnetic beads 2 times with 200. mu.L of amino magnetic bead coupling buffer, settle the magnetic beads with a magnet, and pipette off the supernatant.
(2) To the washed amino magnetic beads, 60. mu.L of a 2mg/mL sarafloxacin hydrochloride solution was added. At the same time, 50mg/mL EDC-HCL (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride) was prepared with cold deionized water, 30. mu.L EDC-HCL solution was added to the system, vortexed, and incubated for 2 hours in a 30 ℃ shaker at 120 rpm.
(3) Adding 200 mu L of amino magnetic bead blocking buffer solution into the centrifuge tube to resuspend the magnetic beads, and incubating for 30 minutes in a shaking table at 30 ℃ with 120-rotation shaking. After incubation, the beads were settled with a magnet and the supernatant was removed by pipetting.
(4) The beads were washed 2 times repeatedly with 200. mu.L of phosphate buffered saline, the beads were settled with a magnet, and the supernatant was removed by pipetting. Finally, 100. mu.L of phosphate buffer solution is added into the magnetic beads to resuspend the magnetic beads, and the magnetic beads are stored at 4 ℃ for subsequent experiments.
2.3SELEX in vitro screening
(1) mu.L of 10. mu.M ssDNA library was added to a centrifuge tube, denatured at 95 ℃ for 5 minutes, immediately subjected to ice-water bath for 10 minutes, added with 100. mu.L of Selection Buffer, mixed well in the centrifuge tube, and incubated at 25 ℃ for 20 minutes for further use.
(2) And (3) taking 100 mu L of magnetic beads coupled with sarafloxacin hydrochloride, washing the magnetic beads with 400 mu L of Selection Buffer for 3 times, removing supernatant, adding the ssDNA library uniformly mixed with the Selection Buffer in the step (1), and performing shake incubation for 1 hour at 120 revolutions in a shaking table at 25 ℃.
(3) After the incubation, the magnetic beads were settled by a magnet for magnetic separation, ssDNA not bound to the sarafloxacin hydrochloride-magnetic beads was discarded by a pipette, and the magnetic beads were washed 3 times with 200. mu.L Washing Buffer.
(4) After Washing, the magnetic beads were settled with a magnet, 50. mu.L of Binding and Washing Buffer was added to the magnetic beads, mixed well, and water-washed at 95 ℃ for 5 minutes. The beads were then sedimented with a magnet and the supernatant was aspirated for use.
2.4PCR amplification
Taking the supernatant as a template, and carrying out PCR amplification by using a downstream primer 2 and an upstream primer. PCR reaction
The method comprises the following steps:
template 3. mu.L
2 mu L of upstream primer
Downstream primer 22. mu.L
ddH2O 18μL
2×Premix Taq 25μL
And (3) PCR reaction conditions: 1. pre-denaturation at 94 ℃ for 1 min; 2. denaturation at 94 ℃ for 30 s; 3. annealing at 60 deg.C for 30s4, and extending at 72 deg.C for 1 min; 5. extending for 2min at 72 ℃; 6. preserving at constant temperature of 4 ℃; wherein 2-4 steps are set for circulation, and the circulation time is 30 times;
2.5 preparation of Secondary ssDNA libraries
(1) Taking 70 mu L of streptavidin magnetic beads, Washing the streptavidin magnetic beads for 3 times by 200 mu L of Washing Buffer, settling the magnetic beads by a magnet, absorbing the supernatant by a pipette gun, adding 100 mu L of streptavidin combined Buffer solution, uniformly mixing the magnetic beads, taking PCR products, adding the PCR products into the streptavidin magnetic beads, shaking and shaking the mixture in a shaking table at the temperature of 30 ℃ for 30 minutes, settling the magnetic beads by the magnet for magnetic separation, absorbing the supernatant by the pipette gun, Washing the magnetic beads by 200 mu L of Washing Buffer for 3 times, settling the magnetic beads by the magnet for magnetic separation, and absorbing the supernatant by the pipette gun.
(2) Adding 50 mu L of 0.2mol/L sodium hydroxide solution into streptavidin magnetic beads coupled with a PCR product of biotin, reacting for 15 minutes in a 120-rotation shaking table at 37 ℃, depositing magnetic beads for magnetic separation, sucking supernatant into a centrifuge tube by using a pipette gun, adding 2mol/L dilute hydrochloric acid into the centrifuge tube, and adjusting the pH to 7.0 by using an extensive pH test paper. This secondary ssDNA library was used for the next round of screening.
2.6 detection
(1) The resulting secondary library was divided into three portions, one portion was saved, one portion was used for Q-PCR detection and one portion was used for the next round of screening.
(2) And (3) performing Q-PCR detection by using the secondary library as a template and the downstream primer 1 and the upstream primer, and analyzing a melting curve to judge the specificity of amplification. The Q-PCR system comprises: template 2. mu.L, SYRB mix 10. mu.L, forward primer 0.2. mu.L, reverse primer 10.2. mu.L, ddH2O 7μL；
The Q-PCR program included: pre-denaturation at 95 ℃ for 30s, 30 cycles of denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 70 ℃ for 15s, and finally adding a melting curve program.
(3) The Ct value measured by Q-PCR should be reduced by one round. The fluorescence threshold is set to 100, the Ct value of the sample has a linear relation with the logarithm of the initial copy number of the template, and the Ct value is smaller when the amount of the template is larger. And (4) calculating the Ct value according to the amplification curve, wherein the Ct value of the screened secondary library is not reduced any more, which indicates that the binding rate of the secondary library and the target molecule is not increased any more, and the screening is stopped.
2.7 authentication
After the secondary library obtained by each round of screening is amplified by PCR, agarose gel electrophoresis with 2% volume fraction is used for detecting, and whether the size of the obtained band is about 80bp is compared with a marker.
The agarose gel electrophoresis procedure was as follows:
(1) preparing agarose solution with proper volume concentration by using 1 XTAE solution according to the number of the sample and the size of the target band, putting the agarose solution into a microwave oven to be heated for 1 minute until agarose is dissolved, adding nucleic acid dye according to the volume ratio of 1:10000 after slight cooling, pouring the agarose solution into a gel-making glass plate, and inserting a comb.
(2) And after the gel is solidified, vertically pulling out the comb. The gel is put into electrophoresis tank 1 XTAE nucleic acid electrophoresis buffer solution, and the sample loading buffer solution are mixed according to the corresponding proportion and then loaded. The power is turned on for 120V until the bromophenol blue moves to the lower edge of the glue.
(3) The gel was imaged in a gel imaging system.
3. High throughput sequencing and sequence analysis
And performing agarose gel electrophoresis after PCR amplification on the final round of screening products, cutting and recovering the 80bp strip, and then sending the strip to a company for high-throughput sequencing. Sending the sequence with the most occurrence times in the high-throughput sequencing result to a company for synthesis, then carrying out Kd value detection, and predicting the secondary structure of the sequence by using software. The sequencing result excludes the sequence forming primer dimer and containing the complementary strand of the forward primer and the reverse primer 1. The two sequences with the lowest Kd and the highest affinity with the target molecule are as follows:
F1:AAGGAGCAGCGTGGAGGATACTCCGTGCGATCGCCGGGGACCGAAGAATCGTTCACATCGTTAGGGTGTGTCGTCGTGGT
B1:AAGGAGCAGCGTGGAGGATACCATCCACCTAGCATCCATAGGCGAACACTTTCTTGGGGCTTAGGGTGTGTCGTCGTGGT
the sequence contains the reverse complementary strand sequence ACCACGACGACACACCCTAA of the forward primer AAGGAGCAGCGTGGAGGATA and the reverse primer 1.
The intermediate sequence of the two aptamers and the 40bp without similarity of the primers are parts capable of being combined with the target sarafloxacin hydrochloride, wherein G% is 37.5% and 32.5% respectively. The partial sequence was sent to Jinzhi Biotechnology Ltd for synthesis and purified by hPAGE. Aptamer secondary structure was predicted by software as shown in figure 1.
4. Aptamer Kd value
(1) Preparing a gradient concentration aptamer solution: each aptamer of 5' -modified FAM was formulated in a series of concentrations (1000nM, 500nM, 300nM, 200nM, 100nM, 50nM, 20nM, 0nM) using Selection Buffer.
(2) Pipetting 80. mu.L of sarafloxacin hydrochloride-amino magnetic beads, transferring the sarafloxacin hydrochloride-amino magnetic beads into a centrifuge tube, settling the magnetic beads by a magnet for magnetic separation, and pipetting and removing supernatant liquid by a pipette gun. And then Washing the magnetic beads 3 times by using 200 mu L Washing Buffer, respectively packaging in 8 centrifuge tubes, respectively absorbing 100 mu L of the aptamers diluted in the step 1 and with different gradient concentrations by using a pipette gun, respectively carrying out water bath at 95 ℃ for 5 minutes and ice water bath for 10 minutes, respectively adding the aptamers into the washed amino magnetic beads coupled with sarafloxacin hydrochloride, shaking up, and carrying out incubation in a constant temperature 120 rotary table at 37 ℃ for 30 minutes in a dark place.
(3) After the incubation, the magnetic beads were settled by a magnet for magnetic separation, the supernatant was aspirated by a pipette gun, and the aptamer-immunomagnetic beads-sarafloxacin hydrochloride was washed 3 times with 200. mu.L of Washing buffer. The magnetic beads were sedimented with a magnet for magnetic separation, the aptamers that did not bind to the aptamer-immunomagnetic beads-sarafloxacin hydrochloride were removed with a pipette, and finally the magnetic beads were resuspended in 200. mu.L Washing buffer and the fluorescence intensity was measured with a microplate reader at the absorption and emission wavelength (488/520 nm).
(4) Each aptamer was analyzed for K according to equation 2-2dThe value is obtained.
Y＝Bmax×X÷(Kd+X)
Wherein Y is the measured fluorescence intensity; b ismaxMaximum fluorescence intensity; x is the concentration of the aptamer.
The invention has the advantages that:
(1) compared with the traditional screening technology, the method has the advantages of simple and convenient operation and low cost of the screening process.
(2) The aptamer can be screened in vitro, has short screening period, strong stability, convenient synthesis and easy labeling of various reporter molecules, and can be stored and used for a long time.
(3) The aptamer obtained by screening can be combined with sarafloxacin hydrochloride, and has high affinity.
(4) The aptamer is used for modifying different reporter molecules, so that various biosensors can be constructed for detecting the concentration of the sarafloxacin hydrochloride in the food.
Description of the drawings:
FIG. 1: secondary structure of sarafloxacin hydrochloride aptamer.
FIG. 2: and fitting the kd values of the aptamers in a nonlinear manner.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
The above purpose is realized by the following technical scheme:
example 1 Synthesis of ssDNA libraries and primers shown below:
original random ssDNA library:
5’-AAGGAGCAGCGTGGAGGATA-N40-TTAGGGTGTGTCGTCGTGGT-3’；
an upstream primer: 5'-AAGGAGCAGCGTGGAGGATA-3'
A downstream primer 1: 5'-ACCACGACGACACACCCTAA-3'
A downstream primer 2: 5 '-bio-ACCACGACGACACACCCTAA-3'
Example 2 screening of specific aptamers by SELEX technology
2.1 solutions required for the Experimental procedures
(1) A100 mL screening solution Selection Buffer preparation method comprises the following steps: 0.037g KCl, 0.011g CaCl2，0.5844g NaCl，0.019g MgCl20.24g of Tris, 20 mu L of Tween 20, adjusting the pH value to 7.6, and supplementing 100mL of deionized water;
(2)100mL washThe preparation method of the liquid Washing Buffer comprises the following steps: 21g Urea, 0.48g Tris, 0.37g EDTA Na220 mu L of Tween 20, adjusting the pH value to 8.0, and supplementing 100mL of deionized water;
(3) configuration method of 100mL Binding and Washing (BW) Buffer of combined eluent: 0.12g Tris, 0.037g EDTA Na211.68g of NaCl, adjusting the pH value to 7.4, and supplementing 100mL of deionized water;
(4) the preparation method of 100mL amino magnetic bead coupling buffer solution comprises the following steps: 1.95g of 2-morpholine ethanesulfonic acid, adjusting the pH value to 4.0, and supplementing 100mL of deionized water;
(5) preparation method of 100mL amino magnetic bead blocking buffer: 2.4g Tris, adjusting the pH value to 8.0, and supplementing 100mL with deionized water;
(6) preparation method of 100mL streptavidin magnetic bead binding buffer solution: 5.84g NaCl, 0.24g Tris, 0.037g EDTA Na2, 20. mu.L Tween 20, pH adjusted to 7.8, made up to 100mL with deionized water;
2.2 amino-magnetic bead-coupled Sarafloxacin hydrochloride
(1) Before use, the amino magnetic beads were shaken on a magnetic separator for 20 seconds and mixed well. Pipette 50. mu.L of magnetic beads into a 1.5mL centrifuge tube, wash the magnetic beads 2 times with 200. mu.L of amino magnetic bead coupling buffer, settle the magnetic beads with a magnet, and pipette off the supernatant.
(2) To the washed amino magnetic beads, 60. mu.L of a 2mg/mL sarafloxacin hydrochloride solution was added. At the same time, 50mg/mL EDC-HCL (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride) was prepared with cold deionized water, 30. mu.L EDC-HCL solution was added to the system, vortexed, and incubated for 2 hours in a 30 ℃ shaker at 120 rpm.
(3) Adding 200 mu L of amino magnetic bead blocking buffer solution into the centrifuge tube to resuspend the magnetic beads, and incubating for 30 minutes in a shaking table at 30 ℃ with 120-rotation shaking. After incubation, the beads were settled with a magnet and the supernatant was removed by pipetting.
(4) The beads were washed 2 times repeatedly with 200. mu.L of phosphate buffered saline, the beads were settled with a magnet, and the supernatant was removed by pipetting. Finally, 100. mu.L of phosphate buffer solution is added into the magnetic beads to resuspend the magnetic beads, and the magnetic beads are stored at 4 ℃ for subsequent experiments.
2.3SELEX in vitro screening
(1) mu.L of 10. mu.M ssDNA library was added to a centrifuge tube, denatured at 95 ℃ for 5 minutes, immediately subjected to ice-water bath for 10 minutes, added with 100. mu.L of Selection Buffer, mixed well in the centrifuge tube, and incubated at 25 ℃ for 20 minutes for further use.
(2) And (3) taking 100 mu L of magnetic beads coupled with sarafloxacin hydrochloride, using 400 mu L of Selection Buffer clear for 3 times, absorbing and removing the supernatant, adding the ssDNA library uniformly mixed with the Selection Buffer in the step (1), and performing shake incubation for 1 hour at 120 revolutions in a shaking table at 25 ℃.
(3) After the incubation, the magnetic beads were settled by a magnet for magnetic separation, ssDNA not bound to the sarafloxacin hydrochloride-magnetic beads was discarded by a pipette, and the magnetic beads were washed 3 times with 200. mu.L Washing Buffer.
(4) After Washing, the magnetic beads were settled with a magnet, 50. mu.L of Binding and Washing Buffer was added to the magnetic beads, mixed well, and water-washed at 95 ℃ for 5 minutes. The beads were then sedimented with a magnet and the supernatant was aspirated for use.
2.4PCR amplification
Taking the supernatant as a template, and carrying out PCR amplification by using a downstream primer 2 and an upstream primer. PCR reaction
The method comprises the following steps:
template 3. mu.L
2 mu L of upstream primer
Downstream primer 22. mu.L
ddH2O 18μL
2×Premix Taq 25μL
And (3) PCR reaction conditions: 1. pre-denaturation at 94 ℃ for 1 min; 2. denaturation at 94 ℃ for 30 s; 3. annealing at 60 deg.C for 30s4, and extending at 72 deg.C for 1 min; 5. extending for 2min at 72 ℃; 6. preserving at constant temperature of 4 ℃; wherein 2-4 steps are set for circulation, and the circulation time is 30 times;
2.5 preparation of Secondary ssDNA libraries
(1) Taking 70 mu L of streptavidin magnetic beads, Washing the streptavidin magnetic beads for 3 times by 200 mu L of Washing Buffer, settling the magnetic beads by a magnet, absorbing the supernatant by a pipette gun, adding 100 mu L of streptavidin combined Buffer solution, uniformly mixing the magnetic beads, taking PCR products, adding the PCR products into the streptavidin magnetic beads, shaking and shaking the mixture in a shaking table at the temperature of 30 ℃ for 30 minutes, settling the magnetic beads by the magnet for magnetic separation, absorbing the supernatant by the pipette gun, Washing the magnetic beads by 200 mu L of Washing Buffer for 3 times, settling the magnetic beads by the magnet for magnetic separation, and absorbing the supernatant by the pipette gun.
(2) Adding 50 mu L of 0.2mol/L sodium hydroxide solution into streptavidin magnetic beads coupled with a PCR product of biotin, reacting for 15 minutes in a 120-rotation shaking table at 37 ℃, depositing magnetic beads for magnetic separation, sucking supernatant into a centrifuge tube by using a pipette gun, adding 2mol/L dilute hydrochloric acid into the centrifuge tube, and adjusting the pH to 7.0 by using an extensive pH test paper. This secondary ssDNA library was used for the next round of screening.
2.6 detection
(1) The resulting secondary library was divided into three portions, one portion was saved, one portion was used for Q-PCR detection and one portion was used for the next round of screening.
(2) And (3) performing Q-PCR detection by using the secondary library as a template and the downstream primer 1 and the upstream primer, and analyzing a melting curve to judge the specificity of amplification. The Q-PCR system comprises: template 2. mu.l, SYRB mix 10. mu.L, forward primer 0.2. mu.L, reverse primer 10.2. mu.L, ddH2O 7μL；
The Q-PCR program included: pre-denaturation at 95 ℃ for 30s, 30 cycles of denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 70 ℃ for 15s, and finally adding a melting curve program.
(3) The Ct value measured by Q-PCR should be reduced by one round. The fluorescence threshold is set to 100, the Ct value of the sample has a linear relation with the logarithm of the initial copy number of the template, and the Ct value is smaller when the amount of the template is larger. And (4) calculating the Ct value according to the amplification curve, wherein the Ct value of the screened secondary library is not reduced any more, which indicates that the binding rate of the secondary library and the target molecule is not increased any more, and the screening is stopped.
2.7 authentication
After the secondary library obtained by each round of screening is amplified by PCR, agarose gel electrophoresis with 2% volume fraction is used for detecting, and whether the size of the obtained band is about 80bp is compared with a marker.
The agarose gel electrophoresis procedure was as follows:
(1) preparing agarose solution with proper volume concentration by using 1 XTAE solution according to the number of the sample and the size of the target band, putting the agarose solution into a microwave oven to be heated for 1 minute until agarose is dissolved, adding nucleic acid dye according to the volume ratio of 1:10000 after slight cooling, pouring the agarose solution into a gel-making glass plate, and inserting a comb.
(2) And after the gel is solidified, vertically pulling out the comb. The gel is put into electrophoresis tank 1 XTAE nucleic acid electrophoresis buffer solution, and the sample loading buffer solution are mixed according to the corresponding proportion and then loaded. The power is turned on for 120V until the bromophenol blue moves to the lower edge of the glue.
(3) The gel was imaged in a gel imaging system.
Example 3 high throughput sequencing and sequence analysis
And performing agarose gel electrophoresis after PCR amplification on the final round of screening products, cutting and recovering the 80bp strip, and then sending the strip to a company for high-throughput sequencing. Sending the sequence with the most occurrence times in the high-throughput sequencing result to a company for synthesis, then carrying out Kd value detection, and predicting the secondary structure of the sequence by using software. The sequencing result excludes the sequence forming primer dimer and containing the complementary strand of the forward primer and the reverse primer 1. The two sequences with the lowest Kd and the highest affinity with the target molecule are as follows:
F1:AAGGAGCAGCGTGGAGGATACTCCGTGCGATCGCCGGGGACCGAAGAATCGTTCACATCGTTAGGGTGTGTCGTCGTGGT
B1:AAGGAGCAGCGTGGAGGATACCATCCACCTAGCATCCATAGGCGAACACTTTCTTGGGGCTTAGGGTGTGTCGTCGTGGT
the sequence contains the reverse complementary strand sequence ACCACGACGACACACCCTAA of the forward primer AAGGAGCAGCGTGGAGGATA and the reverse primer 1.
The intermediate sequence of the two aptamers and the 40bp without similarity of the primers are parts capable of being combined with the target sarafloxacin hydrochloride, wherein G% is 37.5% and 32.5% respectively. The partial sequence was sent to Jinzhi Biotechnology Ltd for synthesis and purified by hPAGE. Aptamer secondary structure was predicted by software as shown in figure 1.
Example 4 aptamer Kd values
(1) Preparing a gradient concentration aptamer solution: each aptamer of 5' -modified FAM was formulated in a series of concentrations (1000nM, 500nM, 300nM, 200nM, 100nM, 50nM, 20nM, 0nM) using Selection Buffer.
(2) And (3) sucking 80 mu L of amino magnetic beads coupled with sarafloxacin hydrochloride, transferring the amino magnetic beads into a centrifugal tube, settling the magnetic beads by using a magnet for magnetic separation, and sucking and removing supernatant by using a pipette gun. And then Washing the magnetic beads 3 times by using 200 mu L Washing Buffer, respectively packaging in 8 centrifuge tubes, respectively absorbing 100 mu L of the aptamers diluted in the step 1 and with different gradient concentrations by using a pipette gun, respectively carrying out water bath at 95 ℃ for 5 minutes and ice water bath for 10 minutes, respectively adding the aptamers into the washed sarafloxacin hydrochloride-amino magnetic beads, shaking up, and carrying out incubation in a constant temperature 120 rotary table at 37 ℃ for 30 minutes in a dark place.
(3) After the incubation, the magnetic beads were settled by a magnet for magnetic separation, the supernatant was aspirated by a pipette gun, and the aptamer-immunomagnetic beads-sarafloxacin hydrochloride was washed 3 times with 200. mu.L of Washing buffer. The magnetic beads were sedimented with a magnet for magnetic separation, the aptamers that were not bound to the aptamer-amino magnetic beads-sarafloxacin hydrochloride were removed with a pipette, and finally the magnetic beads were resuspended in 200. mu.L Washing buffer and the fluorescence intensity was measured with a microplate reader at the absorption and emission wavelength (488/520 nm).
(4) Using Origin software, according to the equation Y ═ BmaxAnd (3) the X/(Kd + X) is obtained by plotting a nonlinear fitting curve with the concentration of sarafloxacin hydrochloride as the abscissa and the measured fluorescence intensity as the ordinate, and the Kd value of the screened sarafloxacin hydrochloride aptamer F1 is 48.08 +/-13.38 nM, and the Kd value of B1 is 84.22 +/-27.40 nM, as shown in figure 2, which indicates that the two aptamers have strong binding capacity with the sarafloxacin hydrochloride.
Claims (1)
1. A screening method of a specifically-bound sarafloxacin hydrochloride aptamer is characterized in that:
1) synthesizing the original random ssDNA library and primers shown in the following sequences:
the original random ssDNA library was specified as follows:
5’-AAGGAGCAGCGTGGAGGATA-N40-TTAGGGTGTGTCGTCGTGGT-3’；
an upstream primer: 5'-AAGGAGCAGCGTGGAGGATA-3'
A downstream primer 1: 5'-ACCACGACGACACACCCTAA-3'
A downstream primer 2: 5 '-bio-ACCACGACGACACACCCTAA-3'
2) SELEX technology for screening specific aptamers
2.1 preparation of solutions required for the Experimental procedures
(1) A100 mL screening solution Selection Buffer preparation method comprises the following steps: 0.037g KCl, 0.011g CaCl2，0.5844g NaCl，0.019g MgCl20.24g of Tris, 20 mu L of Tween 20, adjusting the pH value to 7.6, and supplementing 100mL of deionized water;
(2) a100 mL cleaning solution Washing Buffer preparation method comprises the following steps: 21g Urea, 0.48g Tris, 0.37g EDTA Na220 mu L of Tween 20, adjusting the pH value to 8.0, and supplementing 100mL of deionized water;
(3) configuration method of 100mL Binding and Washing (BW) Buffer of combined eluent: 0.12g Tris, 0.037g EDTA Na211.68g of NaCl, adjusting the pH value to 7.4, and supplementing 100mL of deionized water;
(4) the preparation method of 100mL amino magnetic bead coupling buffer solution comprises the following steps: 1.95g of 2-morpholine ethanesulfonic acid, adjusting the pH value to 4.0, and supplementing 100mL of deionized water;
(5) preparation method of 100mL amino magnetic bead blocking buffer: 2.4g Tris, adjusting the pH value to 8.0, and supplementing 100mL with deionized water;
(6) preparation method of 100mL streptavidin magnetic bead binding buffer solution: 5.84g NaCl, 0.24g Tris, 0.037g EDTA Na220 mu L of Tween 20, adjusting the pH value to 7.8, and supplementing 100mL of deionized water;
2.2 amino-magnetic bead-coupled Sarafloxacin hydrochloride
(1) Before use, the amino magnetic beads are shaken on a magnetic separator for 20 seconds and mixed evenly; absorbing 50 mu L of magnetic beads by using a pipette gun, adding the magnetic beads into a 1.5mL centrifuge tube, washing the magnetic beads for 2 times by using 200 mu L of amino magnetic bead coupling buffer solution, settling the magnetic beads by using a magnet, and absorbing and removing supernate by using the pipette gun;
(2) adding 60 mu L of 2mg/mL sarafloxacin hydrochloride solution into the washed amino magnetic beads; meanwhile, cold deionized water is used for preparing 50mg/mL EDC-HCL (1- (3-dimethylaminopropyl) -3-ethylcarbodiimide hydrochloride), 30 mu L EDC-HCL solution is added into the system, vortexed and incubated for 2 hours in a shaking table at 30 ℃ with 120 revolutions;
(3) adding 200 mu L of amino magnetic bead sealing buffer solution into a centrifuge tube to resuspend the magnetic beads, and oscillating and incubating for 30 minutes in a shaking table at 30 ℃ by 120 revolutions; after incubation, settling the magnetic beads by using a magnet, and sucking and removing supernate by using a pipette;
(4) adding 200 mu L of phosphate buffer solution to repeatedly wash the magnetic beads for 2 times, settling the magnetic beads by using a magnet, and absorbing and removing supernatant by using a pipette; finally, 100 mu L of phosphate buffer saline solution is added into the magnetic beads for resuspending the magnetic beads, and the magnetic beads are stored at 4 ℃ for subsequent experiments;
2.3SELEX in vitro screening
(1) Adding 10 mu L of 10 mu M ssDNA library into a centrifuge tube, denaturing at 95 ℃ for 5 minutes, immediately performing ice-water bath for 10 minutes, adding 100 mu L of Selection Buffer into the centrifuge tube, uniformly mixing, and incubating at 25 ℃ for 20 minutes for later use;
(2) taking 100 mu L of magnetic beads coupled with sarafloxacin hydrochloride, washing for 3 times by using 400 mu L of Selection Buffer, removing supernatant, adding the ssDNA library uniformly mixed with the Selection Buffer in the step (1), and oscillating and incubating for 1 hour at 120 turns in a shaking table at 25 ℃;
(3) after the incubation is finished, settling the magnetic beads by using a magnet for magnetic separation, discarding ssDNA which is not combined with the sarafloxacin hydrochloride-magnetic beads by using a pipette, and Washing the magnetic beads for 3 times by using 200 mu L Washing Buffer;
(4) after the Washing, settling the magnetic beads by using a magnet, adding 50 mu L Binding and Washing Buffer into the magnetic beads, uniformly mixing, and carrying out water bath at 95 ℃ for 5 minutes; then, settling the magnetic beads by using a magnet, and sucking the supernatant for later use;
2.4PCR amplification
Taking the supernatant as a template, and carrying out PCR amplification by using a downstream primer 2 and an upstream primer; and (3) PCR reaction system:
and (3) PCR reaction conditions: 1. pre-denaturation at 94 ℃ for 1 min; 2. denaturation at 94 ℃ for 30 s; 3. annealing at 60 deg.C for 30s4, and extending at 72 deg.C for 1 min; 5. extending for 2min at 72 ℃; 6. preserving at constant temperature of 4 ℃; wherein 2-4 steps are set for circulation, and the circulation time is 30 times;
2.5 preparation of Secondary ssDNA libraries
(1) Taking 70 mu L of streptavidin magnetic beads, Washing the streptavidin magnetic beads for 3 times by using 200 mu L of Washing Buffer, settling the magnetic beads by using a magnet, absorbing and discarding the supernatant by using a pipette gun, adding 100 mu L of streptavidin combined Buffer solution, uniformly mixing the magnetic beads, taking a PCR product, adding the PCR product into the streptavidin magnetic beads, shaking and uniformly incubating the mixture for 30 minutes in a shaking table at the temperature of 30 ℃, settling the magnetic beads by using a magnet for magnetic separation, absorbing and discarding the supernatant by using the pipette gun, Washing the magnetic beads for 3 times by using 200 mu L of Washing Buffer, settling the magnetic beads by using the magnet for magnetic separation, and absorbing and discarding the supernatant by using the pipette gun;
(2) adding 50 mu L of 0.2mol/L sodium hydroxide solution into streptavidin magnetic beads of a PCR product coupled with biotin, reacting for 15 minutes in a 120-rotation shaking table at 37 ℃, depositing magnetic beads for magnetic separation, sucking supernatant into a centrifuge tube by using a pipette gun, adding 2mol/L dilute hydrochloric acid into the centrifuge tube, and adjusting the pH to 7.0 by using an extensive pH test paper; this secondary ssDNA library was used for the next round of screening;
2.6 detection
(1) Dividing the obtained secondary library into three parts, preserving one part, using the other part for Q-PCR detection, and using the other part for the next round of screening;
(2) taking the secondary library as a template, carrying out Q-PCR detection on the downstream primer 1 and the upstream primer, and analyzing a melting curve to judge the specificity of amplification; the Q-PCR system comprises: template 2. mu.L, SYRB mix 10. mu.L, forward primer 0.2. mu.L, reverse primer 10.2. mu.L, ddH2O 7μL；
The Q-PCR program included: pre-denaturation at 95 ℃ for 30s, 30 cycles of denaturation at 95 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 70 ℃ for 15s, and finally adding a melting curve program;
(3) the Ct value obtained by Q-PCR measurement should be reduced by turns; the fluorescence threshold value is set to be 100, the Ct value of the sample and the logarithm of the initial copy number of the template have a linear relation, and the larger the amount of the template is, the smaller the Ct value is; and calculating the Ct value according to the amplification curve, and stopping screening when the Ct value of the screened secondary library is not reduced any more.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110114246.1A CN112662664B (en) | 2021-01-28 | 2021-01-28 | Screening method of specifically-bound sarafloxacin hydrochloride aptamer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110114246.1A CN112662664B (en) | 2021-01-28 | 2021-01-28 | Screening method of specifically-bound sarafloxacin hydrochloride aptamer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112662664A true CN112662664A (en) | 2021-04-16 |
| CN112662664B CN112662664B (en) | 2022-04-19 |
Family
ID=75414821
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110114246.1A Active CN112662664B (en) | 2021-01-28 | 2021-01-28 | Screening method of specifically-bound sarafloxacin hydrochloride aptamer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112662664B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104450725A (en) * | 2015-01-05 | 2015-03-25 | 辽宁工程技术大学 | Aptamer of enrofloxacin and preparation method and application thereof |
| CN104830866A (en) * | 2015-05-20 | 2015-08-12 | 江南大学 | ssDNA aptamer for recognizing ofloxacin with specificity and application of ssDNA aptamer |
| US20170121715A1 (en) * | 2014-07-24 | 2017-05-04 | Jiangnan University | A specific oligonucleotide aptamer for the identification of T-2 toxin |
-
2021
- 2021-01-28 CN CN202110114246.1A patent/CN112662664B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20170121715A1 (en) * | 2014-07-24 | 2017-05-04 | Jiangnan University | A specific oligonucleotide aptamer for the identification of T-2 toxin |
| CN104450725A (en) * | 2015-01-05 | 2015-03-25 | 辽宁工程技术大学 | Aptamer of enrofloxacin and preparation method and application thereof |
| CN104830866A (en) * | 2015-05-20 | 2015-08-12 | 江南大学 | ssDNA aptamer for recognizing ofloxacin with specificity and application of ssDNA aptamer |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109371031A (en) * | 2018-11-23 | 2019-02-22 | 北京化工大学 | A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112662664B (en) | 2022-04-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7527929B2 (en) | Methods of isolating nucleic acids using multifunctional group-coated solid phase carriers | |
| US8808990B2 (en) | Serial isolation of multiple DNA targets from stool | |
| EP1466018B1 (en) | Use of silica material in an amplification reaction | |
| EP2304028B1 (en) | Methods and kits for extraction of dna | |
| CN112662664B (en) | Screening method of specifically-bound sarafloxacin hydrochloride aptamer | |
| CN108866065B (en) | ssDNA aptamer for specifically recognizing gentamicin and application thereof | |
| JP2002512252A (en) | Reduction of endotoxin in nucleic acid purification | |
| CN110923237B (en) | Roxithromycin specific binding aptamer and application thereof | |
| WO2014079350A1 (en) | Cho cell dna detection method | |
| CN106645050B (en) | It is a kind of for detecting the aptamers and its application of lactoferrin content | |
| CN111705062B (en) | Stilbene estrogen aptamer and application thereof | |
| Liu et al. | An aptamer-based colorimetric sensor for streptomycin and its application in food inspection | |
| CN114127293A (en) | Method for in vitro screening of DNA aptamer of PD-L1 and application of DNA aptamer in cancer diagnosis | |
| CN107858357B (en) | Bovine respiratory syncytial G protein specific aptamer | |
| CN108251428B (en) | Aptamer for identifying various organophosphorus pesticides and application thereof | |
| CN103045602B (en) | DNA aptamer capable of specifically binding tetrodotoxin and application of DNA aptamer | |
| CN114426971A (en) | Fluorescence immunoassay method based on DNAzyme auxiliary signal amplification | |
| CN111979247B (en) | Aptamer of beclomethasone as well as screening method and application thereof | |
| CN113462693A (en) | Application of ssDNA aptamer in identification of iridovirus infected cells of micropterus salmoides | |
| KR20210132375A (en) | Method for isolating nucleic acid using integrated magnetite nanoparticles on graphene oxide | |
| CN111676224A (en) | Aptamer capable of being combined with 2-bromo-1-indanol and screening method thereof | |
| CN115044588B (en) | Aptamer and hot-start DNA polymerase | |
| CN114058624B (en) | Aptamer, sensor, kit and application for detecting sulfanilamide-5-methoxypyrimidine | |
| CN113278621B (en) | ssDNA aptamer and application thereof in identification and detection of vibrio harveyi | |
| CN114107307B (en) | Method for screening PD-L1 DNA nucleic acid aptamer in vitro and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |