CN112639086A

CN112639086A - Herbicide-resistant gene, polypeptide and application thereof in plant breeding

Info

Publication number: CN112639086A
Application number: CN202080003126.8A
Authority: CN
Inventors: 不公告发明人
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2019-04-30
Filing date: 2020-04-29
Publication date: 2021-04-09
Anticipated expiration: 2040-04-29
Also published as: WO2020221312A1; CN112639086B

Abstract

A mutated HPPD polypeptide is provided which differs from the parent HPPD polypeptide by one or more amino acid sequences, including a mutation at amino acid 342 corresponding to SEQ ID No. 1, which mutated HPPD polypeptide has a strong tolerance to herbicides. Also provided are genes encoding mutated HPPD polypeptides and their use in plant breeding.

Description

Herbicide-resistant gene, polypeptide and application thereof in plant breeding

Technical Field

The invention relates to the field of botany, in particular to herbicide-resistant genes, polypeptides and application thereof in plant breeding.

Background

p-Hydroxyphenylpyruvate Dioxygenase (4-Hydroxyphenylpyruvate Dioxygenase, HPPD, EC 1.13.11.27) is an important enzyme in Tyrosine metabolism in organisms, and is present in almost all aerobic organisms, in which Tyrosine (Tyrosine) in organisms produces p-Hydroxyphenylpyruvate (HPPA) under the action of Tyrosine Aminotransferase (TAT), and in the presence of oxygen HPPD catalyzes the conversion of HPPA to Homogentisate (HGA). In animals, the main function of HPPD is to promote the catabolism of tyrosine, aromatic amino acid and phenylalanine. However, the action in plants is significantly different from that in animals, homogentisate further forms plastoquinones (plastoquinones) and tocopherols (vitamin E). The tocopherol plays a role of a membrane-related antioxidant, is an essential antioxidant for plant growth, and can effectively enhance the stress resistance of plants. In plants, over 60% of chlorophyll is bound to a light-harvesting antenna complex, which absorbs solar light energy and transfers excitation energy to a photosynthesis reaction center, whereas carotenoids are important components of chlorophyll-binding proteins and antenna systems in the reaction center, play an important role in plant photosynthesis, absorb and transfer electrons, and play an important role in scavenging free radicals.

Inhibition of HPPD leads to uncoupling of photosynthesis within plant cells, a deficiency in secondary light harvesting pigments, and chlorophyll destruction due to active oxygen intermediates and photo-oxidation, resulting in albinism of plant photosynthetic tissues, growth being inhibited until death, due to the lack of photoprotection normally provided by carotenoids. Thus, HPPD was identified as a herbicide target since the 90's of the 20 th century. HPPD inhibiting herbicides have proven to be very effective selective herbicides, have broad-spectrum herbicidal activity, can be used both pre-emergent and post-emergent, and have the characteristics of high activity, low residue, safety to mammals, environmental friendliness and the like. At present, 5 herbicides targeting HPPD have been developed according to structural classification, mainly including triketones, pyrazo □ ketones, isoxazolones, diketonitriles and benzophenones.

However, these HPPD inhibiting herbicides also cause some damage to crops while they indiscriminately kill weeds, and it is therefore particularly important to obtain herbicide-tolerant crops. Current strategies, in addition to attempting to bypass HPPD-mediated homogentisate production, include overexpression of this enzyme to produce large quantities of herbicide target enzyme in plants, mitigating the inhibitory effects of herbicides. Over-expression of HPPD results in plants having better pre-emergence tolerance to the diketonitrile derivative of isoxaflutole (DKN), but insufficient tolerance to post-emergence herbicide treatment.

Therefore, there is an urgent need in the art to develop and improve tolerance systems to HPPD inhibitors.

Disclosure of Invention

The invention aims to provide an HPPD resistance gene with high resistance to an HPPD inhibitor, an encoding polypeptide and application thereof.

In a first aspect of the invention, there is provided an isolated herbicide resistance polypeptide which is a mutated HPPD polypeptide,

and the mutated HPPD polypeptide differs from the parent HPPD polypeptide in one or more amino acid sequences, the difference comprising a mutation at amino acid 342, corresponding to SEQ ID No. 1:

tyrosine (Y) at position 342.

In another preferred embodiment, the tyrosine (Y) at position 342 is mutated to one or more amino acids selected from the group consisting of: histidine (H), asparagine (Asn), alanine (Ala), lysine (Lys), arginine (Arg), cysteine (C) phenylalanine (Phe).

In another preferred embodiment, the tyrosine (Y) at position 342 is mutated to histidine (H) or cysteine (C).

In another preferred embodiment, the tyrosine (Y) at position 342 is mutated to histidine (H).

In another preferred embodiment, the herbicide resistance polypeptide further comprises an additional mutation site mutated at one or more amino acids corresponding to SEQ ID No.1 selected from the group consisting of:

serine (S) at position 214;

arginine (R) at position 349;

proline (P) at position 340;

threonine (T) at position 341;

tyrosine (Y) at position 343;

glutamine (Q) at position 344;

asparagine (N) at position 345;

leucine (L) at position 346;

lysine (K) at position 347;

lysine (K) at position 348;

valine (V) at position 350;

glycine (G) at position 351;

aspartic acid (D) at position 352;

glutamic acid (E) at position 433.

In another preferred embodiment, the serine (S) at position 214 is mutated to one or more amino acids selected from the group consisting of: valine (V), leucine (L).

In another preferred embodiment, the arginine (R) at position 349 is mutated to one or more amino acids selected from the group consisting of: serine (S), threonine (T).

In another preferred embodiment, proline (P) at position 340 is mutated to one or more amino acids selected from the group consisting of: alanine (a), serine (S), leucine (L).

In another preferred embodiment, the threonine (T) at position 341 is mutated to one or more amino acids selected from the group consisting of: histidine (H), arginine (R), lysine (K).

In another preferred embodiment, the tyrosine (Y) at position 343 is mutated to one or more amino acids selected from the group consisting of: histidine (H), cysteine (C), arginine (R), lysine (K), phenylalanine (F).

In another preferred embodiment, the glutamine (Q) at position 344 is mutated to one or more amino acids selected from the group consisting of: arginine (R), tryptophan (W).

In another preferred embodiment, asparagine (N) at position 345 is mutated to one or more amino acids selected from the group consisting of: aspartic acid (D), glycine (G).

In another preferred embodiment, the leucine (L) at position 346 is mutated to one or more amino acids selected from the group consisting of: phenylalanine (F), serine (S).

In another preferred embodiment, lysine (K) at position 347 is mutated to one or more amino acids selected from the group consisting of: glutamic acid (E), glycine (G).

In another preferred embodiment, lysine (K) at position 348 is mutated to one or more amino acids selected from the group consisting of: glutamic acid (E), glycine (G).

In another preferred embodiment, valine (V) at position 350 is mutated to one or more amino acids selected from the group consisting of: alanine (a), serine (S), threonine (T).

In another preferred embodiment, glycine (G) at position 351 is mutated to one or more amino acids selected from the group consisting of: serine (S), aspartic acid (D), asparagine (N).

In another preferred embodiment, the aspartic acid (D) at position 352 is mutated to one or more amino acids selected from the group consisting of: aspartic acid (N), glycine (G), serine (S).

In another preferred embodiment, the glutamic acid (E) at position 433 is mutated to one or more amino acids selected from the group consisting of: lysine (K), arginine (R).

In another preferred embodiment, the mutation comprises Y342H in combination with one or more mutations selected from the group consisting of: S214V, S214L, R349S, R349T, E433K, E433R.

In another preferred embodiment, the mutation is selected from the group consisting of: Y342H, R349S, or a combination thereof.

In another preferred embodiment, said further mutation site is capable of maintaining or enhancing the tolerance or resistance of the mutant polypeptide to an HPPD inhibiting herbicide or increasing the applicability of the mutant HPPD polypeptide to an herbicide.

In another preferred embodiment, the amino acid sequence of the herbicide resistance polypeptide is as shown in SEQ ID No.2 or 3.

In another preferred embodiment, the herbicide-resistant polypeptide is a polypeptide having an amino acid sequence shown in SEQ ID No.2 or 3, an active fragment thereof, or a conservative variant thereof.

In another preferred embodiment, the herbicide-resistant polypeptide is a polypeptide having an amino acid sequence shown in SEQ ID No. 4 or 5, an active fragment thereof, or a conservative variant thereof.

In another preferred embodiment, the mutein has an amino acid sequence which is identical or substantially identical to the sequence shown in SEQ ID No.1, except for the mutations (e.g.at positions 214, 342, 349, 340, 341, 343, 344, 345, 346, 347, 348, 350, 351, 352, 433).

In another preferred embodiment, the substantial identity is a difference of up to 50 (preferably 1-20, more preferably 1-10, more preferably 1-5) amino acids, wherein the difference comprises a substitution, deletion or addition of an amino acid, and the mutein has herbicide tolerance activity.

In another preferred embodiment, the herbicide is an HPPD inhibiting herbicide selected from the group consisting of: triketones, diketonitriles, isoxazoles, pyrazoles, benzophenones, quinazolindiones, or combinations thereof.

In another preferred embodiment, the triketone herbicide is selected from the group consisting of: sulcotrione, mesotrione, tembotrione, bicyclosulfuron, or a combination thereof.

In another preferred embodiment, the isoxazole herbicide is selected from the group consisting of: isoxaflutole, isoxachlorotole, clomazone, or a combination thereof.

In another preferred embodiment, the quinazolinedione herbicides comprise the compounds described in quinazolinone, mequintocet, CN104557739A and CN 110669016A.

In another preferred embodiment, the herbicide resistance polypeptide has at least 80%, preferably at least 85% or 90%, more preferably at least 95%, and most preferably at least 98% or 99% homology with the sequence shown in SEQ ID No. 1.

In another preferred embodiment, the sequence of the parent HPPD polypeptide has at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to the amino acid sequence as depicted in SEQ ID No. 1.

In another preferred embodiment, the herbicide tolerance concentration of the herbicide resistance polypeptide V1 is greater than or equal to 2V 1/V2, preferably greater than or equal to 3V 1/V2, preferably greater than or equal to 4V 1/V2, preferably greater than or equal to 5V 1/V2, preferably greater than or equal to 6V 1/V2, preferably greater than or equal to 8V 1/V2, more preferably greater than or equal to 10V 1/V2, compared to the tolerance concentration of the parent HPPD polypeptide to the same herbicide V2.

In another preferred example, the parent HPPD polypeptide is derived from a monocotyledonous or dicotyledonous plant.

In another preferred embodiment, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of: plants of Gramineae, Leguminosae and Brassicaceae.

In another preferred embodiment, the parent HPPD polypeptide is derived from one or more plants selected from the group consisting of: rice, corn, tobacco, sorghum, wheat, barley, soybean, arabidopsis, potato, tomato, lettuce, rape, cabbage, quinoa.

In another preferred embodiment, the parent HPPD polypeptide is derived from Arabidopsis thaliana (Arabidopsis thaliana).

In another preferred embodiment, the herbicide resistance polypeptide is derived from a monocot or dicot.

In another preferred embodiment, the herbicide resistance polypeptide is derived from one or more plants selected from the group consisting of: plants of Gramineae, Leguminosae and Brassicaceae.

In another preferred embodiment, the herbicide resistance polypeptide is derived from one or more plants selected from the group consisting of: rice, corn, tobacco, sorghum, wheat, barley, soybean, arabidopsis, potato, tomato, lettuce, rape, cabbage, quinoa.

In another preferred embodiment, the herbicide resistance polypeptide is derived from Arabidopsis thaliana (Arabidopsis thaliana).

In another preferred embodiment, the herbicide resistance polypeptide is capable of tolerating a herbicide at a concentration of 5. mu.M or more, preferably 10. mu.M or more, preferably 20. mu.M or more, preferably 50. mu.M or more, more preferably 100. mu.M or more.

In another preferred embodiment, the herbicide resistance polypeptide is capable of tolerating a herbicide at a concentration of 10-400. mu.M, preferably ≥ 20-300. mu.M, more preferably 40-260. mu.M.

In another preferred embodiment, the herbicide resistance polypeptide is selected from the group consisting of:

(a) a polypeptide having an amino acid sequence as set forth in SEQ ID No.2 or 3;

(b) a polypeptide derived from (a) and having herbicide tolerance activity, which is formed by substituting, deleting or adding one or more (such as 2,3, 4 or 5) amino acid residues in the amino acid sequence shown in SEQ ID NO.2 or 3.

In another preferred embodiment, the derived polypeptide has at least 60%, preferably at least 70%, more preferably at least 80%, most preferably at least 90%, such as 95%, 97%, 99% homology with the sequence as shown in SEQ ID No.2 or 3.

In another preferred embodiment, the herbicide resistance polypeptide is mutated from a wild-type HPPD polypeptide as set forth in SEQ ID No. 1.

In a second aspect, the present invention provides an isolated polynucleotide encoding a herbicide resistance polypeptide according to the first aspect of the invention.

In another preferred embodiment, the polynucleotide is selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide as set forth in SEQ ID No. 2-3;

(b) a polynucleotide having a sequence as set forth in SEQ ID No. 6;

(c) a polynucleotide having a nucleotide sequence having 80% or more (preferably 90% or more, more preferably 95% or more, most preferably 98%) homology with the sequence shown in SEQ ID No. 6, and encoding a polypeptide shown in SEQ ID No. 2-3;

(d) a polynucleotide complementary to any one of the polynucleotides of (a) - (c).

In another preferred embodiment, the polynucleotide is selected from the group consisting of: a genomic sequence, a cDNA sequence, an RNA sequence, or a combination thereof.

In another preferred embodiment, said polynucleotide additionally comprises an auxiliary element selected from the group consisting of: a signal peptide, a secretory peptide, a tag sequence (e.g., 6His), or a combination thereof.

In another preferred embodiment, the polynucleotide further comprises a regulatory element operably linked thereto.

In another preferred embodiment said regulatory element is selected from one or more of the group consisting of: enhancer, rotor

A seat, a promoter, a terminator, a leader sequence, a polyadenylation sequence and a marker gene.

In another preferred embodiment, the polynucleotide further comprises a promoter operably linked to the ORF sequence of the herbicide resistance polypeptide.

In another preferred embodiment, the promoter is selected from the group consisting of: a constitutive promoter, a tissue specific promoter, an inducible promoter, or a strong promoter.

In a third aspect, the invention provides a vector comprising a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the vector comprises an expression vector, a shuttle vector and an integration vector.

In a fourth aspect, the invention provides a host cell comprising a vector according to the third aspect of the invention or a genome into which a polynucleotide according to the second aspect of the invention has been integrated.

In another preferred embodiment, the host cell is a eukaryotic cell, such as a yeast cell or a plant cell.

In another preferred embodiment, the host cell is a prokaryotic cell, such as E.coli.

In another preferred embodiment, the eukaryotic cell comprises a plant cell.

In another preferred embodiment, the plant includes angiosperms and gymnosperms.

In another preferred embodiment, the gymnosperm is selected from the group consisting of: cycadaceae (Cycadaceae), podocarpaeaceae (podocarpaeceae), araucaceae (araucaceae), Pinaceae (Pinaceae), cedaceae, cypress, cephalotaxaceae, taxaceae, ephedra, gnetaceae, monotype, welchidaceae, or combinations thereof.

In another preferred embodiment, the plant includes a monocotyledon and a dicotyledon.

In another preferred embodiment, the plant includes herbaceous plants and woody plants.

In another preferred embodiment, the herbaceous plant is selected from the group consisting of: solanaceae, gramineae, leguminous plants, or combinations thereof.

In another preferred embodiment, the woody plant is selected from the group consisting of: actinidiaceae, Rosaceae, Moraceae, or their combination.

In another preferred embodiment, the plant is selected from the group consisting of: cruciferous plants, gramineae, leguminous plants, solanaceae, actinidiaceae, malvaceae, paeoniaceae, rosaceae, liliaceae, or combinations thereof.

In another preferred embodiment, the plant is selected from the group consisting of: arabidopsis, tobacco, rice, cabbage, soybean, tomato, corn, tobacco, wheat, barley, millet, sorghum, potato, quinoa, lettuce, rape, strawberry, or a combination thereof.

In a fifth aspect, the present invention provides a method for preparing a herbicide resistance polypeptide, said method comprising the steps of:

(a) culturing a host cell according to the fourth aspect of the invention under conditions suitable for expression, thereby expressing the herbicide resistance polypeptide; and

(b) isolating said herbicide resistance polypeptide.

In a sixth aspect, the invention provides an enzyme preparation comprising a herbicide resistance polypeptide according to the first aspect of the invention.

In another preferred embodiment, the enzyme preparation comprises an injection, and/or a lyophilized preparation.

In a seventh aspect of the present invention, there is provided a method of modifying a plant, said method comprising the steps of:

(a) providing a plant cell, wherein the plant cell is engineered such that the plant cell expresses a herbicide resistance polypeptide of the first aspect of the invention; and

(b) regenerating the plant cell of step (a) into a plant.

In another preferred embodiment, the plant cell is engineered by one or more methods selected from the group consisting of: genetic engineering, natural mutagenesis, physical mutagenesis (e.g., ultraviolet mutagenesis, X-ray or Y-ray mutagenesis), chemical mutagenesis (e.g., nitrous acid, hydroxylamine, EMS, nitrosoguanidine, etc.), biological mutagenesis (e.g., viral or bacterial-mediated mutagenesis).

In another preferred embodiment, the step (a) includes the steps of:

(1) providing an agrobacterium carrying expression vector comprising a DNA coding sequence for a herbicide resistance polypeptide of the first aspect of the invention;

(2) contacting a plant cell with the agrobacterium of step (1) such that the DNA coding sequence for the herbicide resistance polypeptide is transferred into the plant cell and integrated into the chromosome of the plant cell; and

(3) selecting plant cells into which has been transferred a DNA coding sequence for said herbicide resistance polypeptide.

In another preferred embodiment, in step (a), the plant cell is engineered using gene editing techniques such that the plant cell expresses the herbicide resistance polypeptide of the first aspect of the invention.

In another preferred example, in step (a), the plant cell is engineered using gene editing techniques such that the HPPD in the plant cell is mutated at the tyrosine corresponding to position 342 of SEQ ID No. 1.

In another preferred example, in step (a), the method further comprises modifying the plant cell by gene editing technology to mutate the HPPD in the plant cell at an amino acid corresponding to one or more of positions 214, 349, 340, 341, 343, 344, 345, 346, 347, 348, 350, 351, 352, 433 of SEQ ID No. 1.

In another preferred embodiment, the gene editing technique is selected from the group consisting of: CRISPR gene editing system, error-prone PCR, gene recombination, TALEN and ZFN.

In another preferred embodiment, the gene editing technology includes any technical method that can generate the mutation.

In another preferred embodiment, the method improves the herbicide tolerance of a plant.

In another preferred example, the method further comprises the steps of: the plant cells are tested for their herbicide resistance.

In another preferred example, the tolerance concentration of the plant under the condition of the culture medium is more than or equal to 50 nM; preferably, not less than 100 nM; preferably, not less than 200 nM; preferably, not less than 250 nM; preferably, not less than 300 nM; preferably, 350nM or more, preferably 400nM or more; more preferably, at least 450 nM.

In another preferred example, the plant can tolerate the concentration of more than or equal to 5 mu M under the soil cultivation condition; preferably, not less than 10 μ M; preferably, not less than 15 μ M; more preferably, not less than 20. mu.M.

In another preferred embodiment, the plant is capable of tolerating the herbicide at a concentration of 5 μ M to 50 μ M, preferably 10 μ M to 30 μ M, more preferably 10 μ M to 25 μ M, more preferably 15 μ M to 20 μ M under soil cultivation conditions.

In another preferred embodiment, the plant is a plant that grows for 2-4 weeks.

In another preferred embodiment, said tolerance is treated by applying a herbicide.

In another preferred embodiment, the plants modified by the method are capable of tolerating, in succession to germination, at least a herbicide (mesotrione, sulcotrione, tembotrione, isoxaflutole, clethodim and/or mequintocet) at a concentration of 50nM, preferably 100nM, more preferably 200 nM.

In an eighth aspect, the invention provides a use of the herbicide-resistant polypeptide of the first aspect of the invention or a gene encoding the same for breeding a plant herbicide-resistant line, or for preparing a reagent or a kit for breeding a plant herbicide-resistant line.

In a ninth aspect, the present invention provides a herbicide resistance susceptible site, said site comprising:

(I) a first resistance-sensitive site corresponding to (i) amino acid 342 of a wild-type HPPD polypeptide from Arabidopsis thaliana; (ii) amino acid 339 of wild type HPPD polypeptide derived from rice; (iii) amino acid 334 of a wild-type HPPD polypeptide derived from maize; (iv) amino acid 333 of a wild-type HPPD polypeptide derived from sorghum; (v) amino acid 329 of a wild-type HPPD polypeptide derived from wheat; or (vi) amino acid 341 of a soybean-derived wild-type HPPD polypeptide.

In another preferred embodiment, the resistance sensitive site further comprises:

(II) a second desensitization sensitive site corresponding to (i) amino acid 349 of a wild-type HPPD polypeptide derived from arabidopsis thaliana, (II) amino acid 346 of a wild-type HPPD polypeptide derived from rice; (iii) amino acid 341 of a wild-type HPPD polypeptide from maize; (iv) amino acid 340 of a wild-type HPPD polypeptide derived from sorghum; (v) amino acid 336 of a wild-type HPPD polypeptide derived from wheat; or (vi) amino acid 348 of a wild-type HPPD polypeptide derived from soybean.

In another preferred embodiment, the resistance sensitivity sites further comprise other resistance sensitivity sites corresponding to (i) one or more amino acids in positions 340, 341, 343, 344, 345, 346, 347, 348, 350, 351, 352, 433 of a wild-type HPPD polypeptide derived from arabidopsis thaliana; (ii) amino acids 337, 338, 339, 341, 342, 343, 344, 345, 346, 348, 349, 430 of a wild-type HPPD polypeptide derived from rice; (iii) amino acids 332,333, 335, 336, 337, 338, 339, 340, 342, 343, 344,432 of a wild-type HPPD polypeptide derived from maize; (iv) amino acids 331, 332, 334, 335, 336, 337, 338, 339, 341, 342, 343,424 of a wild-type HPPD polypeptide derived from sorghum; (v) amino acids 327,328, 330, 331, 332,333,334, 335, 337, 338, 339,420 of a wild-type HPPD polypeptide derived from wheat; or (vi) amino acid 339, 340, 342, 343, 344, 345, 346, 347, 349, 350, 351,432 of a wild-type HPPD polypeptide derived from soybean.

In another preferred embodiment, the polypeptide has sensitivity and insensitivity, when the site is tyrosine (Y), the polypeptide is sensitive, and the polypeptide is sensitive to an herbicide; when the site is histidine (H), asparagine (Asn), glutamine (Gln), lysine (Lys), arginine (Arg), or cysteine (C), the polypeptide is insensitive and is resistant to herbicides,

preferably, compared with the tolerance concentration V2 of the sensitive polypeptide to the same herbicide, the tolerance concentration V1 of the insensitive polypeptide to the herbicide is more than or equal to 2V 1/V2, more than or equal to 3V 1/V2, more than or equal to 4V 1/V2, more than or equal to 5V 1/V2, more than or equal to 6V 1/V2, more than or equal to 8V 1/V2, more preferably more than or equal to 5V 1/V2, and more preferably more than or equal to 10V 1/V2.

In another preferred embodiment, the polypeptide has a sensitive type and an insensitive type, the polypeptide is sensitive when the first site of resistance sensitivity is tyrosine (Y) and the second site of resistance sensitivity is arginine (R), and the polypeptide is sensitive to an herbicide; when the first resistance-sensitive site is histidine (H), asparagine (Asn), alanine (Ala), lysine (Lys), arginine (Arg), cysteine (C) or phenylalanine (Phe) and the second resistance-sensitive site is serine (S), threonine (T), the polypeptide is a non-susceptible type and the polypeptide is resistant to herbicides.

In another preferred embodiment, the insensitive polypeptide is the herbicide resistance polypeptide of claim 1 and the sensitive polypeptide is a wild-type HPPD polypeptide.

In a tenth aspect of the invention there is provided a fusion protein comprising said mutant polypeptide or biologically active fragment thereof, fused to another component, e.g. a tag peptide such as a histidine tag, e.g. 6 × His, or a plastid targeting peptide, e.g. a peptide which targets chloroplasts.

In an eleventh aspect of the invention, there is provided a plant cell, plant tissue, plant part, plant which is tolerant or resistant to a HPPD-inhibiting herbicide, wherein said plant cell, plant tissue, plant part, plant comprises said herbicide resistance polypeptide or polynucleotide sequence thereof.

In a twelfth aspect of the invention, there is provided a method of identifying or selecting a transformed plant cell, plant tissue, plant or part thereof, comprising: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed plant cell, plant tissue, plant or part thereof comprises a herbicide resistance polypeptide according to the first aspect of the invention or a polynucleotide according to the second aspect of the invention or a vector according to the third aspect of the invention;

(ii) contacting the transformed plant cell, plant tissue, plant or part thereof with a herbicide;

(iii) determining whether the plant cell, plant tissue, plant or part thereof is affected by the herbicide; and

(iv) identifying or selecting a transformed plant cell, plant tissue, plant or part thereof.

In another preferred embodiment, the plant cell, plant tissue, plant or part thereof may comprise another isolated polynucleotide.

In a twelfth aspect of the present invention, there is provided a method for identifying herbicide-tolerant plants, comprising:

(i) identifying whether the plant sample has a herbicide resistance polypeptide according to the first aspect of the invention or a polynucleotide according to the second aspect of the invention or a vector according to the third aspect of the invention.

In another preferred embodiment, in step (i), it is determined by sequencing whether the herbicide resistance polypeptide of the first aspect of the invention or the polynucleotide of the second aspect of the invention or the vector of the third aspect of the invention is present in the plant sample.

In a thirteenth aspect of the present invention, there is provided a method of controlling unwanted plants at a plant cultivation site, characterized in that the method comprises:

(1) planting at the cultivation site a plant comprising an herbicide resistance polypeptide of the first aspect of the invention or a polynucleotide of the second aspect of the invention or a vector of the third aspect of the invention;

(2) applying an effective amount of herbicide to said plants at said cultivation site.

In a fourteenth aspect of the present invention, there is provided a method for producing a herbicide-resistant plant, characterized by comprising:

crossing a first plant with a second plant, wherein said first plant is a herbicide-resistant plant comprising an herbicide-resistance polypeptide according to the first aspect of the invention or a polynucleotide according to the second aspect of the invention or a vector according to the third aspect of the invention.

In another preferred embodiment, the second plant is a non-herbicide or less herbicide resistant plant.

In a fifteenth aspect of the present invention, there is provided a method of screening for herbicide tolerance or identifying a triketone herbicide comprising the steps of:

(a) applying a test compound to a plant expressing a mutant HPPD polypeptide according to claim 1 in the presence of the test compound in a test panel, and analyzing the growth or viability of the plant;

and analyzing the growth or viability of said plants in a control group without application of said test compound and under otherwise identical conditions;

(b) comparing the growth or viability of the plants of the test group and the control group, wherein if the growth or viability of the plants to which the test compound is applied is not affected or is well grown as compared to the control group, it is an indication that the test compound is herbicide tolerant or a triketone herbicide.

In another preferred embodiment, the growth or viability condition comprises: leaf color, plant height, survival rate.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows a schematic diagram of AtHPPD base editing library construction.

FIG. 2 shows that single base editing is detected in the 2-21 heterozygote AtHPPD gene.

FIG. 3 shows phenotypic segregation of 2-21 heterozygote seeds on MST resistance selection medium.

FIG. 4 shows that all 2-21 progeny plants with MST resistance were detected to contain the T to C mutation.

FIG. 5 shows that 2-21 seedlings have both normal growth and development and higher MST resistance.

FIG. 6 shows that 2-21 had 5 μ M MST spray tolerance under soil culture conditions.

FIG. 7 shows that AtHPPDY342H transgenic T1 represents MST resistance.

FIG. 8 shows that AtHPPDY342H transgenic T2 represents MST resistance.

FIG. 9 shows the tolerance of AtHPPDY342H plants to different herbicides.

FIG. 10 shows sequence differences analyzed after Sanger sequencing of rice editing plants.

Figure 11 shows the difference in rice plants after 7 days of spraying with 4g.a.i/mu clethodim.

Detailed Description

The present inventors have conducted extensive and intensive studies and, for the first time, have unexpectedly screened key amino acid sites having herbicide tolerance activity in plants. The invention discovers that the herbicide tolerance of plants can be remarkably improved after key sites in wild type HPPD polypeptides are modified. On this basis, the present inventors have completed the present invention.

Term(s) for

As used herein, the term "AxxB" means the amino acid a at position xx is changed to amino acid B, e.g., "L87I" means the amino acid L at position 87 is mutated to I, and so on.

As used herein, the term "HPPD" refers to p-Hydroxyphenylpyruvate Dioxygenase (HPPD, EC 1.13.11.27), which is a key enzyme in catalyzing the reaction of the degradation product of tyrosine, p-Hydroxyphenylpyruvate (HPP), the oxidation of which to form Homogentisate (HGA), present in various organisms. Inhibition of HPPD results in uncoupling of photosynthesis within plant cells, a deficiency in secondary light harvesting pigments, and chlorophyll destruction due to the lack of photoprotection normally provided by carotenoids, reactive oxygen intermediates and photooxidation, with consequent albinism of plant photosynthetic tissues, growth being inhibited until death. HPPD inhibiting herbicides have proven to be very effective selective herbicides, have broad-spectrum herbicidal activity, can be used both pre-emergent and post-emergent, and have the characteristics of high activity, low residue, safety to mammals, environmental friendliness and the like.

As used herein, the terms "HPPD inhibitor", "HPPD-inhibiting herbicide" are used interchangeably and refer to substances that are either herbicidal by themselves or in combination with other herbicides and/or additives that alter their effectiveness, which appear to be agents that inhibit plant growth or even kill plants by inhibiting HPPD, substances that are herbicidal by themselves by inhibiting HPPD are well known in the art, including many types, 1) triketones, for example, Sulcotrione (CAS number: 99105-77-8); mesotrione (Mesotrione, CAS number 104206-82-8); fluroxyprione (bicyclopyrone, CAS number: 352010-68-5); tembotrione (CAS number: 335104-84-2); mesotrione (tefuryltrione, CAS number 473278-76-1); benzobicylon (Benzobicyclon, CAS number: 156963-66-5); 2) diketonitriles, for example, 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-4-trifluoromethylphenyl) propane-1, 3-dione (CAS number: 143701-75-1); 2-cyano-3-cyclopropyl-1- (2-methylsulfonyl-3, 4-dichlorophenyl) propane-1, 3-dione (CAS number: 212829-55-5); 2-cyano-1- [4- (methylsulfonyl) -2-trifluoromethylphenyl]-3- (1-methylcyclopropyl) propane-1, 3-dione (CAS number 143659-52-3); 3) isoxazoles, for example, isoxaflutole (isoxaflutole, also known as isoxaflutole, CAS number: 141112-29-0); isoxachlorotole (isoxachlorotolole, CAS No. 141112-06-3); clomazone (CAS number: 81777-89-1); 4) pyrazoles, for example, topramezone (CAS number: 210631-68-8); sulfonylopyrazole (pyrasulfotole, CAS number: 365400-11-9); benzoxazole (pyrazoxyfen, CAS number: 71561-11-0); pyrazolate (pyrazolite, CAS number: 58011-68-0); bicotrione (benzofenap, CAS number: 82692-44-2)(ii) a Topramezone (CAS number: 1622908-18-2); tolpyralate (CAS number: 1101132-67-5); benzoxaflutole (CAS number: 1992017-55-6); bicyclopyrone (CAS number: 1855929-45-1); mesotrione triazolate (CAS number: 1911613-97-2); 5) benzophenones; 6) quinazolinediones, which refer to compounds containing the formula

HPPD inhibitor compounds with quinazoline diketone mother nucleus structure are disclosed in patent publication Nos. CN110669016A, CN104557739A, WO2019196904A1 and the like, such as quizalofop (CAS No. 1639426-14-4) and methyl quizalofop (CAS No. 1639426-42-8). 7) Other classes: lancotrione (CAS number: 1486617-21-3); fenquinolones (CAS number: 1342891-70-6). Preferably, the herbicide is an isoxazole, a triketone; preferably, the herbicide is isoxaflutole, mesotrione. The herbicides can be used in combination with the type of crop or weed to which they are applied, in controlling unwanted vegetation (e.g., weeds) before emergence, after emergence, before planting and at the time of planting. Preferably a triketone HPPD inhibitor such as sulcotrione, mesotrione, tembotrione.

The term "effective amount" or "effective concentration" means an amount or concentration, respectively, that is sufficient to kill or inhibit the growth of a non-target plant, plant tissue, plant cell, or host cell, but that does not kill or severely inhibit the growth of the herbicide-resistant plant, plant tissue, plant cell, and host cell of the present invention (the target plant). The non-target plant can be a similar parent (or wild type) plant, plant tissue, plant cell or host cell, and can also be a weed, or a wild type plant not related to the target plant that emerges from the cultivation site (e.g., soybean that emerges from a corn field). Generally, an effective amount of herbicide is an amount routinely used in agricultural production systems to kill weeds of interest. Such amounts are known to those of ordinary skill in the art. The herbicides according to the invention exhibit herbicidal activity when applied to plants or to the locus of plants directly at any stage of growth or prior to planting or emergence. The effect observed depends on the plant species to be controlled, the growth stage of the plant, the application parameters and spray droplet size of the dilution, the particle size of the solid components, the environmental conditions at the time of use, the specific compounds used, the specific adjuvants and carriers used, the soil type, etc., and the amount of chemical applied. These and other factors can be adjusted to promote non-selective or selective herbicidal action, as is known in the art.

As used herein, the terms "herbicide-resistance polypeptide", "mutated HPPD polypeptide", "mutated pappd polypeptide", "mutated HPPD protein", "mutated HPPD enzyme", "polypeptide of the invention", and the like, all used interchangeably, refer to a polypeptide according to the first aspect of the invention.

In another preferred embodiment, the herbicide resistance polypeptide is a protein or polypeptide having SEQ ID NO. 2-3, or a derivative polypeptide or active fragment thereof derived to have the same herbicide tolerance activity.

As used herein, the terms "herbicide resistance", "herbicide tolerance activity", used interchangeably, refer to tolerance to herbicides, particularly triketone HPPD inhibitors, such as sulcotrione, mesotrione, tembotrione or tembotrione, and the tolerance to herbicide resistance of the present invention can be characterized by the concentration or amount of herbicide used.

The term "parent nucleotide or polypeptide" refers to a nucleic acid molecule or polypeptide (protein) that can be found in nature, including wild-type nucleic acid molecules or proteins (polypeptides) that have not been artificially engineered, and also including nucleic acid molecules or proteins (polypeptides) that have been artificially engineered but do not contain the present disclosure. The nucleotide can be obtained by genetic engineering techniques, such as genome sequencing, Polymerase Chain Reaction (PCR), etc., and the amino acid sequence can be deduced from the nucleotide sequence. The "parent plant" is a plant that contains a parent nucleotide or polypeptide. The "parent nucleotide or polypeptide" may be extracted from the parent plant according to techniques well known to those skilled in the art, or may be obtained by chemical synthesis. The amino acid sequence of the parent HPPD polypeptide is shown as SEQ ID No. 1.

"tolerance" or "resistance" as used herein refers to the ability of an HPPD protein or a cell, tissue or plant containing the protein to withstand a herbicide while maintaining enzymatic activity or viability or plant growth, and can generally be characterized by parameters such as the amount or concentration of the herbicide used. Further, in the present invention, an HPPD enzyme that "has increased tolerance to an HPPD-inhibiting herbicide" or "has increased resistance to an HPPD-inhibiting herbicide" refers to an HPPD enzyme that exhibits at least 1.5-10 times greater tolerance (e.g., with the maximum tolerance concentration being the characterizing parameter) than the parent HPPD enzyme, under equivalent conditions to the parent HPPD enzyme, while maintaining its activity in catalyzing the conversion of p-hydroxyphenylpyruvate to homogentisate. By "enhanced tolerance to an HPPD-inhibiting herbicide" or "enhanced resistance to an HPPD-inhibiting herbicide" is meant a plant that has increased tolerance or resistance to said HPPD-inhibiting herbicide as compared to a wild-type plant of the same species at a tolerant concentration that is at least 2-fold to 16-fold higher than the tolerant concentration of a wild-type plant of the same species. The best degree of the improvement of "tolerance" or "resistance" according to the invention is that the undesired plants can be reduced or inhibited or killed without affecting the growth or viability of the plants containing the muteins according to the invention at the same herbicide application amount or concentration.

As used herein, "isolated" refers to a substance that is separated from its original environment (which, if it is a natural substance, is the natural environment). If the polynucleotide or polypeptide in its native state in a living cell is not isolated or purified, the same polynucleotide or polypeptide is isolated or purified if it is separated from other substances coexisting in its native state.

As used herein, "isolated herbicide resistance polypeptide" means that the herbicide resistance polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify the herbicide resistance polypeptide using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel.

As used herein, the "amino acid" refers to a carboxylic acid containing an amino group. Each protein in an organism is composed of 20 basic amino acids. Except glycine, the amino acid is L-alpha-amino acid (wherein proline is L-alpha-imino acid), and the structural general formula of the amino acid is shown in the specification

(R group is a variable group).

The terms "protein", "polypeptide" and "peptide" are used interchangeably herein to refer to an amino acid

A residue polymer, including polymers in which one or more amino acid residues are chemical analogues of a natural amino acid residue. The proteins and polypeptides of the invention may be produced recombinantly or may be chemically synthesized.

The term "unwanted plants" is understood to mean plants of no practical or practical value which influence the normal growth of the desired plant (e.g. crop plants) and may include weeds, for example dicotyledonous and monocotyledonous weeds. Dicotyledonous weeds include, but are not limited to, weeds of the genera: sinapis (Sinapis), Lepidium (Lepidium), Galium Larresiae, Stellaria (Stellaria), Matricaria (Matricaria), Anthemis (Anthemis), Echinacea (Galinsoga), Chenopodium (Chenopodium), Urtica (Urtica), Senecio (Senecio), Amaranthus (Amaranthus), Portulaca (Portulaca), Xanthium (Xanthium), Convolvulus (Conlvoulus), Ipomoea (Ipomoea), Polygonum (Polygonum), Sesbania (Sesbania), Ambrosia (Ambrosia), thistle (Cirsium), Carduus (Carduus), Sonchus (Sonchus), Solanum (Solanum), Rorippa (Rorippa), Arthroma (Rotala), Matricaria (Lindernia), Hypericum (Veronica), Abutilon (Abutilon), Terra (Emex), Datura (Datura), Viola (Viola), Sasa (Galeopsis), Papaver (Papaver), Centaurea (Centaurea), Oenothera (Trifolium), Ranunculus (Ranunculus) and Taraxacum (Taraxacum). Monocotyledonous weeds include, but are not limited to, weeds of the genera: echinochloa (Echinochloa), Setaria (Setaria), Panicum (Panicum), Digitaria (Digitaria), Phleum (Phleum), Poa pratensis (Poa), Festuca (Festuca), Eleusine (Eleusine), Brachiaria (Brachiaria), Lolium (Lolium), Bromus (Bromus), Avena (Avena), Cyperus (Cyperus), Sorghum (Sorghum), Agropyron (Agropyron), Cynodon (Cynodon), Potentilla (Monochoria), Fimbristylis (Fimbristylis), Sagittaria (Sagittaria), Eleocharis (Eleococcus), Scirpus (Scirpus), Agrimonium (Pasalaum), Sparganium (Isemula), cuspidochaeta (Sphacea), Sphacea (Spargania), and Alternaria (Alternaria). The undesirable plants may also include other plants different from the plants to be cultivated, such as crops like naturally growing parts of rice cultivated land or small quantities of soybeans;

in the present invention, the term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant calli, plant pieces, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, ears, roots, root tips, anthers and the like.

In the present invention, the term "gene editing" technology mainly includes CRISPR technology, TALEN technology, ZFN technology. Gene editing tools referred to in CRISPR technology include guideRNA, Cas proteins (e.g., Cas9, Cpf1, Cas12b, etc.), which can recognize and cleave target DNA under the guidance of guideRNA. The gene editing tool referred to in TALEN technology is a restriction enzyme that can cleave a specific DNA sequence, which includes one TAL effector DNA binding domain and one DNA cleavage domain. The gene editing tool referred to in ZFN technology is also a restriction enzyme that can cut a specific DNA sequence, and includes a zinc finger DNA binding domain and a DNA cleavage domain. It is well known to those skilled in the art that editing of intracellular genomes can be achieved by constructing the nucleotides encoding gene editing tools and other regulatory elements into suitable vectors and transforming the cells, the types of editing including gene knock-outs, insertions, base edits.

As used herein, the term "operably linked" is intended to mean that the nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell).

The terms "polynucleotide", "nucleotide sequence", "nucleic acid molecule" and "nucleic acid" are used interchangeably and include DNA, RNA or hybrids thereof, whether double-stranded or single-stranded.

The term "homology" or "identity" is used to refer to the match of sequences between two polypeptides or between two nucleic acids. When a position in both of the sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. For example, the identity of two nucleotide sequences can be confirmed by: the BLAST algorithm, obtained from the National Center for Biotechnology Information (NCBI), of the United states (Altschulet al, 1990, mol. biol.215:403-10), was determined using default parameters.

Muteins of the invention and nucleic acids encoding the same

As used herein, the terms "mutein", "mutein of the invention", "herbicide-resistant polypeptide of the invention", "mutated HPPD polypeptide" are used interchangeably and refer to a non-naturally occurring HPPD polypeptide that is mutated and the mutein is a protein that is artificially engineered based on the protein shown in SEQ ID No.1, wherein the mutein comprises core amino acids that are associated with herbicide tolerance activity and at least one of the core amino acids is artificially engineered.

The term "core amino acid" refers to a sequence based on SEQ ID No.1 and having at least 80%, such as 84%, 85%, 90%, 92%, 95%, 98% or 99% homology to SEQ ID No.1, the corresponding site being a particular amino acid as described herein, such as the sequence shown in SEQ ID No.1, the core amino acid being:

serine (S) at position 214; and/or

Tyrosine (Y) at position 342; and/or

Arginine (R) at position 349; and/or

Proline (P) at position 340; and/or

Threonine (T) at position 341; and/or

Tyrosine (Y) at position 343; and/or

Glutamine (Q) at position 344; and/or

Asparagine (N) at position 345; and/or

Leucine (L) at position 346; and/or

Lysine (K) at position 347; and/or

Lysine (K) at position 348; and/or

Valine (V) at position 350; and/or

Glycine (G) at position 351; and/or

Aspartic acid (D) at position 352; and/or

Glutamic acid (E) at position 433, and a mutein obtained by mutating the above core amino acid has herbicide tolerance activity.

Preferably, in the present invention, the core amino acid of the present invention is mutated as follows:

serine (S) at position 214 is mutated to valine (V) or leucine (L); and/or

Tyrosine (Y) at position 342 is mutated to histidine (H), asparagine (Asn), alanine (Ala), lysine (Lys), arginine (Arg), cysteine (C) or phenylalanine (Phe); and/or

Arginine (R) at position 349 is mutated to threonine (T) or serine (S); and/or

Proline (P) at position 340 is mutated into alanine (A) and serine (S) leucine (L);

threonine (T) at position 341 is mutated to histidine (H), arginine (R) or lysine (K);

the 343 rd tyrosine (Y) is mutated into histidine (H), cysteine (C), arginine (R), lysine (K) or phenylalanine (F);

glutamine (Q) at position 344 is mutated to arginine (R) or tryptophan (W);

asparagine (N) at position 345 is mutated to aspartic acid (D) or glycine (G);

leucine (L) at position 346 is mutated to phenylalanine (F) or serine (S);

lysine (K) at position 347 is mutated to glutamic acid (E) or glycine (G);

lysine (K) at position 348 is mutated to glutamic acid (E) or glycine (G);

valine (V) at position 350 is mutated to alanine (a), serine (S) or threonine (T);

glycine (G) at position 351 is mutated to serine (S), aspartic acid (D) or asparagine (N);

aspartic acid (D) at position 352 is mutated to aspartic acid (N), glycine (G) or serine (S); and/or

Glutamic acid (E) at position 433 was mutated to lysine (K) or arginine (R).

It is understood that the amino acid numbering in the muteins of the invention is based on SEQ ID No.1, and that when a particular mutein has 80% or more homology to the sequence shown in SEQ ID No.1, the amino acid numbering of the mutein may be misaligned with respect to the amino acid numbering of SEQ ID No.1, e.g., by 1-5 positions toward the N-terminus or C-terminus of the amino acid, whereas with sequence alignment techniques that are conventional in the art, one skilled in the art would generally appreciate that such misalignment is within a reasonable range and that muteins having the same or similar herbicide tolerance activity that have 80% (e.g., 90%, 95%, 98%) homology due to the misalignment of the amino acid numbering are not within the scope of the muteins of the invention.

In the present invention, the parent hydroxyphenylpyruvate dioxygenase protein may be derived from any plant, in particular from the aforementioned monocotyledonous or dicotyledonous plants. The sequences of the parent (e.g., wild-type) hydroxyphenylpyruvate dioxygenase protein, from several sources, as well as the coding sequences, have been disclosed in the prior art documents, which are incorporated herein by reference.

Preferably, the parent hydroxyphenylpyruvate dioxygenase protein of the invention is derived from Arabidopsis or Oryza. More preferably, said parent hydroxyphenylpyruvate dioxygenase protein has the amino acid sequence shown in SEQ ID No.1 or an amino acid sequence which has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the amino acid sequence shown in SEQ ID No. 1.

The muteins of the present invention are synthetic or recombinant proteins, i.e., they may be chemically synthesized products or produced using recombinant techniques from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants). Depending on the host used in the recombinant production protocol, the muteins of the invention may be glycosylated or may be non-glycosylated. The mutant proteins of the present invention may or may not also include an initial methionine residue.

The invention also includes fragments, derivatives and analogues of the muteins. As used herein, the terms "fragment," "derivative," and "analog" refer to a protein that retains substantially the same biological function or activity as the mutein.

The mutein fragment, derivative or analogue of the invention may be (i) a mutein wherein one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a mutein having a substituent group in one or more amino acid residues, or (iii) a mutein wherein the mature mutein is fused to another compound, such as a compound that extends the half-life of the mutein, e.g. polyethylene glycol, or (iv) a mutein wherein an additional amino acid sequence is fused to the mutein sequence, such as a leader or secretory sequence or a sequence used to purify the mutein or a proprotein sequence, or a fusion protein with an antigenic IgG fragment. Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein. In the present invention, conservatively substituted amino acids are preferably generated by amino acid substitutions according to Table I.

TABLE I

The active muteins of the invention have herbicide tolerance activity.

Preferably, the mutein is shown in SEQ ID No.2 or 3. It is understood that the muteins of the invention generally have a higher homology (identity) with the sequence shown in SEQ ID No.2 or 3, preferably said muteins have a homology of at least 80%, preferably at least 85% to 90%, more preferably at least 95%, most preferably at least 98% or 99% with the sequence shown in SEQ ID No.2 or 3.

In addition, the mutant protein can be modified. Modified (generally without altering primary structure) forms include: chemically derivatized forms of the mutein such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from glycosylation modifications during synthesis and processing of the mutein or during further processing steps. Such modification may be accomplished by exposing the mutein to an enzyme that performs glycosylation, such as mammalian glycosylase or deglycosylase. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are muteins which have been modified to increase their resistance to proteolysis or to optimize solubility.

The term "polynucleotide encoding a mutein" may be a polynucleotide comprising a polynucleotide encoding a mutein of the invention, or may also comprise additional coding and/or non-coding sequences.

In a preferred embodiment, the polynucleotide of the invention encoding a mutein has the sequence shown in SEQ ID No. 6.

The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polypeptides or muteins of the same amino acid sequence as the present invention. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the mutein it encodes.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides hybridizable under stringent conditions (or stringent conditions) with the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) formamide, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more.

The muteins and polynucleotides of the present invention are preferably provided in isolated form, and more preferably, purified to homogeneity.

The full-length sequence of the polynucleotide of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

Methods for amplifying DNA/RNA using PCR techniques are preferably used to obtain the polynucleotides of the invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The polynucleotide sequences of the present invention may be used to express or produce recombinant herbicide resistance polypeptides by conventional recombinant DNA techniques (Science, 1984; 224: 1431). Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide (or variant) of the invention encoding a herbicide resistance polypeptide, or with a recombinant expression vector containing the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

It is noted that positions 342, 349, 343, 346, 347, 348, 350, 351, 433 in the amino acid sequence of the HPPD from arabidopsis thaliana of the present invention are conserved positions in rice (sequence ref. genebank, XM _015770677, corresponding positions 339, 346, 340, 343, 344, 345, 347, 348, 430), in sorghum (sequence ref. UNIPROT: C5XVJ3, corresponding positions 333, 340, 334, 337, 338, 339, 341, 342, 424), in wheat (sequence ref. UNIPROT: Q45FE8, 329, 336, 330, 333,334, 335, 337, 338, 420), in soybean (sequence ref. A5Z1N7, corresponding positions 341, 348, 342, 345, 346, 347, 349, 350, 432), in maize (sequence ref. prot: I7 s1, 334, hi341, 335, 338, 339, 340, 342, 343, 432). Thus, the above-mentioned sites have a crucial role in the resistance of the herbicide in crops.

In a preferred embodiment, the rice OsHPPD wild-type amino acid sequence is shown in SEQ ID No. 12.

In a preferred embodiment, the amino acid sequence of the mutant OsHPPD (Y339H) is shown as SEQ ID NO. 13.

Carrier and plant improvement

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells transformed with the vector or herbicide resistance polypeptide coding sequences of the invention, and methods for producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus, or other vector well known in the art. In general, any plasmid or vector can be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they typically contain an origin of replication, a promoter, a marker gene, a terminator and translation control elements.

The promoter of the present invention may be any nucleotide sequence which shows transcriptional activity in the host cell of choice including mutant, truncated, and hybrid promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or heterologous to the host cell. As the promoter to be expressed in plant cells or plants, it is preferable to use a promoter native to p-hydroxyphenylpyruvate dioxygenase, or a heterologous promoter active in plants. The promoter may be constitutively expressed or may be inducible. Examples of the promoter include, for example, a histone promoter, a rice actin promoter, a plant virus promoter such as a cauliflower mosaic virus promoter, and the like.

In certain embodiments, the expression vectors of the invention further comprise at least one origin of replication for autonomous replication. The choice of vector will generally depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vector may be an autonomously replicating vector, i.e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any element which ensures self-replication. Alternatively, in certain embodiments, the vector may be one which, when introduced into a host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon may be used. Alternatively, the vector may be a vector for gene editing of an HPPD gene endogenous to the host cell.

Vectors may be of the type, for example, plasmids, viruses, cosmids, phages and the like, which are well known to those skilled in the art and are described extensively in the art. Preferably, the expression vector in the present invention is a plasmid. The expression vector may also contain one or more selectable marker genes for use in selecting host cells containing the vector. Such selectable markers include the gene encoding dihydrofolate reductase, or the gene conferring neomycin tolerance, the gene conferring resistance to tetracycline or ampicillin, and the like.

More than one copy of a polynucleotide of the invention may be inserted into a host cell to increase the yield of the gene product. An increase in the number of copies of a polynucleotide can be achieved by integrating at least one additional copy of the sequence into the host cell genome or by including an amplifiable selectable marker gene with the polynucleotide, in which case cells containing amplified copies of the selectable marker gene, and thus additional copies of the polynucleotide, can be selected for by artificially culturing the cells in the presence of the appropriate selectable agent.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a herbicide resistance polypeptide and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells (e.g., cells of crops and forestry plants). Representative examples are: escherichia coli, Streptomyces, Agrobacterium; fungal cells such as yeast; plant cells, animal cells, and the like.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, e.g., E.coli, competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The transformed plant may also be transformed by Agrobacterium transformation or gene gun transformation, such as leaf disk method. The transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain plants with altered herbicide tolerance.

The plant cells can also express the herbicide-resistant polypeptide of the present invention by directly editing HPPD in the genome of the target plant using gene editing techniques. Representative gene editing techniques include CRISPR gene editing systems, error prone PCR, gene recombination, TALENs, and ZFNs.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell disruption by osmosis, ultrafiltration, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Recombinant herbicide resistance polypeptides have a variety of uses. For example, for screening for compounds, polypeptides or other ligands that promote or confer function on polypeptides that are resistant to herbicides. Screening of polypeptide libraries with expressed recombinant herbicide-resistant polypeptides can be used to find valuable polypeptide molecules that can stimulate the function of herbicide-resistant polypeptides.

In another aspect, the invention also includes polyclonal and monoclonal antibodies, particularly monoclonal antibodies, specific for the herbicide resistance polypeptide or the gene encoding it. The present invention includes not only intact monoclonal or polyclonal antibodies, but also immunologically active antibody fragments, or chimeric antibodies.

The antibodies of the invention can be prepared by a variety of techniques known to those skilled in the art. For example, the purified herbicide-resistant polypeptide gene product, or antigenic fragment thereof, can be administered to an animal to induce the production of polyclonal antibodies. The antibodies of the invention can be obtained by conventional immunization techniques using fragments or functional regions of the gene products of the herbicide-resistant polypeptides. These fragments or functional regions can be prepared by recombinant methods or synthesized using a polypeptide synthesizer. Antibodies that bind to an unmodified form of the herbicide resistance polypeptide gene product can be produced by immunizing an animal with a gene product produced in a prokaryotic cell (e.g., e.coli); antibodies that bind to post-translationally modified forms (e.g., glycosylated or phosphorylated proteins or polypeptides) can be obtained by immunizing an animal with a gene product produced in a eukaryotic cell (e.g., a yeast or insect cell). Antibodies against herbicide resistance polypeptides can be used to detect herbicide resistance polypeptides in a sample.

One method of detecting the presence of a herbicide resistance polypeptide in a sample is by using an antibody specific for the herbicide resistance polypeptide, which comprises: contacting the sample with an antibody specific for a herbicide resistance polypeptide; observing whether an antibody complex is formed, the formation of an antibody complex being indicative of the presence of an herbicide resistance polypeptide in the sample.

A part or all of the polynucleotide of the present invention can be used as a probe to be fixed on a microarray or a DNA chip (also called a "gene chip") for analyzing the differential expression analysis of genes in tissues. In vitro amplification by RNA-polymerase chain reaction (RT-PCR) using primers specific for herbicide resistant polypeptides can also detect transcription products of herbicide resistant polypeptides.

The present invention also provides a method for increasing the tolerance or resistance of a plant cell, plant tissue, plant part or plant to an HPPD-inhibiting herbicide, which comprises transforming said plant or part thereof with a nucleic acid molecule comprising a nucleic acid sequence encoding a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the invention and allowing expression thereof. The nucleic acid molecule may be expressed as an extrachromosomal entity or may be integrated into the genome of the plant cell for expression, in particular by homologous recombination at the location of an endogenous gene in the plant cell.

The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant or part thereof, comprising crossing a plant expressing a mutant hydroxyphenylpyruvate dioxygenase (HPPD) protein, or a biologically active fragment or fusion protein thereof, according to the invention, with another plant, and screening for plants or parts thereof having increased HPPD-inhibiting herbicide tolerance or resistance.

The present invention also provides a method of increasing HPPD-inhibiting herbicide tolerance or resistance in a plant cell, plant tissue, plant part or plant comprising genetically editing an endogenous HPPD protein of said plant cell, plant tissue, plant part or plant to effect expression therein of a mutant p-hydroxyphenylpyruvate dioxygenase protein, or a biologically active fragment or fusion protein thereof, of the present invention.

The invention further relates to plant cells, plant tissues, plant parts and plants, and progeny thereof, obtained by the above method. Preferably, plant cells, plant tissues or plant parts transformed with a polynucleotide of the present invention can be regenerated into whole plants. The invention includes cell cultures, including tissue cell cultures, liquid cultures, and solid plate cultures. Seeds produced by and/or used to regenerate the plants of the invention are also included within the scope of the invention. Other plant tissues and parts are also encompassed by the present invention. The invention likewise includes methods for producing plants or cells which contain the nucleic acid molecules according to the invention. One preferred method of producing such plants is by planting the seeds of the invention. Plants transformed in this way can acquire resistance to a variety of herbicides with different modes of action.

The invention also provides a method of controlling undesired vegetation in a plant-cultivated area in an amount effective for controlling undesired vegetation, which comprises applying to the cultivated area comprising a plant or seed of the invention an amount effective for controlling undesired vegetation of one or more HPPD-inhibiting herbicides.

In the present invention, the term "cultivated land" includes a field for cultivating the plant of the present invention such as soil, and also includes, for example, plant seeds, plant seedlings and grown plants. The term "an effective amount to control undesired vegetation" refers to an amount of herbicide sufficient to affect the growth or development of undesired vegetation, such as weeds, for example, to prevent or inhibit the growth or development of undesired vegetation, or to kill the undesired vegetation. Advantageously, the controlling of the undesired plant effective amount does not significantly affect the growth and/or development of the plant seeds, plant seedlings or plants of the present invention. One skilled in the art can determine such an amount of undesired vegetation effective for control by routine experimentation.

The present invention provides a method of use for identifying triketone HPPD herbicides by using mutant HPPDs having a polypeptide or active fragment according to SEQ ID No.2 or SEQ ID No. 3. The method comprises the following steps: providing a mutant HPPD polypeptide, or a cell or plant (test panel) expressing a mutant HPPD polypeptide; applying the test compound to a mutant HPPD polypeptide, or a cell or plant expressing a mutant HPPD polypeptide and a control group of parent (e.g., wild-type) proteins, cells, or plants; determining the activity or growth or viability of the test and control groups; selecting a test compound that causes a reduction in activity or growth or viability of the control group as compared to the test group.

The main advantages of the invention include:

(a) the invention discovers for the first time that the characteristic of herbicide resistance can be endowed to plants after mutation of the 1024 th base of the Arabidopsis thaliana HPPD from T to C and mutation of the corresponding 342 th amino acid from Y to R; it is at amino acid homologous site 339 in rice, and can also confer herbicide resistance to plant after mutation.

(b) Resistance or tolerance of arabidopsis thaliana to herbicides can be enhanced by introducing a gene encoding a herbicide resistance polypeptide.

(c) By introducing a gene encoding the herbicide resistance polypeptide of the present invention, the resistance or tolerance of a plant to herbicides can be enhanced.

(d) The herbicide resistance polypeptide can be used for cultivating new varieties of herbicide-tolerant plants.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Unless otherwise specified, reagents and materials in the examples of the present invention are commercially available products.

Example 1 screening of herbicide resistant mutant sites

1. Construction of sgRNA library

267 grnas were designed (at GACCCGTTTCTTGAGATTC SEQ ID No.:7) within the AtHPPD genomic sequence; TACCAGAATCTCAAGAAAC (SEQ ID NO: 8); TCTGGTAGTAAGTAGGCGG (SEQ ID No.:9) as in table 1) and cloning these grnas into 3 base editing vectors as in fig. 1, three base editing expression libraries were constructed, and library 1 and 2 were the editors of base C to T and library 3 vectors were the editors of base a to G. The backbone of each of the three library-constructing plasmids was pCambia 1300. PU6 represents the Arabidopsis U6 promoter used in the vector, derived from Arabidopsis staining No.3 (LR 215054.1: 4569938-4570230); PUBQ indicates that the Arabidopsis AtUBQ1 promoter sequence is derived from Arabidopsis thaliana staining No.3 (CP 002686.1: 19505047-19505665); the APOBEC1, nCAS9 and UGI sequences used in libraries 1 and 2 are referenced in Gaudelli NM et al [1 ]. ABE7.10 used in library 3 is referred to Komor AC et al [2 ].

2. Experimental materials and method steps related to the construction of the expression vector of the base editor;

1) BSA1 enzyme digestion of base editor vector at 37 ℃ for 4 hours

2) sgRNA complementary double strand annealing and phosphorylation

3) The ligation reaction was performed at room temperature for 10min:

4) the ligation product was transformed into E.coli DH5 alpha

5) Spread to LB plate to which 30. mu.g/L kanamycin had been added

6) Scraping clone extracting plasmid library

3. Genetic transformation of vectors

1) Mu.g of the library plasmid was transformed into Agrobacterium GV1301 and plated onto LB plates supplemented with 25. mu.g/L rifampicin and 30. mu.g/L kanamycin.

2) The colonies were collected by scraping.

3) The flower dipping method is used for transfecting Arabidopsis thaliana Col-0. Not less than 100 shoots were transfected per library.

4) T1 generation seeds were collected. Screening T1 generation positive seedlings on 1/2MS +40 mug/L hygromycin (Hyg) culture medium, and transplanting the seedlings to soil. T2 generation seeds were harvested.

4. Screening of T2 generation plants

Screening T2 generation plants, wherein the screening culture medium is 1/2MS +40 mug/L hygromycin (Hyg) +100nM Mesotrione (MST), and obtaining 2-21 seedlings through screening. The seedlings contain T to C mutation through sequencing detection, and the amino acid sequence is converted from Y to R at position 342, namely, the base T at position 1024 of AT1G06570.1 CDs sequence (Genebank access: NM-100536) is converted into C. Sequencing primer SEQ2: GCTCTTGTCGTTCCTTCTTC (SEQ ID No.: 10); SEQ3: CGGAACAAAGAGGAAGAGTC (SEQ ID NO: 11). The gene detection map is shown in FIG. 2.

5. 2-21 heterozygote plants exhibiting herbicide resistance

Seeds from 2-21 heterozygote plants germinated on herbicide-containing medium (1/2MS + 40. mu.g/L Hyg +100nM MST) with phenotypic segregation, as shown in FIG. 3. Considering the trait segregation of the hygromycin resistance gene, the normal emergence rate of resistance for the dominant herbicide resistant mutation is 9/16. Our resistant shoots were 21 plants/36 plants on average, and compared to theoretical data. Indicating that the plants were herbicide resistant under the conditions of either heterozygous or homozygous mutation of Y342R.

6. 2-21 mutation site can be stably inherited in filial generation

The sequence of the herbicide-resistant progeny HPPD gene of the 2-21 heterozygote plant is further detected by sequencing, and the sequencing map is shown in FIG. 4. 10 tested MST resistant plants, 4 homozygous for the T to C mutation at position 1024 of the cDNA, and 6 heterozygous.

7. 2-21 mutant plants tolerance test to MST under culture Medium conditions

The homozygote edited by 2-21 bases has no influence on the normal growth of the plant on 1/2MS culture medium, and in 1/2MS + MST herbicide culture medium, when the concentration of MST is as high as 200nM, the leaves of the 2-21 homozygote are still green, the growth condition of seedlings is shown in figure 5, which shows that the 2-21 homozygote plant has good tolerance to MST. The maximum tolerated concentration of 2-21 homozygotes for MST under germination growth conditions on medium is approximately 200 nM.

8. 2-21 mutant plants have better tolerance to MST under soil conditions

Under the soil cultivation condition, the 16L/8D, 2-21 homozygote plants and the wild Col-0 are respectively sprayed with 0 mu M, 1 mu M, 5 mu M and 20 mu M MST for two weeks in the bolting period under the growth culture condition of 22 ℃, 2-21 homozygotes can tolerate the spraying of 20 mu M MST, the plant growth condition is shown in figure 6, and the condition that the-21 homozygotes have better tolerance to high-concentration MST is shown.

9. The Y342R mutant transgenic plant has better tolerance than the wild plant

(1) Construction of pCambia 1305-PAtHPPD: AtHPPDY342R-HA and pCambia 1305-PAtHPPD: AtHPPD-HA vector, AtHPPD 342R transgenic T1 generation plants show MST antibody phenotype on 1/2MS +40 mug/L Hyg +100nM MST screening culture medium, while the plant T1 generation plants transferred with the control non-mutated AtHPPD gene do not show obvious resistance, and the seedling growth condition is shown in figure 7, which shows that Y342R mutation can endow plants with good herbicide resistance activity.

(2) Amplifying endogenous promoter and genome sequence of the arabidopsis thaliana AtHPPD gene, mutating a Y342H site in vitro by using a PCR mode, and constructing transgenic vectors of arabidopsis thaliana wild type AtHPPD gene (HPDWT) and Y342H mutated AtHPPD gene (HPDY 342H). The wild type Arabidopsis thaliana Col-0 was transformed. The resulting transgenic plants of the T2 generation were screened for herbicide resistance as shown in fig. 8. Transplanting the seedlings which germinate for 11 days into soil, spraying 5 mu M MST after 10 days of growth, photographing after two weeks to observe the phenotype as shown in figure 8A, continuously spraying 5 mu M MST for the second time, and photographing after two weeks to observe the phenotype as shown in figure 8B. The results showed that the transgenic plants HPDY342H T2-19 and T2-18 line into which the Y342H mutated AtHPPD gene was transferred had stronger tolerance to MST than the HPDWT T2-2 and T2-21 lines into which the wild-type AtHPPD gene was transferred.

10. The 2-21 mutant has good tolerance to other HPPD inhibiting herbicides

Seeds of 2-21(AtHPPD Y342H) and Col-0 were germinated on 1/2MS medium supplemented with 50nM and 100nM ISO (isoxaflutole), 2. mu.g/L mequindox, respectively, to develop a 14-day recording phenotype, indicating that 2-21 exhibited resistance to various types of HPPD inhibitors (see FIG. 9).

Example 2 enhancement of herbicide resistance by the Y339H mutation in HPPD from Rice

1. Vector construction

And (3) selecting a carrier: selecting a plant-optimized Crispr-ABE vector with high editing efficiency, taking NG as a PAM structural domain of a recognition position, and designing sgRNA aiming at a Y-H site on an HPPD gene. Design of sgRNA-F: GGTAGTAGTTGGGCGGCGGC (SEQ ID No.:14) and sgRNA-R: GCCGCCGCCCAACTACTACC (SEQ ID NO.:15), with appropriate cohesive ends added to either side of the sequence, was constructed on a rice Crispr-ABE vector.

The cleavage of Crispr-ABE vector: 30. mu.L of the digestion system: repeatedly sucking and mixing with a gun, or flicking the tube wall with fingers, and then quickly centrifuging.

Reagent	Volume of
ddH ₂O	Make up to 30. mu.L
Crispr-ABE	2μg
CutSmart	3μL
BsaI-HF	1μL

Reaction conditions are as follows:

temperature of	Time
37℃	4h
12℃	∞

Using a gel recovery method, electrophoresis: agarose concentration: 0.8 percent; electrophoretic voltage: 80V; electrophoresis time: 1.5h

Primer annealing artificially synthesized DNA oligonucleotides were annealed double-stranded as follows:

each DNA oligonucleotide was diluted to 10. mu.M with 1 XTaq buffer, and 1. mu.L of each of the upstream and downstream primers was aspirated and mixed for annealing. After annealing, the product is placed on ice or stored at-20 ℃.

Reagent	Volume of
Primer-F	1μL
Primer-R	1μL
1×Taq buffer	8μL

T4 ligation vector was ligated using 10. mu.L ligation system, T4DNA ligase system for 30min at 25 ℃.

10 μ L system:

reagent	Volume of
ddH ₂O	Make up to 10 mu L
Vector	30ng
10×T4 DNA ligase rection buffer	1μL
T4 Ligase	0.5μL
Variable last gRNA addition	1μL

Reaction conditions are as follows:

coli (electric conversion/transformation)

The method uses an electric converter and comprises the following steps:

electrode cup: ddH₂After O washing, soaking the mixture in 75% ethanol for 20 minutes, soaking the mixture in absolute ethanol for 20 minutes, drying the mixture in a fume hood, and precooling the mixture on ice;

subpackaging LB with a 1.5mL centrifuge tube, and preheating at 28 ℃;

thawing the competent cells on ice for 5 min;

mu.L of the ligation product was added to 50. mu.L of E.coli for electrotransformation and mixed well.

Sucking the mixed solution into an electrode cup, flicking and uniformly mixing, and electrically shocking;

the preheated LB 700. mu.L was poured into an electrode cup, and the cells were washed into a 2ml tube. Cleaning the electrode cup and soaking the electrode cup in 75% ethanol;

shaking the bacterial liquid at 37 ℃ and 200rpm for 1 h;

the bacterial liquid was spread on LB plates containing the selected resistance and cultured overnight at 37 ℃ by inversion.

And extracting plasmids, sequencing and obtaining the final gene editing vector.

Agrobacterium tumefaciens transformation (electric transformation)

subpackaging YEP with a 1.5mL centrifuge tube, and preheating at 28 ℃;

thawing the competent cells on ice for 5 min;

sucking 1 mul of plasmid and mixing with competent cell;

shaking the bacterial liquid at the temperature of 28 ℃ and the rpm of 200 for 1.5-2 h;

the suspension was pipetted 500. mu.L (determined by plate size and competent transformation efficiency) and spread on YEP plates containing selection resistance and cultured upside down for 2 d.

2. Callus transformation

Inducing calli of rice Xishui 134: stripping rice seeds, washing the seeds with sterile water until the washed water becomes clear, sterilizing with 70% alcohol for 30 seconds, then placing 5% sodium hypochlorite in a horizontal shaking table for shaking culture for 20 minutes, washing with sterile water for 5 times after the sodium hypochlorite is sterilized, placing in sterile absorbent paper, air-drying the moisture on the surfaces of the seeds, inoculating on an induction culture medium, and culturing callus at 28 ℃.

Agrobacterium infection rice callus: selecting about 100 Xiushui 134 calluses with the diameter of 2-3mm for subculture for 14 days in each batch of transformation, and collecting the calluses into a triangular flask; pouring the agrobacterium liquid which is resuspended by the infection liquid into a triangular flask containing callus, and placing the triangular flask in a shaker at 28 ℃ and 200 r/min for 20min of infection; after infection, pouring out bacterial liquid, placing the callus on sterile filter paper, air-drying for about 20min, placing on a common culture medium plate, and co-culturing, wherein the plate is paved with the sterile filter paper soaked by AAM (acetosyringone AS) liquid culture medium; after 3 days of infection, the agrobacteria were washed off (5 times with sterile water and then with 500mg/L cephalosporin antibiotic for 20 minutes) and placed on a 40mg/L hygromycin screening medium for screening culture.

Screening, differentiation and rooting of resistant calli: transferring the co-cultured callus to a screening medium for a first round of screening (2 weeks); after the first round of screening, transferring the newly grown callus to a screening medium (containing 40mg/L hygromycin) for second round of screening (2 weeks); after screening is finished, selecting a yellow-white callus with a good growth state for differentiation, adding 40mg/L hygromycin into a differentiation culture medium for herbicide resistance screening, and obtaining seedlings of about 1cm after 3-4 weeks; transferring the differentiated seedlings to a rooting culture medium (added with 20mg/L hygromycin) for rooting culture; and (4) hardening the seedlings after rooting, and then transferring the seedlings to a flowerpot filled with soil to be placed in a greenhouse for culturing.

3. Detection of

Synthesis of detection primers HPPD-F: CACGAGTTCGCCGAGTTCA (SEQ ID NO: 16) and HPPD-R: TTGACACCTTTCTGCGCCTA (SEQ ID NO: 17). The amplified fragment is 521bp, and the sgRNA site is approximately positioned in the middle of the amplified fragment. And taking a small number of leaves from the differentiated seedlings, and extracting genome DNA by a CTAB method. Genome DNA was subjected to PCR using the detection primers described above. The amplification products were detected by 1% agarose electrophoresis and subjected to sanger sequencing. Sequencing results show that T at 1015-position of the nucleotide sequence of OsHPPD is mutated into C, so that Y at 339-position of amino acid is mutated into H (see figure 10).

4. Identification of resistance

One month after greenhouse soil cultivation, gene-editing positive plants were sprayed with an application rate of 4g.a.i/mu (clethodim). The leaf state was observed seven days later.

5. Results of the experiment

After the herbicide is sprayed for 7 days, the leaves of the edited plant keep green, and the leaves of the wild plant are yellowed (see figure 11), namely the growth state of the edited plant is better than that of the wild plant.

6. Conclusion of the experiment

OsHPPD (Y339H) mutation corresponding to AtHPPD Y342H site can also enhance the tolerance of the plant to HPPD inhibiting herbicide.

Reference to the literature

1.Gaudelli NM,Komor AC,Rees HA,Packer MS,Badran AH,Bryson DI,Liu DR:Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage.Nature 2017,551(7681):464-471.

2.Komor AC,Kim YB,Packer MS,Zuris JA,Liu DR:Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage.Nature 2016,533(7603):420-424.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Claims

An isolated herbicide resistance polypeptide, wherein the herbicide resistance polypeptide is a mutated HPPD polypeptide,

and the mutated HPPD polypeptide differs from the parent HPPD polypeptide by one or more amino acid differences comprising a mutation at amino acid position 342 corresponding to SEQ ID No. 1:

tyrosine (Y) at position 342.
The herbicide resistance polypeptide of claim 1 wherein the tyrosine (Y) at position 342 is mutated to one or more amino acids selected from the group consisting of: histidine (H), asparagine (Asn), alanine (Ala), lysine (Lys), arginine (Arg), cysteine (C) phenylalanine (Phe).
An isolated polynucleotide encoding the herbicide resistance polypeptide of claim 1.
A vector comprising the polynucleotide of claim 3.
A host cell comprising the vector or genome of claim 4 and having the polynucleotide of claim 3 integrated therein.
A method for preparing a herbicide resistance polypeptide, said method comprising the steps of:

(a) culturing the host cell of claim 5 under conditions suitable for expression, thereby expressing the herbicide resistance polypeptide; and

(b) isolating said herbicide resistance polypeptide.
An enzyme preparation comprising the herbicide resistance polypeptide of claim 1.
A method of modifying a plant, said method comprising the steps of:

(a) providing a plant cell, wherein the plant cell is engineered such that the plant cell expresses the herbicide resistance polypeptide of claim 1; and

(b) regenerating the plant cell of step (a) into a plant.
Use of the herbicide resistance polypeptide or gene encoding the same of claim 1 for breeding a plant herbicide resistant line, or for preparing an agent or kit for breeding a plant herbicide resistant line.
A herbicide resistance susceptible site, said site comprising:

(I) a first resistance-sensitive site corresponding to (i) amino acid 342 of a wild-type HPPD polypeptide from Arabidopsis thaliana; (ii) amino acid 339 of wild type HPPD polypeptide derived from rice; (iii) amino acid 334 of a wild-type HPPD polypeptide derived from maize; (iv) amino acid 333 of a wild-type HPPD polypeptide derived from sorghum; (v) amino acid 329 of a wild-type HPPD polypeptide derived from wheat; or (vi) amino acid 341 of a soybean-derived wild-type HPPD polypeptide.
A method of identifying or selecting a transformed plant cell, plant tissue, plant or part thereof comprising: (i) providing a transformed plant cell, plant tissue, plant or part thereof, wherein the transformed plant cell, plant tissue, plant or part thereof comprises the herbicide resistance polypeptide of claim 1 or the polynucleotide of claim 2 or the vector of claim 3;

(ii) contacting the transformed plant cell, plant tissue, plant or part thereof with a herbicide;

(iii) determining whether the plant cell, plant tissue, plant or part thereof is affected by the herbicide; and

(iv) identifying or selecting a transformed plant cell, plant tissue, plant or part thereof.
A method of identifying herbicide tolerant plants comprising:

(i) identifying whether a plant sample has the herbicide resistance polypeptide of claim 1 or the polynucleotide of claim 2 or the vector of claim 3.
A method of controlling unwanted plants at a plant cultivation site, the method comprising:

(1) growing a plant comprising the herbicide resistance polypeptide of claim 1 or the polynucleotide of claim 2 or the vector of claim 3 at the cultivation site;

(2) applying an effective amount of herbicide to said plants at said cultivation site.
A method for producing a herbicide resistant plant comprising:

crossing a first plant with a second plant, wherein said first plant is a herbicide-resistant plant comprising an herbicide-resistance polypeptide of the invention according to claim 1 or a polynucleotide of claim 2 or a vector of claim 3.
A method of screening for herbicide tolerance or identifying a triketone herbicide comprising the steps of:

(a) applying a test compound to a plant expressing a mutant HPPD polypeptide according to claim 1 in the presence of the test compound in a test panel, and analyzing the growth or viability of the plant;

and analyzing the growth or viability of said plants in a control group without application of said test compound and under otherwise identical conditions;

(b) comparing the growth or viability of the plants of the test group and the control group, wherein if the growth or viability of the plants to which the test compound is applied is not affected or is well grown as compared to the control group, it is an indication that the test compound is herbicide tolerant or a triketone herbicide.