CN112661860A - Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus - Google Patents
Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus Download PDFInfo
- Publication number
- CN112661860A CN112661860A CN202011554908.9A CN202011554908A CN112661860A CN 112661860 A CN112661860 A CN 112661860A CN 202011554908 A CN202011554908 A CN 202011554908A CN 112661860 A CN112661860 A CN 112661860A
- Authority
- CN
- China
- Prior art keywords
- ifn
- leu
- alpha
- glu
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention belongs to the field of gene medicines, and particularly relates to preparation and application of tiger long-acting interferon. The tiger long-acting interferon (SEQ ID NO.1) prolongs the action time of the interferon by adopting an optimized recombination mode of an interferon gene (SEQ ID NO.2) and albumin (SEQ ID NO.3) of the tiger; the baculovirus expression system adopted by the subject group has high expression level and good product activity, and in addition, the expression level can be further improved after targeted sequence optimization is carried out on the basis of the original gene.
Description
Technical Field
The invention belongs to the field of gene medicines, and particularly relates to tiger long-acting interferon, a preparation method thereof and application thereof in resisting influenza viruses.
Background
Influenza, one of the global serious infectious diseases caused by influenza virus, causes huge damage to socioeconomic and human health every outbreak of influenza. Influenza a viruses are viruses of the orthomyxoviridae family, and are found in a wide range of hosts, including humans, mammals and birds, and can cause seasonal influenza and avian influenza. In 1997 8 months, hong kong reported the first worldwide case of death from infection with avian influenza virus H5N 1; in 2002, the infection of tigers by influenza viruses has been discovered in China (Xiahizhizhu et al, 2003); thailand in 2004 reported that H5N1 subtype avian influenza virus infects tigers lethally, nearly 146 tigers infect and attack, and the clinical manifestations of the attack tigers often show symptoms such as high fever, convulsion and pneumonia; recently, northeast tiger infection flu death cases are found in Heilongjiang and the like; canines, felines, and ferrets find cases of influenza infection. Particularly, when some endangered wild animals (such as northeast tigers) are infected with highly pathogenic influenza viruses, the wild animals often die because the highly pathogenic influenza viruses cannot be cured in time and effectively.
Interferon is an active protein produced by vertebrates, and has various medical effects such as antiviral, anti-cell proliferation, immunoregulation, etc., so that research on clinical application of interferon has been conducted intensively from the beginning of discovery to the present. The tiger interferons are classified into types i, ii and iii according to their cell origin and receptor: type I includes IFN-alpha and IFN-beta, wherein IFN-alpha has more than twenty subtypes and IFN-beta has only one subtype; type II has only IFN-gamma and only one subtype; type III includes 3 subtypes IFN-. lambda.1, IFN-. lambda.2 and IFN-. lambda.3. The antiviral effects of type I interferons are most representative, and recombinant IFN- α, whether naturally occurring or synthetic, binds to common cell surface receptors and induces antiviral activity in the body.
At present, in the research field of anti-influenza, interferon is selected for use due to quick response and obvious effect, but common interferon has short half-life, cannot exert the whole curative effect of the interferon, and seriously limits the clinical use of the interferon. In interferon used clinically in human, the half-life of interferon is prolonged by means of fusion protein recombination interferon, and in the relevant literature, the half-life of interferon is prolonged by using fusion protein in canine, but animals have little possibility of cross use because of various species, large species difference and high species specificity of interferon. Moreover, the research on wild endangered animal interferon is relatively less, and the subject group sets up a research on the tiger interferon with high efficiency, high activity and long action time.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a method for prolonging the action time of interferon by means of fusion protein modification, which can prolong the half-life period of interferon, so that the interferon can play a greater role in clinical use, and the problem that the interferon has short half-life period and cannot provide efficient protection in the clinical treatment of tigers is effectively solved.
In order to achieve the above object, the present invention provides a long-acting interferon protein IFN- α + ALB, the amino acid sequence of which is shown in SEQ ID No. 1: pro Glu Phe Met Ala Leu Pro Ser Ser Phe Leu Val Ala Leu Val Ala Leu Gly Cys Asn Ser Val Cys Cys Leu Gly Cys Asp Leu Pro Gln Thr His Gly Leu Leu Asn Arg Arg Ala Leu Thr Leu Leu Gly Gln Met Lys Arg Leu Pro Ala Ser Ser Cys Gln Lys Asp Arg Asn Asp Phe Ala Phe Pro Gln Asp Val Phe Gly Gly Asp Gln Ser His Lys Ala Gln Ala Leu Ser Val Val His Val Thr Asn Gln Lys Ile Phe His Phe Phe Cys Thr Glu Ala Ser Ser Ser Ala Ala Trp Asn Thr Thr Leu Leu Glu Glu Phe Cys Thr Gly Leu Asp Arg Gln Leu Thr Ser Leu Glu Ala Cys Val Met Gln Glu Val Gly Glu Gly Glu Ala Pro Leu Thr AsnGlu Asp Ser Ile Leu Arg Asn Tyr Phe Gln Arg Leu Ser Leu Tyr Leu Gln Glu Lys Lys Ser Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Leu Tyr Tyr Ser Ser Ile Ala Leu Gln Lys Arg Leu Arg Ser Glu Lys Gly Gly Gly Gly Ser Arg Gly Leu Thr Arg Arg Glu Ala His Gln Ser Glu Ile Ala His Arg Phe Asn Asp Leu Gly Glu Glu His Phe Arg Gly Leu Val Leu Val Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Glu Asp His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Gly Cys Val Ala Asp Gln Ala Ala Ala Asn Cys Glu Lys Ser Leu His Glu Leu Phe Gly Asp Lys Leu Cys Thr Val Ala Ser Leu Arg Asp Lys Tyr Gly Glu Met Ala Asp Cys Cys Glu Lys Lys Glu Pro Glu Arg Asn Glu Cys Phe Leu Gln His Lys Asp Asp Asn Pro Gly Phe Gly Gln Leu Val Thr Pro Glu Ala Asp Ala Met Cys Thr Ala Phe His Glu Asn Glu Gln Arg Phe Leu Gly Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe Tyr Ala Pro Glu Leu Leu Tyr Tyr Ala Glu Glu Tyr Lys Gly Val Phe Thr Glu Cys Cys Glu Ala Ala Asp Lys Ala Ala Cys Leu Thr Pro Lys Val Asp Ala Leu Arg Glu Lys Val Leu Ala Ser Ser Ala Lys Glu Arg Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala Trp Ser Val Ala Arg Leu Ser Gln Lys Phe Pro Lys Ala Asp Phe Ala Glu Ile Ser Lys Leu Val Thr Asp Leu Ala Lys Ile His Lys Glu Cys Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser Thr Lys Leu Lys Glu Cys Cys Gly Lys Pro Val Leu Glu Lys Ser His Cys Ile Ser Glu Ala Glu Arg Asp Glu Leu Pro Ala Asp Leu Ala Pro Leu Ala Ala Asp Phe Val Glu Asp Lys Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val Phe Leu Gly Thr Phe Leu Tyr Glu Tyr Ser Arg ArgHis Pro Glu Tyr Ser Val Ser Leu Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu Glu Lys Cys Cys Ala Thr Asp Asp Pro Pro Thr Cys Tyr Ala His Val Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro His Asn Leu Val Lys Thr Asn Cys Glu Leu Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro Thr Leu Val Glu Val Ser Arg Ser Leu Gly Lys Val Gly Ser Lys Cys Cys Thr His Pro Glu Ser Glu Arg Leu Ser Cys Ala Glu Asp Tyr Leu Ser Val Val Leu Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val Ser Glu Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg Pro Cys Phe Ser Ala Leu Gln Val Asp Glu Thr Tyr Val Pro Lys Glu Phe Ser Ala Glu Thr Phe Thr Phe His Ala Asp Leu Cys Thr Leu ProGlu Ala Glu Lys Gln Ile Lys Lys Gln Ser Ala Leu Val Glu Leu Leu Lys His Lys Pro Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Gly Asp Phe Gly Ser Phe Val Asp LysCys Cys Ala Ala Glu Asp Lys Glu Ala Cys Phe Ala Glu Glu Gly Pro Lys Leu Val Ala Thr Thr Gln Ala Ala Leu Ala Gly Gly Gly Gly Ser His His His His His His.
The interferon is a fusion interferon protein modified by albumin, specifically, tiger IFN-alpha and IFN-alpha + ALB genes optimized according to insect cell preferred codons are connected with a pFastBac1 vector to prepare a recombinant baculovirus Bacmid plasmid, and insect cells are transfected to obtain recombinant baculovirus, and the long-acting interferon protein IFN-alpha + ALB is obtained by expression and purification after the insect cells are inoculated by the virus.
The tiger IFN-alpha gene and IFN-alpha + ALB gene optimized according to insect cell preferred codons are synthesized by Jinzhi biology company.
Wherein the nucleotide sequence of the optimized tiger IFN-alpha gene is shown in SEQ ID NO.2 as ccggaattcatggcacttccatcttctttcttagtagctctggtggcattgggttgtaactctgtttgctgccttggatgcgatcttccacagacacatggacttcttaaccgacgagcacttacacttcttggacagatgaaacgacttccagcatcttcttgccagaaagatcgaaacgatttcgcattcccacaggatgtctttggaggcgaccagtctcataaagcacaggcactttctgttgttcatgttacaaaccagaagatattccacttcttttgtacagaagcatcttcttctgcagcatggaacacaacacttcttgaagagttctgcacaggacttgatcgacagcttacatctcttgaagcatgcgttatgcaggaagttggagaaggagaagcaccacttacaaacgaagattctatccttcgaaactacttccagcgactttctctttaccttcaggagaagaagtcatcgccatgcgcatgggaagttgttcgagcagaaatcatgcgatctctttactactcttctatcgcacttcagaaacgacttcgatctgagaagggtggcggcggttcccaccatcatcatcatcattgagcggccgcaaaaggaaaa; or a nucleotide sequence modified by substitution, deletion and addition of one or more bases on the nucleotide sequence.
The nucleotide sequence of the IFN-alpha + ALB gene is shown in SEQ ID NO.3 as ccggaattcatggcacttccatcttctttcctagtggccctcgtggcattaggctgtaactctgtttgctgccttggatgcgatcttccacagacacatggattgttgaatcgcagagcgcttacacttcttggacagatgaaacgacttccagcatcttcttgccagaaagatcgaaacgatttcgcattcccacaggatgtgtttggaggtgatcaatctcataaagcacaggcactgtccgtggtcc acgtcacaaaccagaagatatttcatttcttctgcacagaagcatcttcttctgcagcatggaacacaacacttcttgaagagttctgcacaggacttgatcgacagcttacatctcttgaagcatgcgttatgcaggaagttggagaaggagaagcaccacttacaaacgaagattctatccttcgaaactacttccagcgactttctctttaccttcaggagaagaagagctcaccatgcgcatgggaagttgttcgagcagaaatcatgcgatctctttactactcttctatcgcacttcagaaacgacttcgatctgagaagggcggaggcgggagccgcggattaacgcgacgagaagcacatcagtctgaaatcgcacatcgattcaacgatcttggagaagaacatttccgaggacttgttcttgttgcattctctcagtaccttcagcagtgcccattcgaagatcatgttaaacttgttaacgaagttacagagttcgcaaagggatgcgtcgcagatcaggcagcagcaaactgcgagaagagcctgcatgaattatttggcgataaactttgcacagttgcatctcttcgagataaatacggagaaatggcagattgctgcgagaagaaggagcccgaacgaaacgaatgcttccttcagcataaagatgataacccaggattcggacagcttgttacaccagaagcagatgcaatgtgcacagcattccatgagaatgagcagcgattccttggaaagtatctatacgaaatcgcaaggcgccacccgtacttctacgctccagaacttctttactacgcagaagaatacaaaggagtatttacggaatgctgcgaagcagcagataaagcagcatgccttacaccaaaggtcgacgcacttcgagagaaggtactcgctagctctgcaaaggagcgtcttaaatgcgcatctcttcagaaattcggagaacgagcattcaaagcatggtctgttgcacgactttctcagaaattcccaaaggctgacttcgcagaaatctctaaacttgttactgacctagcgaagatacacaaggagtgttgtcacggcgatcttcttgaatgcgcagatgatcgagcagatctggccaagtatatatgcgagaatcaagattctatctctacaaagctcaaagagtgttgtggtaaacctgtgttagagaagtcccactgcatctctgaagcagaacgagatgaacttccagccgacctagcacccttggcagcagatttcgttgaggacaaggaggtatgtaagaattatcaggaagcaaaggacgtcttcttgggtacttttctttacgaatactctcggcggcacccggagtattctgtttctcttcttcttcgacttgcaaaggagtatgaagcaacacttgagaaatgctgcgccactgacgatccaccaacatgctacgcacatgtgtttgacgagttcaaacctttagtagaggagcctcataaccttgttaagaccaattgcgaactgtttgagaaactaggtgaatacggattccagaacgcacttcttgttcgatacacaaagaaggtacctcaggtttctacaccaacgttagtagaggtatcgcgatctcttggaaaggtcggctctaagtgttgtacgcaccctgaatctgaacgactttcttgcgcagaagattacctcagtgtagtgcttaacaggctctgtgttcttcatgagaagacgcctgtttctgaacgagttacaaagtgttgtactgagagccttgttaaccgacgaccatgcttctctgcacttcaggttgatgaaacatacgttccaaaggagttcagtgctgaaacattcacattccatgcagatctttgcacacttccagaagcagagaagcaaataaagaagcaatccgcacttgttgaacttcttaaacataaaccaaaggcgaccgatgaacagcttaagaccgtcatgggagatttcggatctttcgttgataagtgttgtgccgctgaagacaaggaggcttgtttcgcagaagaaggaccaaagttggtggcaacaacacaggcagcacttgcaggcggtggtgggtcccaccaccatcatcatcattgagcggccgcaaaaggaaaa; or a nucleotide sequence modified by substitution, deletion and addition of one or more bases on the nucleotide sequence.
Restriction enzymes of the optimized tiger IFN-alpha gene and IFN-alpha + ALB gene and pFastBac1 carrier enzyme digestion are EcoRI and NotI.
The codon optimization according to the insect cell preference follows: the encoded amino acid sequence is unchanged; removing rare codons; disruption of the stem-loop structure that affects mRNA stability and ribosome binding.
The purification mode is a nickel column affinity chromatography mode.
In order to achieve the above object, the present invention also provides a method for preparing the albumin modified fusion interferon protein IFN-alpha + ALB, comprising the following steps.
Step one, construction of a recombinant baculovirus Bacmid plasmid: carrying out multi-cloning site analysis on the optimized tiger IFN-alpha gene, the fusion modified IFN-alpha + ALB gene and the gene of a pFastBac1 vector, and selecting two restriction enzyme sites which are provided on the vector but not in a target fragment: EcoRI and NotI, after double enzyme digestion, inserting the recovered target fragment into an insect cell expression vector pFastBac1, and transforming an escherichia coli DH10Bac competent cell to obtain a recombinant baculovirus Bacmid plasmid.
Step two, rescuing the recombinant baculovirus: insect cells are transfected by the recombinant baculovirus Bacmid plasmid, and the recombinant baculovirus is obtained through rescue.
Step three, large-scale expression and purification of protein: infecting insect cells with the obtained recombinant baculovirus according to MOI (3), harvesting supernatant after 3 days, and purifying the obtained supernatant by a nickel column affinity chromatography mode to obtain the long-acting interferon protein IFN-alpha + ALB.
In the first step, the specific operations are as follows: respectively adding 1 mul of pFastBac-IFN-alpha and 1 mul of pFastBac-IFN-alpha + ALB into two 50 mul of DH10Bac competent cells, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 45s, carrying out ice bath for 2min, adding 1ml of nonresistant LB culture medium, carrying out culture at 37 ℃ for 48h, picking out white spot colonies, adding the LB culture medium, carrying out shake culture at 37 ℃ and 200rpm/min for 12h, extracting plasmid DNA, carrying out PCR identification, and identifying the correct positive plasmid, namely the recombinant baculovirus Bacmid plasmid.
And in the second step, when the cell confluence of the insect cells reaches more than 80%, performing transfection.
The purification procedure in step three was performed by loading the supernatant onto a nickel column to allow sufficient binding, followed by washing with 25mM imidazole and elution with 250mM imidazole.
The insect cell is Sf9 cell.
The invention provides application of tiger long-acting interferon in the aspect of resisting influenza.
The invention has obvious technical effect.
The subject group adopts the recombination mode of tiger interferon gene and albumin to prolong the action time of interferon; meanwhile, most animal interferon products are produced by prokaryotic expression, the product activity and yield of the production mode are not ideal, the expression level of a baculovirus expression system adopted by the subject group is high, the product activity is good, in addition, the expression level can be further improved after targeted sequence optimization is carried out on the basis of an original gene, the method has the advantages of mass production, high yield, effective reduction of the production cost, good protection effect and certain prevention effect on the tiger influenza virus.
Drawings
FIG. 1 shows the results of restriction enzyme identification and PCR identification of the recombinant plasmid.
FIG. 2 shows the result of genome identification of the supernatant after transfection of cells with the recombinant plasmid.
FIG. 3 shows the Coomassie blue staining and the WesternBolt identification of the resulting proteins.
FIG. 4 shows the effect of the in vitro activity of the resulting protein as determined by MDCK-H5N 1.
Figure 5 is a graph of the relative half-life results of two interferons in mice.
FIG. 6 is the challenge protection against influenza virus (A/Tiger/Heilongjiang/HDHZ/2016).
Detailed description of the invention
The technical solution of the present invention is further described in detail with reference to the accompanying drawings and the detailed description. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.
Example 1 construction and characterization of fusion proteins insect cells expressing bacmid.
1 material.
Coli DH 5. alpha. competent cells were purchased from Takara Bio Inc., E.coli DH10Bac competent cells were prepared and stored in the laboratory, insect baculovirus system vector pFastBac1 was purchased from Invitrogen Inc., technical services such as gene sequencing and primer synthesis were provided by Kingzhi corporation and Kumei organisms, and restriction enzymes FastDiget EcoRI and FastDiget NotI were purchased from Thermo Fisher Scientific.
Coli DH10Bac competent cell preparation method as follows: the strain DH10Bac is streaked on an LB plate, cultured for 20-24h at 37 ℃,single colonies were picked and inoculated into tubes containing 5mL LB liquid medium, incubated at 37 ℃ and 200-. Inoculating 1mL of the bacterial solution into a 500mL conical flask containing 100mL of liquid culture medium, culturing at 37 ℃ and 200-220rpm by shaking on a shaker for 3h until the OD value reaches 0.35-0.4. The inoculum was transferred to a sterile 50mL centrifuge tube precooled with ice, and placed on ice for 10min to cool the inoculum to 0 ℃. The cells were recovered by centrifugation at 4 ℃ for 10min at 4000 rpm. The supernatant was discarded and the residue was removed by pipetting. Every 50mL of the recovered bacterial liquid is pre-cooled with 30mL of 0.1mol/L CaCl2The solution was resuspended. The cells were recovered by centrifugation at 4 ℃ for 10min at 4000 rpm. The supernatant was discarded and the residue was removed by pipetting. 2mL of precooled 0.1mol/L CaCl is used for every 50mL of bacterium liquid recovery2The solution (containing 10% -20% glycerol) resuspended each cell pellet. Each tube was filled with 100. mu.L of competent cells in 1.5mL centrifuge tubes and stored in a freezer at-80 ℃ for further use.
2, a method.
2.1 optimized IFN- α and IFN- α + ALB were synthesized by Kingzhi Biometrics.
2.2 the invention adopts the method that the fusion of the tiger interferon gene and the albumin gene is connected to a pFastBac1 carrier for protein expression. Cloning the obtained gene into pFastBac1 plasmid according to EcoRI and NotI enzyme cutting sites, transforming the gene into E.coli DH5 alpha competent cells, plating the cells overnight for culture, screening positive bacteria, and carrying out quality-improving particle PCR, sequencing and enzyme cutting identification to obtain correct pFastBac-IFN-alpha and pFastBac-IFN-alpha + ALB plasmids. Then the plasmid is transformed into DH10Bac competent cells, and the cells are coated on LB plates containing kanamycin, tetracycline, gentamicin, x-gal and IPTG, positive colonies are screened, and recombinant bacmids are extracted. Identifying the IFN-alpha fragment with PCR upstream primer CCGGAATTCATGGC ACTT and downstream primer TGCGGCCGCTC AATGATG; the PCR forward primer for identifying IFN-alpha + ALB fragment was CGGAATTCA TGGCACTTC, and the reverse primer was TGCGGCCGCTCAA TGAT.
2.3 high-volume expression of the fusion protein.
Transferring 2 positive recombinant plasmids into sf9 insect cells by using a Lipofectamine 3000 transfection reagent, collecting the supernatant of P3 generation cells, extracting a supernatant genome by using a genome extraction kit, and identifying the expression of genes by respectively using a PCR upstream primer and a PCR downstream primer (an upstream primer is CCGGAATTCATGGCACTT and a downstream primer is TGCGGCCGCTC AATGATG) for identifying IFN-alpha fragments and a PCR upstream primer and a PCR downstream primer (an upstream primer is CGGAATTCATGGCACTTC and a downstream primer is TGCGGCCGCTCAAT GAT) for identifying IFN-alpha + ALB fragments. And (3) inoculating the third-generation recombinant baculovirus with MOI ═ 3 after correct identification, harvesting the baculovirus infected suspension cells after 3 days, centrifuging the suspension cells in a 4 ℃ centrifuge at 4000rpm for 10min, collecting cell culture supernatant, repeatedly freezing and thawing the cell sediment for several times, and centrifuging the cell sediment at 4000rpm for 10min to also collect cell lysis supernatant.
2.4 Nickel column chromatography purification and verification of protein.
The collected cell supernatants were purified by nickel column, eluted with imidazole, and then examined for protein purity by Coomassie blue staining using 10% SDS-PAGE gel, and specificity of the eluted proteins was confirmed by Western Blot.
And 3, obtaining a result.
The results of the enzyme digestion identification of the screened positive clones and the PCR identification of the bacteria liquid are shown in FIG. 1, wherein pFastBac-IFN-alpha and pFastBac-IFN-alpha + ALB are shown, the size of a pFastBac1 vector is 4700bp, and the size of IFN alpha fragments is as follows: 630bp, IFN alpha + ALB size 2400 bp; the figure shows that the baculovirus plasmid is correctly constructed, and pFastBac-IFN-alpha + ALB are successfully constructed; the method comprises the following steps of A, enzyme digestion identification of a recombinant plasmid pFastBac-IFN-alpha 1. Marker; pFastBac-IFN-alpha 1 #; pFastBac-IFN-alpha 2 #; pFastBac-IFN-alpha 3 #; B. carrying out enzyme digestion identification on the recombinant plasmid pFastBac-IFN-alpha + ALB 1. Marker; pFastBac-IFN-alpha + ALB 1 #; pFastBac-IFN-alpha + ALB 2 #; C. carrying out PCR identification on a bacterial liquid of a recombinant plasmid pFastBac-IFN-alpha 1. Marker; pFastBac-IFN-alpha 1 #; pFastBac-IFN-alpha 2 #; pFastBac-IFN-alpha 3 #; D. carrying out PCR identification on a bacterial liquid of a recombinant plasmid pFastBac-IFN-alpha + ALB 1. Marker; pFastBac-IFN-alpha + ALB; 1 #; pFastBac-IFN-alpha + ALB 2 #; pFastBac-IFN-alpha + ALB 3 #.
After the identification is correct, a large amount of expression is carried out, corresponding genes are also detected in cell supernatant, and the identification result of the supernatant genome after the recombinant plasmid transfects the cells is shown in figure 2; the results show that the cells successfully express baculovirus plasmids pFastBac-IFN-alpha and pFastBac-IFN-alpha + ALB; wherein, cell supernatant after A.pFastBac-IFN-alpha + ALB transfection is identified as Marker 1; pFast Bac-IFN-alpha + ALB 1 #; pFastBac-IFN-alpha + ALB 2 #; pFastBac-IFN-alpha + ALB 3 #; identifying a Marker in cell supernatant after pFastBac-IFN-alpha transfection; pFast Bac-IFN-alpha 1 #; pFastBac-IFN-. alpha.2 #.
The results of Coomassie blue staining and WesternBolt identification of the resulting protein are shown in FIG. 3; wherein, the A. interferon IFN-alpha protein (shown in SEQ ID NO. 4: Pro Glu Phe Met Ala Leu Pro Ser Ser Phe Leu Val Ala Leu Val Ala Leu Gly Cys Asn Ser Val Cys Cys Leu Gly Cys Asp Leu Pro Gln Thr His Gly Leu Leu Asn Arg Arg Ala Leu Thr Leu Leu Gly Gln Met Lys Arg Leu Pro Ala Ser Ser Cys Gln Lys Asp Arg AsnAsp Phe Ala Phe Pro Gln Asp Val Phe Gly Gly Asp Gln Ser His Lys Ala Gln Ala Leu Ser Val Val His Val Thr Asn Gln Lys Ile Phe His Phe Phe Cys Thr Glu Ala Ser Ser Ser Ala Ala Trp Asn Thr Thr Leu Leu Glu Glu Phe Cys Thr Gly Leu Asp Arg Gln Leu Thr Ser Leu Glu Ala Cys Val Met Gln Glu Val Gly Glu Gly) Glu Ala Pro Leu Thr Asn Glu Asp Ser Ile Leu Arg Asn Tyr Phe Gln Arg Leu Ser Leu Tyr Leu Gln Glu Lys Lys Ser Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser Leu Tyr Tyr Ser Ser Ile Ala Leu Gln Lys Arg Leu Arg Ser Glu Lys Gly Gly Gly Gly Ser His His His His His His) SDS-PAGE validation; B. the recombinant interferon IFN-alpha + ALB protein SDS-PAGE verifies; C. interferon IFN-alpha protein WesternBolt is identified, and the primary antibody is rabbit polyclonal antibody; D. recombinant interferon IFN-alpha + ALB protein WesternBolt identifies that the primary antibody is rabbit polyclonal antibody. We can also clearly see the protein we need in the purified protein validation results, and the Western Blot results show that it has good specificity. Indicating that the two proteins IFN-alpha and IFN-alpha + ALB are expressed correctly.
Example 2 in vitro and in vivo activity identification of long-acting interferons.
1 material.
BALB/c female mice, 6-8 weeks old, were purchased from Beijing Wittingle. Mouse (2,5-OAS) ELISA test kit was purchased from Shanghai enzyme-linked organisms, and CCK-8 test reagent was purchased from Biyunnan organisms.
2, a method.
2.1 the effect on cell viability in vitro was determined using MDCK cells.
After MDCK cells grow to a proper density, diluting a cat interferon standard product, optimized IFN-alpha and optimized IFN-alpha + ALB in a multiple ratio respectively, adding the diluted product into a cell plate, culturing for 48 hours, using H5 virus to perform detoxification according to 100TCID50, continuously culturing for 60-72 hours, and detecting the cell activity by using a CCK-8 cell activity detection kit.
2.2 determination of half-life in mice.
60 female mice are respectively injected with IFN alpha, IFN alpha and ALB in the abdominal cavity, the injection water is diluted to 1mL, 0.4 mg/mouse is injected in the abdominal cavity, 3 mice are randomly selected at 0h, 6h, 12h, 24h, 36h, 48h, 72h and 96h after injection, the eyes of the mice are picked up for blood collection, and serum is collected by centrifugation at 3000rpm for 5 min. And detecting the content of 2, 5-oligoadenylate synthetase in serum by using a mouse 2, 5-oligoadenylate synthetase (2,5-OAS) enzyme-linked immunosorbent assay (ELISA) detection kit.
2.3 evaluation of preventive and therapeutic effects in mice.
The mouse H5N1 (tiger influenza wild strain) virus challenge test is carried out on 70 mice which are divided into seven groups, each group comprises 10 mice, and the groups are respectively provided with: IFN- α group: 400 mug of the first group of the drugs is taken 4h before the toxin is attacked, 400 mug of the second group of the drugs is taken 8h after the toxin is attacked, and 400 mug of the third group of the drugs is taken 24h after the toxin is attacked; IFN- α + ALB group: 400 mug of medicine is taken 4 hours before the toxin is attacked in the fourth group, 400 mug of medicine is taken 8 hours after the toxin is attacked in the fifth group, and 400 mug of medicine is taken 24 hours after the toxin is attacked in the sixth group; PBS was given as a control group in the seventh group. Each mouse is administrated in the abdominal cavity, the time interval is 24h after the first administration, 2 times of injection is carried out, and the toxicity is counteracted by adopting a nasal drip mode by 5 times of MLD 50. The body weight and survival rate of the mice were measured daily after challenge. All animal test conditions and procedures were in compliance with the ethical guidelines of the international society for pain research, and were approved by the national release military animal care and utility committee, and all experiments were conducted in the military veterinary institute biosafety tertiary laboratory (BSL-3).
And 3, obtaining a result.
3.1 in vitro cell activity influences the results.
In vitro activity experiments were performed by the MDCK-H5N1 system, see FIG. 4, in which panels 1-9Respectively has a dilution factor of 41、42、43、44、45、46、47、48、4910 is a blank cell control and 11 is a virus positive control. The activity detection result shows that: with the increasing dilution gradient, the influence of the three interferon preparations on the cell activity is gradually reduced, wherein the treatment effect of the common interferon preparation on the cells is far lower than that of the cat interferon standard product and the long-acting interferon preparation, and the activity unit of the long-acting interferon preparation is basically equal to that of the cat interferon standard product.
The activity units of the protein can be determined from the standard.
According to the formula:
(wherein Pr is the titer of the standard, Ds is the pre-dilution multiple of the sample to be detected, Es is the dilution multiple of the sample to be detected corresponding to the half titer of the standard, Dr is the pre-dilution multiple of the standard, Er is the half dilution multiple of the standard)
Final determination of IFN- α -3.75 × 105IU/ml。
IFN-α+ALB＝6.65×105IU/ml。
3.2 comparison of half-lives of two interferons in mice.
The interferon affects the expression of 2,5 oligoadenylate synthetase (2,5-OAS) in mice, and the ELISA kit is used to measure the amount of 2,5 oligoadenylate synthetase (2,5-OAS) in mouse serum, and the obtained ELISA experimental results are summarized, and the relative comparison between the two results is shown in FIG. 5, wherein the results are as follows: the general IFN-alpha interferon presents an increasing trend along with the time after the intraperitoneal injection of the mice, reaches a maximum value in 12 hours, and then is attenuated to a normal level after 36 hours; whereas interferon modified by our albumin decays to normal at 96 hours after reaching a maximum at 24 hours after injection into mice. Through comparative analysis, the prepared fusion protein interferon has greatly improved in vivo activity and prolonged half life by about 3-5 times compared with common interferon.
3.3 evaluation results of preventive and therapeutic effects in mice.
The virus control group and the experimental group were challenged with 5MLD50 virus ((a/Tiger/Heilongjiang/HDHZ/2016)) and administered 4h before challenge, 8 hours after challenge and 24 hours after challenge, respectively, and the change in body weight and survival of mice were observed daily, and the following results are shown in fig. 6, in which a is the change rate of body weight of mice in each group after challenge, and the change rates of body weight in each group are not greatly different as a whole; in the figure B, the survival rate of the mice in each group after challenge is 60%, the survival rate of the fusion protein interferon group after prevention is 40%, the survival rate of the treatment after 8 hours of challenge is 40%, the survival rate of the treatment after 24 hours of challenge is 30%, while the survival rate of the common interferon group after prevention is 40%, the survival rate of the treatment after 8 hours of challenge is 30%, and the treatment does not survive after 24 hours of challenge. According to the results of the weight change rate and the survival rate, the fusion protein interferon group has better protection effect than the common interferon group.
Sequence listing
<110> university of Henan; military veterinary institute of military medical research institute of military science institute
<120> tiger long-acting interferon, preparation method thereof and application thereof in anti-influenza virus
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 798
<212> PRT
<213> IFN-α+ALBm
<400> 1
Pro Glu Phe Met Ala Leu Pro Ser Ser Phe Leu Val Ala Leu Val Ala
1 5 10 15
Leu Gly Cys Asn Ser Val Cys Cys Leu Gly Cys Asp Leu Pro Gln Thr
20 25 30
His Gly Leu Leu Asn Arg Arg Ala Leu Thr Leu Leu Gly Gln Met Lys
35 40 45
Arg Leu Pro Ala Ser Ser Cys Gln Lys Asp Arg Asn Asp Phe Ala Phe
50 55 60
Pro Gln Asp Val Phe Gly Gly Asp Gln Ser His Lys Ala Gln Ala Leu
65 70 75 80
Ser Val Val His Val Thr Asn Gln Lys Ile Phe His Phe Phe Cys Thr
85 90 95
Glu Ala Ser Ser Ser Ala Ala Trp Asn Thr Thr Leu Leu Glu Glu Phe
100 105 110
Cys Thr Gly Leu Asp Arg Gln Leu Thr Ser Leu Glu Ala Cys Val Met
115 120 125
Gln Glu Val Gly Glu Gly Glu Ala Pro Leu Thr Asn Glu Asp Ser Ile
130 135 140
Leu Arg Asn Tyr Phe Gln Arg Leu Ser Leu Tyr Leu Gln Glu Lys Lys
145 150 155 160
Ser Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser
165 170 175
Leu Tyr Tyr Ser Ser Ile Ala Leu Gln Lys Arg Leu Arg Ser Glu Lys
180 185 190
Gly Gly Gly Gly Ser Arg Gly Leu Thr Arg Arg Glu Ala His Gln Ser
195 200 205
Glu Ile Ala His Arg Phe Asn Asp Leu Gly Glu Glu His Phe Arg Gly
210 215 220
Leu Val Leu Val Ala Phe Ser Gln Tyr Leu Gln Gln Cys Pro Phe Glu
225 230 235 240
Asp His Val Lys Leu Val Asn Glu Val Thr Glu Phe Ala Lys Gly Cys
245 250 255
Val Ala Asp Gln Ala Ala Ala Asn Cys Glu Lys Ser Leu His Glu Leu
260 265 270
Phe Gly Asp Lys Leu Cys Thr Val Ala Ser Leu Arg Asp Lys Tyr Gly
275 280 285
Glu Met Ala Asp Cys Cys Glu Lys Lys Glu Pro Glu Arg Asn Glu Cys
290 295 300
Phe Leu Gln His Lys Asp Asp Asn Pro Gly Phe Gly Gln Leu Val Thr
305 310 315 320
Pro Glu Ala Asp Ala Met Cys Thr Ala Phe His Glu Asn Glu Gln Arg
325 330 335
Phe Leu Gly Lys Tyr Leu Tyr Glu Ile Ala Arg Arg His Pro Tyr Phe
340 345 350
Tyr Ala Pro Glu Leu Leu Tyr Tyr Ala Glu Glu Tyr Lys Gly Val Phe
355 360 365
Thr Glu Cys Cys Glu Ala Ala Asp Lys Ala Ala Cys Leu Thr Pro Lys
370 375 380
Val Asp Ala Leu Arg Glu Lys Val Leu Ala Ser Ser Ala Lys Glu Arg
385 390 395 400
Leu Lys Cys Ala Ser Leu Gln Lys Phe Gly Glu Arg Ala Phe Lys Ala
405 410 415
Trp Ser Val Ala Arg Leu Ser Gln Lys Phe Pro Lys Ala Asp Phe Ala
420 425 430
Glu Ile Ser Lys Leu Val Thr Asp Leu Ala Lys Ile His Lys Glu Cys
435 440 445
Cys His Gly Asp Leu Leu Glu Cys Ala Asp Asp Arg Ala Asp Leu Ala
450 455 460
Lys Tyr Ile Cys Glu Asn Gln Asp Ser Ile Ser Thr Lys Leu Lys Glu
465 470 475 480
Cys Cys Gly Lys Pro Val Leu Glu Lys Ser His Cys Ile Ser Glu Ala
485 490 495
Glu Arg Asp Glu Leu Pro Ala Asp Leu Ala Pro Leu Ala Ala Asp Phe
500 505 510
Val Glu Asp Lys Glu Val Cys Lys Asn Tyr Gln Glu Ala Lys Asp Val
515 520 525
Phe Leu Gly Thr Phe Leu Tyr Glu Tyr Ser Arg Arg His Pro Glu Tyr
530 535 540
Ser Val Ser Leu Leu Leu Arg Leu Ala Lys Glu Tyr Glu Ala Thr Leu
545 550 555 560
Glu Lys Cys Cys Ala Thr Asp Asp Pro Pro Thr Cys Tyr Ala His Val
565 570 575
Phe Asp Glu Phe Lys Pro Leu Val Glu Glu Pro His Asn Leu Val Lys
580 585 590
Thr Asn Cys Glu Leu Phe Glu Lys Leu Gly Glu Tyr Gly Phe Gln Asn
595 600 605
Ala Leu Leu Val Arg Tyr Thr Lys Lys Val Pro Gln Val Ser Thr Pro
610 615 620
Thr Leu Val Glu Val Ser Arg Ser Leu Gly Lys Val Gly Ser Lys Cys
625 630 635 640
Cys Thr His Pro Glu Ser Glu Arg Leu Ser Cys Ala Glu Asp Tyr Leu
645 650 655
Ser Val Val Leu Asn Arg Leu Cys Val Leu His Glu Lys Thr Pro Val
660 665 670
Ser Glu Arg Val Thr Lys Cys Cys Thr Glu Ser Leu Val Asn Arg Arg
675 680 685
Pro Cys Phe Ser Ala Leu Gln Val Asp Glu Thr Tyr Val Pro Lys Glu
690 695 700
Phe Ser Ala Glu Thr Phe Thr Phe His Ala Asp Leu Cys Thr Leu Pro
705 710 715 720
Glu Ala Glu Lys Gln Ile Lys Lys Gln Ser Ala Leu Val Glu Leu Leu
725 730 735
Lys His Lys Pro Lys Ala Thr Asp Glu Gln Leu Lys Thr Val Met Gly
740 745 750
Asp Phe Gly Ser Phe Val Asp Lys Cys Cys Ala Ala Glu Asp Lys Glu
755 760 765
Ala Cys Phe Ala Glu Glu Gly Pro Lys Leu Val Ala Thr Thr Gln Ala
770 775 780
Ala Leu Ala Gly Gly Gly Gly Ser His His His His His His
785 790 795
<210> 2
<211> 630
<212> DNA
<213> IFN-α
<400> 2
ccggaattca tggcacttcc atcttctttc ttagtagctc tggtggcatt gggttgtaac 60
tctgtttgct gccttggatg cgatcttcca cagacacatg gacttcttaa ccgacgagca 120
cttacacttc ttggacagat gaaacgactt ccagcatctt cttgccagaa agatcgaaac 180
gatttcgcat tcccacagga tgtctttgga ggcgaccagt ctcataaagc acaggcactt 240
tctgttgttc atgttacaaa ccagaagata ttccacttct tttgtacaga agcatcttct 300
tctgcagcat ggaacacaac acttcttgaa gagttctgca caggacttga tcgacagctt 360
acatctcttg aagcatgcgt tatgcaggaa gttggagaag gagaagcacc acttacaaac 420
gaagattcta tccttcgaaa ctacttccag cgactttctc tttaccttca ggagaagaag 480
tcatcgccat gcgcatggga agttgttcga gcagaaatca tgcgatctct ttactactct 540
tctatcgcac ttcagaaacg acttcgatct gagaagggtg gcggcggttc ccaccatcat 600
catcatcatt gagcggccgc aaaaggaaaa 630
<210> 3
<211> 2415
<212> DNA
<213> IFN-α+ALB
<400> 3
ccggaattca tggcacttcc atcttctttc ctagtggccc tcgtggcatt aggctgtaac 60
tctgtttgct gccttggatg cgatcttcca cagacacatg gattgttgaa tcgcagagcg 120
cttacacttc ttggacagat gaaacgactt ccagcatctt cttgccagaa agatcgaaac 180
gatttcgcat tcccacagga tgtgtttgga ggtgatcaat ctcataaagc acaggcactg 240
tccgtggtcc acgtcacaaa ccagaagata tttcatttct tctgcacaga agcatcttct 300
tctgcagcat ggaacacaac acttcttgaa gagttctgca caggacttga tcgacagctt 360
acatctcttg aagcatgcgt tatgcaggaa gttggagaag gagaagcacc acttacaaac 420
gaagattcta tccttcgaaa ctacttccag cgactttctc tttaccttca ggagaagaag 480
agctcaccat gcgcatggga agttgttcga gcagaaatca tgcgatctct ttactactct 540
tctatcgcac ttcagaaacg acttcgatct gagaagggcg gaggcgggag ccgcggatta 600
acgcgacgag aagcacatca gtctgaaatc gcacatcgat tcaacgatct tggagaagaa 660
catttccgag gacttgttct tgttgcattc tctcagtacc ttcagcagtg cccattcgaa 720
gatcatgtta aacttgttaa cgaagttaca gagttcgcaa agggatgcgt cgcagatcag 780
gcagcagcaa actgcgagaa gagcctgcat gaattatttg gcgataaact ttgcacagtt 840
gcatctcttc gagataaata cggagaaatg gcagattgct gcgagaagaa ggagcccgaa 900
cgaaacgaat gcttccttca gcataaagat gataacccag gattcggaca gcttgttaca 960
ccagaagcag atgcaatgtg cacagcattc catgagaatg agcagcgatt ccttggaaag 1020
tatctatacg aaatcgcaag gcgccacccg tacttctacg ctccagaact tctttactac 1080
gcagaagaat acaaaggagt atttacggaa tgctgcgaag cagcagataa agcagcatgc 1140
cttacaccaa aggtcgacgc acttcgagag aaggtactcg ctagctctgc aaaggagcgt 1200
cttaaatgcg catctcttca gaaattcgga gaacgagcat tcaaagcatg gtctgttgca 1260
cgactttctc agaaattccc aaaggctgac ttcgcagaaa tctctaaact tgttactgac 1320
ctagcgaaga tacacaagga gtgttgtcac ggcgatcttc ttgaatgcgc agatgatcga 1380
gcagatctgg ccaagtatat atgcgagaat caagattcta tctctacaaa gctcaaagag 1440
tgttgtggta aacctgtgtt agagaagtcc cactgcatct ctgaagcaga acgagatgaa 1500
cttccagccg acctagcacc cttggcagca gatttcgttg aggacaagga ggtatgtaag 1560
aattatcagg aagcaaagga cgtcttcttg ggtacttttc tttacgaata ctctcggcgg 1620
cacccggagt attctgtttc tcttcttctt cgacttgcaa aggagtatga agcaacactt 1680
gagaaatgct gcgccactga cgatccacca acatgctacg cacatgtgtt tgacgagttc 1740
aaacctttag tagaggagcc tcataacctt gttaagacca attgcgaact gtttgagaaa 1800
ctaggtgaat acggattcca gaacgcactt cttgttcgat acacaaagaa ggtacctcag 1860
gtttctacac caacgttagt agaggtatcg cgatctcttg gaaaggtcgg ctctaagtgt 1920
tgtacgcacc ctgaatctga acgactttct tgcgcagaag attacctcag tgtagtgctt 1980
aacaggctct gtgttcttca tgagaagacg cctgtttctg aacgagttac aaagtgttgt 2040
actgagagcc ttgttaaccg acgaccatgc ttctctgcac ttcaggttga tgaaacatac 2100
gttccaaagg agttcagtgc tgaaacattc acattccatg cagatctttg cacacttcca 2160
gaagcagaga agcaaataaa gaagcaatcc gcacttgttg aacttcttaa acataaacca 2220
aaggcgaccg atgaacagct taagaccgtc atgggagatt tcggatcttt cgttgataag 2280
tgttgtgccg ctgaagacaa ggaggcttgt ttcgcagaag aaggaccaaa gttggtggca 2340
acaacacagg cagcacttgc aggcggtggt gggtcccacc accatcatca tcattgagcg 2400
gccgcaaaag gaaaa 2415
<210> 4
<211> 203
<212> PRT
<213> IFN-α
<400> 4
Pro Glu Phe Met Ala Leu Pro Ser Ser Phe Leu Val Ala Leu Val Ala
1 5 10 15
Leu Gly Cys Asn Ser Val Cys Cys Leu Gly Cys Asp Leu Pro Gln Thr
20 25 30
His Gly Leu Leu Asn Arg Arg Ala Leu Thr Leu Leu Gly Gln Met Lys
35 40 45
Arg Leu Pro Ala Ser Ser Cys Gln Lys Asp Arg Asn Asp Phe Ala Phe
50 55 60
Pro Gln Asp Val Phe Gly Gly Asp Gln Ser His Lys Ala Gln Ala Leu
65 70 75 80
Ser Val Val His Val Thr Asn Gln Lys Ile Phe His Phe Phe Cys Thr
85 90 95
Glu Ala Ser Ser Ser Ala Ala Trp Asn Thr Thr Leu Leu Glu Glu Phe
100 105 110
Cys Thr Gly Leu Asp Arg Gln Leu Thr Ser Leu Glu Ala Cys Val Met
115 120 125
Gln Glu Val Gly Glu Gly Glu Ala Pro Leu Thr Asn Glu Asp Ser Ile
130 135 140
Leu Arg Asn Tyr Phe Gln Arg Leu Ser Leu Tyr Leu Gln Glu Lys Lys
145 150 155 160
Ser Ser Pro Cys Ala Trp Glu Val Val Arg Ala Glu Ile Met Arg Ser
165 170 175
Leu Tyr Tyr Ser Ser Ile Ala Leu Gln Lys Arg Leu Arg Ser Glu Lys
180 185 190
Gly Gly Gly Gly Ser His His His His His His
195 200
Claims (10)
1. A long-acting interferon IFN-alpha + ALB, characterized in that the amino acid sequence is shown as SEQ ID NO.1, or the amino acid comprises a protein variant which is derived by substitution, deletion or insertion of one or more amino acid residues and still has the tiger interferon IFN-alpha function with over 80 percent of homology.
2. The long-acting interferon protein IFN-alpha + ALB according to claim 1, wherein the IFN-alpha + ALB is a fusion interferon protein modified by albumin, specifically, the tiger IFN-alpha and IFN-alpha + ALB genes optimized according to insect cell preferred codons are connected with a pFastBac1 vector to prepare a recombinant baculovirus Bacmid plasmid, and the recombinant baculovirus is obtained and is used for expression and purification after the insect cell is inoculated by the virus to obtain the long-acting interferon protein IFN-alpha + ALB.
3. The long-acting interferon protein IFN-alpha + ALB according to claim 2, wherein the nucleotide sequence of the optimized tiger IFN-alpha gene is shown as SEQ ID No. 2; or a nucleotide sequence modified by substitution, deletion and addition of one or more bases on the nucleotide sequence.
4. The long-acting interferon protein IFN- α + ALB according to claim 2, wherein the nucleotide sequence of the IFN- α + ALB gene is shown in SEQ ID No. 3; or a nucleotide sequence modified by substitution, deletion and addition of one or more bases on the nucleotide sequence.
5. The long-acting interferon protein IFN- α + ALB according to claim 2, wherein restriction enzymes of the optimized tiger IFN- α gene cleaved with the pFastBac1 vector are EcoRI and NotI; and the restriction enzymes for cutting the IFN-alpha + ALB gene and the pFastBac1 vector are EcoRI and NotI.
6. A method of producing the long-acting interferon protein IFN-. alpha. + ALB of any one of claims 1 to 5, comprising the steps of:
step one, construction of a recombinant baculovirus Bacmid plasmid: carrying out multi-cloning site analysis on the optimized tiger IFN-alpha gene, the fusion modified IFN-alpha + ALB gene and the gene of a pFastBac1 vector, and selecting two restriction enzyme sites which are provided on the vector but not in a target fragment: EcoRI and NotI, after double enzyme digestion, inserting the recovered target fragment into an insect cell expression vector pFastBac1, and transforming an escherichia coli DH10Bac competent cell to obtain a recombinant baculovirus Bacmid plasmid;
step two, rescuing the recombinant baculovirus: transfecting insect cells by using a recombinant baculovirus Bacmid plasmid, and rescuing to obtain a recombinant baculovirus;
step three, large-scale expression and purification of protein: infecting insect cells with the obtained recombinant baculovirus according to MOI (3), harvesting supernatant after 3 days, and purifying the obtained supernatant by a nickel column affinity chromatography mode to obtain the long-acting interferon protein IFN-alpha + ALB.
7. The method for preparing long-acting interferon protein IFN- α + ALB according to claim 6, wherein the first step is specifically performed by: respectively adding 1 mul of pFastBac-IFN-alpha and 1 mul of pFastBac-IFN-alpha + ALB into two 50 mul of DH10Bac competent cells, carrying out ice bath for 30min, carrying out heat shock at 42 ℃ for 45s, carrying out ice bath for 2min, adding 1ml of nonresistant LB culture medium, carrying out culture at 37 ℃ for 48h, picking out white spot colonies, adding the LB culture medium, carrying out shake culture at 37 ℃ and 200rpm/min for 12h, extracting plasmid DNA, carrying out PCR identification, and identifying the correct positive plasmid, namely the recombinant baculovirus Bacmid plasmid.
8. The method of claim 6, wherein the transfection is performed when the cell confluence of the insect cells reaches 80% or more in the second step.
9. The method of claim 6, wherein the step three comprises applying the supernatant to a nickel column to bind the IFN- α + ALB sufficiently, washing with 25mM imidazole, and eluting with 250mM imidazole.
10. The use of the long-acting interferon protein IFN- α + ALB of any of claims 1 to 9 for combating influenza in tigers.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011554908.9A CN112661860B (en) | 2020-12-25 | 2020-12-25 | Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011554908.9A CN112661860B (en) | 2020-12-25 | 2020-12-25 | Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112661860A true CN112661860A (en) | 2021-04-16 |
| CN112661860B CN112661860B (en) | 2023-06-23 |
Family
ID=75408559
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011554908.9A Active CN112661860B (en) | 2020-12-25 | 2020-12-25 | Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112661860B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103613668A (en) * | 2013-11-14 | 2014-03-05 | 长春西诺生物科技有限公司 | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof |
| CN104311671A (en) * | 2013-11-14 | 2015-01-28 | 长春西诺生物科技有限公司 | Cat long-acting fusion interferon as well as preparation method and application thereof |
| CN106336455A (en) * | 2016-10-13 | 2017-01-18 | 东北林业大学 | Siberian tiger alpha interferon and coding gene and application thereof |
| CN106399266A (en) * | 2016-09-18 | 2017-02-15 | 华南农业大学 | Recombinant baculovirus for expressing dog serum albumin fused interferon gamma and application of recombinant baculovirus |
| CN108840938A (en) * | 2017-08-09 | 2018-11-20 | 芜湖英特菲尔生物制品产业研究院有限公司 | A kind of fusion protein being made of pig albumin and Porcine interferon-gamma and preparation method thereof and a kind of Recombinant Swine long-acting interferon γ |
-
2020
- 2020-12-25 CN CN202011554908.9A patent/CN112661860B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103613668A (en) * | 2013-11-14 | 2014-03-05 | 长春西诺生物科技有限公司 | Long-acting fusion interferon for dogs and cats, as well as preparation method and application thereof |
| CN104311671A (en) * | 2013-11-14 | 2015-01-28 | 长春西诺生物科技有限公司 | Cat long-acting fusion interferon as well as preparation method and application thereof |
| CN106399266A (en) * | 2016-09-18 | 2017-02-15 | 华南农业大学 | Recombinant baculovirus for expressing dog serum albumin fused interferon gamma and application of recombinant baculovirus |
| CN106336455A (en) * | 2016-10-13 | 2017-01-18 | 东北林业大学 | Siberian tiger alpha interferon and coding gene and application thereof |
| CN108840938A (en) * | 2017-08-09 | 2018-11-20 | 芜湖英特菲尔生物制品产业研究院有限公司 | A kind of fusion protein being made of pig albumin and Porcine interferon-gamma and preparation method thereof and a kind of Recombinant Swine long-acting interferon γ |
Non-Patent Citations (3)
| Title |
|---|
| HONGJING ZHAO ET AL.: "Molecular cloning and functional characterization of eleven subtypes of interferon-α in Amur tigers (Panthera tigris altaica)", 《DEVELOPMENTAL AND COMPARATIVE IMMUNOLOGY》 * |
| 王晶宇等: "犬干扰素α2与犬白蛋白融合基因在昆虫细胞中的表达与活性分析", 《畜牧兽医学报》 * |
| 陈明涛等: "虎α干扰素与虎白蛋白融合蛋白的表达与鉴定", 《中国病原生物学杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112661860B (en) | 2023-06-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ding et al. | Identification of two subgroups of type I IFNs in perciforme fish large yellow croaker Larimichthys crocea provides novel insights into function and regulation of fish type I IFNs | |
| CN108314724B (en) | Cat omega 11 interferon mutant and preparation method and application thereof | |
| CN105518129B (en) | Attenuated influenza vaccines and uses thereof | |
| WO2014061735A1 (en) | NOVEL HIGH-FUNCTIONING ENZYME HAVING ALTERED HUMAN β-HEXOSAMINIDASE B SUBSTRATE SPECIFICITY, AND HAVING PROTEASE RESISTANCE APPLIED THERETO | |
| JP2008532995A (en) | How to use recombinant high-efficiency complex interferon | |
| Wang et al. | Molecular cloning, expression and antiviral activity of porcine interleukin-29 (poIL-29) | |
| CN106674354B (en) | Fusion protein of chicken interferon IFN-lambda and IFN-alpha | |
| CN111925994B (en) | Recombinant African swine fever virus with DP71L gene deleted and preparation method and application thereof | |
| Li et al. | First characterization of a teleost Epstein-Barr virus-induced gene 3 (EBI3) reveals a regulatory effect of EBI3 on the innate immune response of peripheral blood leukocytes | |
| CN107254482A (en) | A kind of method for improving Recombinant Swine interferon alpha fusion protein antiviral activity | |
| CN110393791B (en) | Anti-infection effect of hnRNPA2B1 and application thereof | |
| Jiang et al. | Distinct expression profiles and overlapping functions of IL-4/13A and IL-4/13B in grass carp (Ctenopharyngodon idella) | |
| CN109627316B (en) | Grass carp IFN-gamma 2 gene, recombinant protein coded by same and application of gene | |
| CN112661860B (en) | Tiger long-acting interferon, preparation method thereof and application thereof in resisting influenza virus | |
| CN110079553B (en) | Biological agent for enhancing disease resistance and epidemic disease resistance of pigs | |
| WO2020108427A1 (en) | NOVEL INTERFERON-α AND PREPARATION METHOD THEREFOR, COMPOSITION AND USE THEREOF | |
| Mostafa et al. | Genetic incompatibilities and reduced transmission in chickens may limit the evolution of reassortants between H9N2 and panzootic H5N8 clade 2.3. 4.4 avian influenza virus showing high virulence for mammals | |
| CN112426523A (en) | Pig vaccine containing antiviral composition and application | |
| CN112370524A (en) | Antiviral composition and preparation method and application thereof | |
| CN107096015A (en) | The antivirus action of novel antiviral molecule Kdm6a a kind of and its application | |
| CN109485719B (en) | A kind of new forms of interferon α 1 and preparation method thereof, composition and purposes | |
| WO2005016247A2 (en) | Dna sequences, peptides, antibodies and vaccines for prevention and treatment of sars | |
| CN108676083B (en) | Sheep gamma interferon mutant and preparation method and application thereof | |
| CN103014015A (en) | Gene segment for coding porcine interferon-gamma and application of gene segment | |
| CN114805539B (en) | Preparation method and application of pig interferon alpha 17 mutant recombinant protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |