CN112626219A - Primer composition for microsatellite instability detection, kit and application - Google Patents
Primer composition for microsatellite instability detection, kit and application Download PDFInfo
- Publication number
- CN112626219A CN112626219A CN202110049693.3A CN202110049693A CN112626219A CN 112626219 A CN112626219 A CN 112626219A CN 202110049693 A CN202110049693 A CN 202110049693A CN 112626219 A CN112626219 A CN 112626219A
- Authority
- CN
- China
- Prior art keywords
- seq
- primer
- primer combination
- enzyme
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention belongs to the field of biotechnology, and particularly relates to a primer composition for microsatellite instability detection, a kit and application. The present application provides a primer composition for microsatellite instability detection comprising: a first primer combination, a second primer combination, a third primer combination, a fourth primer combination, a fifth primer combination, and a sixth primer combination; the primer combination is SEQ ID NO. 1-SEQ ID NO.12 in sequence. Compared with an immunohistochemistry method and an HRM method, the primer composition, the kit and the application for microsatellite instability detection disclosed by the application have the advantages of accurate and reliable result, high sensitivity and high specificity.
Description
Technical Field
The invention belongs to the technical field of biomedicine, and particularly relates to a primer composition for microsatellite instability detection, a kit and application.
Background
Colorectal cancer (CRC) is a common malignant tumor of the digestive tract, and the incidence and mortality of diseases in China are on an increasing trend. Microsatellite instability (MSI) is an important cause of colorectal cancer, has an important role in predicting prognosis and chemotherapy response of intestinal cancer patients, and has an important significance in diagnosis of Lynch syndrome. Microsatellite instability (MSI) is widely existed in various malignant tumors, and MSI has been reported to exist in colorectal cancer, lung cancer, liver cancer, esophageal cancer, lymphoma, urinary tumor, reproductive system tumor, child embryonic tumor and other tumors.
In recent years, the clinical and fundamental studies on microsatellite instability (MSI) have been well developed, and the relationship between MSI and CRC has been deeply understood. In 2017, the national cancer complex treatment alliance (NCCN) in the clinical practice guidelines for rectal cancer (2017.V2) pointed out: 1) all history of colorectal cancer should be routinely checked for MMR or MSI to identify the strange syndrome. 2) Patients with stage II MSI-H rectal cancer had a better prognosis and did not benefit from adjuvant treatment with 5-FU. In addition, the new drug Keytruda was approved by the FDA in 2017 for the treatment of all patients with solid tumors with high microsatellite instability (MSI-H) or mismatch repair deficiency (dMMR). Therefore, there is an increasing clinical need for MSI detection.
At present, methods for detecting microsatellite instability include MMR protein immunohistochemistry, fragment analysis, high performance liquid chromatography, HRM methods and the like. The detection method in the patent is used for detecting the instability of the microsatellite by combining a fragment analysis method of capillary electrophoresis based on fluorescence PCR, which is a currently recognized gold standard method, and the clinical specimen result prepared by the method has higher consistency compared with the immunohistochemical method and the HRM method.
Disclosure of Invention
The application provides a primer group, a kit and a detection method aiming at a microsatellite instability state. In order to realize the purpose of the invention, the invention adopts the following technical scheme:
in a first aspect, the present application provides a primer composition for microsatellite instability detection, comprising:
a first primer combination, a second primer combination, a third primer combination, a fourth primer combination, a fifth primer combination, and a sixth primer combination;
the first primer combination comprises SEQ ID NO.1 and SEQ ID NO. 2;
the second primer combination comprises SEQ ID NO.3 and SEQ ID NO. 4;
the third primer combination comprises SEQ ID NO.5 and SEQ ID NO. 6;
the fourth primer combination comprises SEQ ID NO.7 and SEQ ID NO. 8;
the fifth primer combination comprises SEQ ID NO.9 and SEQ ID NO. 10;
the sixth primer combination includes SEQ ID NO.11 and SEQ ID NO. 12.
In particular, the method comprises the following steps of,
the base sequence GAGTTGGCCCTAGACTTAGA of SEQ ID NO. 1;
the base sequence TCCAAAGAGACAGCAGTTGG of SEQ ID NO. 2.
The base sequence TGCAGCAGTCAGAGCCCTTA of SEQ ID NO. 3;
the base sequence GCTTCTTCAGTATATGTCAATGAAAACA of SEQ ID NO. 4. The base sequence TGAATAAGCCACTGCCTGGT of SEQ ID NO. 5;
the base sequence CCGCATTCACACTTTCTGGT of SEQ ID NO. 6.
The base sequence TGAATAAGCCACTGCCTGGT of SEQ ID NO. 7;
the base sequence CCGCATTCACACTTTCTGGT of SEQ ID NO. 8.
The base sequence GATGTTTCTCCTGCCACCTG of SEQ ID NO. 9;
the base sequence TCAACAGCAGAGACCTTGTCA of SEQ ID NO. 10.
The base sequence CCAGCGTGGGAGACAGAGCAAGACT of SEQ ID NO. 11; the base sequence TGCTAACATTCTAAGGCTAT of SEQ ID NO. 12.
In other embodiments, the 5' end of said SEQ ID NO.1, said SEQ ID NO.3, said SEQ ID NO.5, said SEQ ID NO.7, said SEQ ID NO.9 and said SEQ ID NO.11 is modified with a fluorophore.
In other embodiments, the fluorophore is selected from one of HEX, FAM, or TMR.
In other embodiments, the 5' end of SEQ ID NO.1 is modified with HEX. The 5' end of the SEQ ID NO.3 is modified with FAM. The 5' end of the SEQ ID NO.5 is modified with FAM. The 5' end of the SEQ ID NO.7 is modified with TMR. HEX is modified at the 5' end of the SEQ ID NO. 9. The 5' end of the SEQ ID NO.11 is modified with TMR.
In a second aspect, the present application provides a kit for microsatellite instability detection, comprising said primer composition, and a PCR reaction system.
In other embodiments, the PCR reaction system comprises: buffer, dNTP, PCR amplification enzyme and enzyme-free water.
In other embodiments, the kit comprises:
2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.1, 1-1.25 μ L of SEQ ID NO.2, 0.2-0.25 μ L of PCR amplification enzyme, and enzyme-free water to 20-25 μ L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.3, 1-1.25. mu.L of SEQ ID NO.4, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.5, 1-1.25. mu.L of SEQ ID NO.6, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.7, 1-1.25. mu.L of SEQ ID NO.8, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.9, 1-1.25. mu.L of SEQ ID NO.10, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.11, 1-1.25. mu.L of SEQ ID NO.12, 0.2-0.25. mu.L of PCR amplification enzyme, and enzyme-free water to 20-25. mu.L.
Specifically, in the using process of the kit, a sample is added into a PCR reaction system for PCR reaction, the obtained product is subjected to capillary electrophoresis, and the instability state of the microsatellite is judged according to the fragment analysis result.
Specifically, the sample is a DNA template, and the DNA template is derived from a tumor tissue paraffin section or a normal tissue paraffin section or peripheral blood.
Specifically, adding a DNA template into a PCR reaction system comprises the following steps:
0.5-5 μ L of DNA template, 2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.1, 1-1.25 μ L of SEQ ID NO.2, 0.2-0.25 μ L of Taq enzyme, and enzyme-free water to 20-25 μ L;
or, 0.5-5 μ L of DNA template, 2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.3, 1-1.25 μ L of SEQ ID NO.4, 0.2-0.25 μ L of Taq enzyme, enzyme-free water to 20-25 μ L;
or, 0.5-5 μ L of DNA template, 2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.5, 1-1.25 μ L of SEQ ID NO.6, 0.2-0.25 μ L of Taq enzyme, enzyme-free water to 20-25 μ L;
or, 0.5-5 μ L of DNA template, 2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.7, 1-1.25 μ L of SEQ ID NO.8, 0.2-0.25 μ L of Taq enzyme, enzyme-free water to 20-25 μ L;
or, 0.5-5 μ L of DNA template, 2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.9, 1-1.25 μ L of SEQ ID NO.10, 0.2-0.25 μ L of Taq enzyme, enzyme-free water to 20-25 μ L;
or, 0.5-5. mu.L of DNA template, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.11, 1-1.25. mu.L of SEQ ID NO.12, 0.2-0.25. mu.L of Taq enzyme, enzyme-free water to 20-25. mu.L.
In other embodiments, the PCR amplification procedure of the PCR reaction system is:
first stage, pre-denaturation at 95 ℃ for 5 min;
second stage, denaturation at 94 ℃ for 30s, annealing at 61 ℃ for 1min and extension at 70 ℃ for 1min, 30 cycles;
and a third stage, extending at 60 ℃ for 30min, and keeping at 4 ℃.
In a third aspect, the application provides an application of the primer composition or the kit in detecting microsatellite instable DNA of tumor tissues or normal tissues or peripheral blood.
Specifically, the application comprises the steps of carrying out fluorescence PCR on DNA of tumor tissues or normal tissues or peripheral blood, carrying out capillary electrophoresis on products, and judging the instability state of the microsatellite according to the result of a fragment analysis method.
Specifically, the application includes:
mixing a normal tissue or peripheral blood DNA sample to be detected, a first primer combination, Buffer, dNTP, PCR (polymerase chain reaction) amplification enzyme and enzyme-free water for PCR to obtain an amplification product; then, carrying out fragment analysis on the amplified product to obtain a peak image of the normal tissue to be detected;
mixing a tumor tissue DNA sample to be detected, a first primer combination, Buffer, dNTP, Taq enzyme and enzyme-free water for PCR to obtain an amplification product; then, carrying out fragment analysis on the amplified product to obtain a peak image of the tumor tissue to be detected;
obtaining peak maps of the normal tissue to be detected and the tumor tissue to be detected corresponding to the second primer combination, the third primer combination, the fourth primer combination, the fifth primer combination and the sixth primer combination according to the method;
comparing the peak images of the tumor tissue and the normal control, wherein if the peak image of the tumor tissue shows two or more quintets and the peak image of the normal tissue only shows one quintet, the site detected by the primer combination is unstable; otherwise, the site detected by the primer combination is stable. Comprehensively judging the instability state of the sites detected by the six groups of primer combinations, and if two or more than two of the sites are unstable, determining that the sample is MSI-H; if a locus is unstable, the specimen in this case is MSI-L; if all sites are stable, the specimen is MSS.
Through clinical specimen verification, compared with an immunohistochemical method and an HRM method, the primer composition and the kit for detecting the instability of the microsatellite, provided by the application, can stably, highly sensitively, highly specifically and accurately detect the instability of the microsatellite; the primers SEQ ID NO. 1-SEQ ID NO.12 provided by the application have no interference peak, and the result interpretation is intuitive and accurate and is easy to interpret.
Drawings
In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.
FIG. 1 is a graph of a peak of tumor tissue versus a peak of normal tissue from a patient with MSI-H colorectal cancer provided in an example of the present application, wherein A is a first detection site amplified by a first primer combination, B is a second detection site amplified by a second primer combination, C is a third detection site amplified by a third primer combination, D is a fourth detection site amplified by a fourth primer combination, E is a fifth detection site amplified by a fifth primer combination, and F is a sixth detection site amplified by a sixth primer combination;
FIG. 2 is a peak diagram of tumor tissue and a peak diagram of normal tissue of an MSS colorectal cancer patient provided in the present application, wherein A is a first detection site amplified by a first primer combination, B is a second detection site amplified by a second primer combination, C is a third detection site amplified by a third primer combination, D is a fourth detection site amplified by a fourth primer combination, E is a fifth detection site amplified by a fifth primer combination, and F is a sixth detection site amplified by a sixth primer combination;
FIG. 3 is a graph of the result of the immunohistochemistry method provided in the examples of the present application for detection of dMMR in MSI-H tumor tissue; wherein, A is MLH1 protein, B is MLH6 protein, C is MSH2 protein, and D is PMS2 protein;
FIG. 4 is a pMMR result chart of MSS tumor tissue detection by immunohistochemistry provided in the examples of the present application; wherein, A is MLH1 protein, B is MLH6 protein, C is MSH2 protein, and D is PMS2 protein;
FIG. 5 is a graph of the HRM results of tumor tissues versus normal tissues for MSI-H colorectal cancer patients provided in examples herein; wherein, A is a peak image of a first detection site, B is a peak image of a second detection site, C is a peak image of a third detection site, D is a peak image of a fourth detection site, E is a peak image of a fifth detection site, and F is a peak image of a sixth detection site;
FIG. 6 shows HRM results of tumor tissue and normal tissue of MSS colorectal cancer patients provided in the examples of the present application; wherein, A is a peak image of a first detection site, B is a peak image of a second detection site, C is a peak image of a third detection site, D is a peak image of a fourth detection site, E is a peak image of a fifth detection site, and F is a peak image of a sixth detection site;
FIG. 7 is a graph showing the peaks of the primer composition G, the primer composition H and the primer composition I for detecting tumor tissues and normal tissues of colorectal cancer patients, which are provided in comparative examples of the present application;
FIG. 8 is a peak diagram of the detection of tumor tissue and normal tissue of a colorectal cancer patient by primer composition J, primer composition K and primer composition L provided in comparative examples of the present application.
Detailed Description
The technical solutions in the embodiments of the present application will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present application, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present application.
Wherein, the raw materials used in the following examples are all sold in the market or made by the user;
colorectal cancer patients of the following examples were of tumor tissue origin: zhongshan university attaches to paraffin sections prepared from tumor specimens removed by surgery in the sixth hospital.
Normal tissue source in colorectal cancer patients: the Zhongshan university affiliated with the sixth hospital surgically removed paraffin sections prepared from paracancerous distal normal tissue.
Example 1
The embodiment of the application provides a detection test adopting SEQ ID NO. 1-12, which comprises the following steps:
1. combining SEQ ID NO.1 and SEQ ID NO.2 with a first primer, respectively; a second primer combination of SEQ ID NO.3 and SEQ ID NO. 4; a third primer combination of SEQ ID NO.5 and SEQ ID NO. 6; a fourth primer combination of SEQ ID NO.7 and SEQ ID NO. 8; a fifth primer combination of SEQ ID NO.9 and SEQ ID NO. 10; the sixth primer is combined with six pairs of primers of SEQ ID NO.11 and SEQ ID NO.12 to prepare the following six reaction systems:
TABLE 1
| Name (R) | Dosage (mu L) |
| 10×Buffer | 2.5 |
| dNTP | 2.5 |
| Primers SEQ ID NO.1 or 3 or 5 or 7 or 9 or 11 | 1.0 |
| Primers SEQ ID NO.2 or 4 or 6 or 8 or 10 or 12 | 1.0 |
| Taq enzyme | 0.25 |
| Enzyme-free water | 11.75 |
2. Sample sources and genomic DNA extraction employed in the embodiments of the present application: all tumor samples and normal samples of colorectal cancer patients are from the pathology department of the sixth hospital affiliated to Zhongshan university, tissues are collected, and genome DNA is extracted by using a mayenite sample extraction kit to obtain corresponding DNA templates. The DNA template concentrations of the tumor and normal controls were adjusted to 50-100ng/ul, respectively.
3. 1 μ l of tumor tissue DNA template and 1 μ l of normal tissue DNA template were added to the six reaction systems of step 1, respectively. The amplification was performed using a conventional PCR instrument, and the procedure was as follows:
first stage, pre-denaturation at 95 ℃ for 5 min;
second stage, denaturation at 94 ℃ for 30s, annealing at 61 ℃ for 1min and extension at 70 ℃ for 1min, 30 cycles;
and a third stage, extending at 60 ℃ for 30min, and keeping at 4 ℃.
4. mu.L of each PCR product of the tumor tissue DNA template, the first primer combination of the normal tissue DNA template, the second primer combination and the third primer combination in the step 3 is added into a 96-well plate containing 8.8. mu.L of Formamide (Hi-Di TM Formamide) and 0.2. mu.L of GeneScan500LIZ size standard. And then taking 1 mu L of PCR products of the tumor tissue DNA template, the fourth primer combination of the normal tissue DNA template, the fifth primer combination and the sixth primer combination respectively, adding the PCR products into a 96-well plate hole filled with 8.8 mu L of Formamide (Hi-Di (TM) Formamide) and 0.2 mu L of GeneScan500LIZ size standard, uniformly mixing, denaturing at 95 ℃ for 4min, immediately putting the mixture on ice for 4min, and performing fragment analysis and detection by using an ABI 3500Dx instrument to respectively obtain product peak maps of the tumor tissue and the normal tissue which are subjected to PCR by adopting the first primer combination, the second primer combination, the third primer combination, the fourth primer combination, the fifth primer combination and the sixth primer combination.
5. Comparing the peak images of the tumor tissue and the normal tissue, wherein if the peak image of the tumor tissue shows two or more quintets and the peak image of the normal tissue only shows one quintet, the site detected by the primer combination is unstable; otherwise, the site detected by the primer combination is stable. Comprehensively judging the instability state of the sites detected by the six groups of primer combinations, and if two or more than two of the sites are unstable, determining that the sample is MSI-H; if a locus is unstable, the specimen in this case is MSI-L; if all sites are stable, the specimen is MSS. The results of the examples of the present application are shown in fig. 1 and 2.
FIG. 1 is a graph of a peak of tumor tissue versus a peak of normal tissue from a patient with MSI-H colorectal cancer provided in an example of the present application, wherein A is a first detection site amplified by a first primer combination, B is a second detection site amplified by a second primer combination, C is a third detection site amplified by a third primer combination, D is a fourth detection site amplified by a fourth primer combination, E is a fifth detection site amplified by a fifth primer combination, and F is a sixth detection site amplified by a sixth primer combination; as can be seen from FIG. 1, the six primer combination products of MSI-H tumor tissues all showed two or more five-peaks, compared to normal controls, and were microsatellite unstable.
FIG. 2 is a peak diagram of tumor tissue and a peak diagram of normal tissue of an MSS colorectal cancer patient provided in the present application, wherein A is a first detection site amplified by a first primer combination, B is a second detection site amplified by a second primer combination, C is a third detection site amplified by a third primer combination, D is a fourth detection site amplified by a fourth primer combination, E is a fifth detection site amplified by a fifth primer combination, and F is a sixth detection site amplified by a sixth primer combination; from fig. 2, it can be seen that all six primer combination products of MSS tumor tissue showed only one quintet, which is a microsatellite stability, compared to normal control.
Example 2
The embodiment of the application provides a detection test by adopting a primer composition of SEQ ID NO. 1-12 and an existing immunohistochemical method, which comprises the following steps:
1. 302 pairs of tissue samples (i.e., tumor tissue and corresponding normal tissue from colorectal cancer patients, nos. 1-302) were obtained from the clinical department of the sixth hospital affiliated to Zhongshan university. Immunohistochemistry was performed using the same tumor tissue wax block as in the examples of the present application. Immunohistochemistry is performed by reference to conventional procedures in the art and will not be described in detail herein.
2. Genomic DNA was extracted separately according to the method described in example 1 of the present application. The procedure is as in example 1, with a first primer combination of SEQ ID NO.1 and SEQ ID NO.2, respectively; a second primer combination of SEQ ID NO.3 and SEQ ID NO. 4; a third primer combination of SEQ ID NO.5 and SEQ ID NO. 6; a fourth primer combination of SEQ ID NO.7 and SEQ ID NO. 8; a fifth primer combination of SEQ ID NO.9 and SEQ ID NO. 10; the system which is formed by combining six pairs of primers of SEQ ID NO.11 and SEQ ID NO.12 with the sixth primer detects 302 tissue samples one by one.
3. The 302 tissue samples are detected by two methods, an immunohistochemistry method is used for detecting the expression conditions of MLH1, MLH6, MSH2 and PMS2 proteins, dMMR is MSI-H of a fragment method, and any one of MLH1, MLH6, MSH2 or PMS2 proteins of tumor tissues is not expressed by the dMMR. pMMR is MSS of fragment method, and pMMR is MLH1, MLH6, MSH2 and PMS2 protein expression of tumor tissue. The results of the immunohistochemistry method provided in the embodiment of the present application are shown in fig. 3-4, wherein fig. 3 is a graph of the result of detection of the MSI-H tumor specimen by the immunohistochemistry method in the embodiment of the present application as dMMR, in fig. 3 and 4, a is MLH1 protein, B is MLH6 protein, C is MSH2 protein, and D is PMS2 protein.
As can be seen from FIG. 3, MLH1 protein was not expressed, MLH6 protein was expressed, MSH2 protein was expressed, PMS2 protein was not expressed; FIG. 4 is a graph showing the result of pMMR detection of MSS tumor specimens by immunohistochemistry in the present example, wherein 4 proteins are expressed. The coincidence rate of the two methods is counted, the coincidence rate of the kit provided by the application and the immunohistochemical result is 96.03%, and the result comparison is shown in table 2.
TABLE 2 comparison of the primer compositions of the present application with the results of immunohistochemical assays
From the results of table 2, it can be seen that: 302 for the specimen, the sensitivity of the method of the present application was 93.33%, the specificity was 97.8%, and the rate consistent with the immunohistochemistry results was 96.03%. The inconsistency rate is close to that reported in the literature, and the primer composition of SEQ ID NO. 1-12 can meet clinical requirements.
Example 3
The embodiment of the application provides a detection test by adopting a primer composition of SEQ ID NO. 1-12 and the existing HRM method, which comprises the following steps:
1. 104 pairs of tissue samples to be tested (namely tumor tissues of colorectal cancer patients and corresponding normal tissues thereof, numbers 1-104) are taken, and the used paraffin samples of the tumor tissues and the normal tissues of the colorectal cancer patients are from the pathology department of the sixth hospital affiliated to Zhongshan university. The HRM method (high resolution melting curve analysis) refers to the conventional operation steps in the field and is not described herein in detail.
FIG. 5 shows the HRM results of tumor samples and normal tissues of MSI-H colorectal cancer patients provided in the examples of the present application; wherein A is a first detection site, B is a second detection site, C is a third detection site, D is a fourth detection site, E is a fifth detection site, and F is a sixth detection site.
FIG. 6 shows HRM results of tumor samples and normal tissue of MSS colorectal cancer patients provided in the examples of the present application; wherein A is a first detection site, B is a second detection site, C is a third detection site, D is a fourth detection site, E is a fifth detection site, and F is a sixth detection site.
2. The tissue samples to be detected are detected by two methods, the embodiment of the application provides that the consistency rate of the results of the HRM method and the primer composition adopting SEQ ID NO. 1-12 is 100%, and the result comparison is shown in Table 3.
TABLE 3 comparison of the primer compositions of the present application with the results of HRM assay
Comparative example 1
The application provides a test for detecting microsatellite instability by adopting different primer combinations, which comprises the following steps:
tumor tissue and normal tissue of the colorectal cancer patient of example 1 were taken according to the method of example 1. The microsatellite instability of tumor tissues and normal tissues was detected using primer composition G, primer composition H, primer composition I, primer composition J, primer composition K and primer composition L of Table 4, respectively.
The kit comprises a first detection site amplified by a first primer combination, a second detection site amplified by a second primer combination, a third detection site amplified by a third primer combination, a fourth detection site amplified by a fourth primer combination, a fifth detection site amplified by a fifth primer combination and a sixth detection site amplified by a sixth primer combination.
Taking a primer composition G at another position of the first detection site, wherein the primer composition G comprises an upstream primer SEQ ID NO.13 and a downstream primer SEQ ID NO. 14.
Taking a primer composition H at another position of the second detection site, wherein the primer composition H comprises an upstream primer SEQ ID NO.15 and a downstream primer SEQ ID NO. 16.
Taking a primer composition I at another position of the third detection site, wherein the primer composition I comprises an upstream primer SEQ ID NO.17 and a downstream primer SEQ ID NO. 18.
Taking a primer composition J at another position of the fourth detection site, wherein the primer composition J comprises an upstream primer SEQ ID NO.19 and a downstream primer SEQ ID NO. 20.
Taking a primer composition K at another position of the fifth detection site, wherein the primer composition K comprises an upstream primer SEQ ID NO.21 and a downstream primer SEQ ID NO. 22.
Taking a primer composition L at another position of the sixth detection site, wherein the primer composition L comprises an upstream primer SEQ ID NO.23 and a downstream primer SEQ ID NO. 24.
FIGS. 7 and 8 show the results of experiments conducted in the same manner as in example 1 using the above primer compositions. Experiments prove that primers at different positions of the same detection site, namely the primer composition G, the primer composition H, the primer composition I, the primer composition J, the primer composition K and the primer composition L are all non-specific primers, so that the result interpretation is interfered.
Table 4 comparison of detection peak patterns using the following 6 pairs of primers
Table 4 primer test results show that non-specific primers interfere with the interpretation of the results. Therefore, only the primers SEQ ID NO. 1-SEQ ID NO.12 provided by the application have no interference peak, and the result is intuitive and accurate to interpret and is easy to interpret.
The application discloses a primer group, a kit and a detection method for detecting the instability state of a microsatellite, which respectively take DNA of tumor tissues and normal tissues or peripheral blood as templates, adopt a primer pair with base sequences shown as SEQ ID NO. 1-NO. 12 to carry out PCR reaction, and carry out fragment analysis on a product to detect the instability state of the microsatellite. Clinical specimen verification shows that compared with an immunohistochemical method and an HRM method, the SEQ ID NO. 1-SEQ ID NO.12 provided by the application has accurate and reliable results, high sensitivity and high specificity.
The foregoing is only a preferred embodiment of the present application and it should be noted that those skilled in the art can make several improvements and modifications without departing from the principle of the present application, and these improvements and modifications should also be considered as the protection scope of the present application.
Sequence listing
<110> secondary sixth Hospital of Zhongshan university
<120> primer composition for microsatellite instability detection, kit and application
<130> MP2035738
<160> 24
<170> SIPOSequenceListing 1.0
<210> 1
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gagttggccc tagacttaga 20
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
tccaaagaga cagcagttgg 20
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgcagcagtc agagccctta 20
<210> 4
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcttcttcag tatatgtcaa tgaaaaca 28
<210> 5
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tgaataagcc actgcctggt 20
<210> 6
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccgcattcac actttctggt 20
<210> 7
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tgaataagcc actgcctggt 20
<210> 8
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ccgcattcac actttctggt 20
<210> 9
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
gatgtttctc ctgccacctg 20
<210> 10
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
tcaacagcag agaccttgtc a 21
<210> 11
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccagcgtggg agacagagca agact 25
<210> 12
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tgctaacatt ctaaggctat 20
<210> 13
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
cctccaagaa tgtaagtggg a 21
<210> 14
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
ggctctaaaa tgctctgttc tca 23
<210> 15
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
tattgcagca gtcagagccc 20
<210> 16
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gcactctggc ctagggaaca 20
<210> 17
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
tggcacagtt ctatttttat attta 25
<210> 18
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
cactttctgg tcactcgcgt ttaca 25
<210> 19
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
tcctgactcc aaaaactctt ctctt 25
<210> 20
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gcattccaac ctgggtgaca gagtg 25
<210> 21
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
caacgtctgt gagatccagg aaacc 25
<210> 22
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
tactagcaat gaccaataag caagt 25
<210> 23
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
gatcgagacc atcctggcta 20
<210> 24
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
ttcttaaggg tggatcaaat ttc 23
Claims (9)
1. A primer composition for microsatellite instability detection, wherein the primer composition comprises a first primer combination, a second primer combination, a third primer combination, a fourth primer combination, a fifth primer combination and a sixth primer combination;
the first primer combination comprises SEQ ID NO.1 and SEQ ID NO. 2;
the second primer combination comprises SEQ ID NO.3 and SEQ ID NO. 4;
the third primer combination comprises SEQ ID NO.5 and SEQ ID NO. 6;
the fourth primer combination comprises SEQ ID NO.7 and SEQ ID NO. 8;
the fifth primer combination comprises SEQ ID NO.9 and SEQ ID NO. 10;
the sixth primer combination includes SEQ ID NO.11 and SEQ ID NO. 12.
2. The primer composition of claim 1, wherein 5' ends of said SEQ ID No.1, said SEQ ID No.3, said SEQ ID No.5, said SEQ ID No.7, said SEQ ID No.9 and said SEQ ID No.11 are modified with a fluorophore.
3. The primer composition of claim 2, wherein the fluorescent group is selected from one of HEX, FAM, or TMR.
4. The primer composition according to claim 1,
HEX is modified at the 5' end of the SEQ ID NO. 1;
FAM is modified at the 5' end of the SEQ ID NO. 3;
FAM is modified at the 5' end of the SEQ ID NO. 5;
the 5' end of the SEQ ID NO.7 is modified with TMR;
HEX is modified at the 5' end of the SEQ ID NO. 9;
the 5' end of the SEQ ID NO.11 is modified with TMR.
5. A kit for microsatellite instability detection comprising the primer composition of any one of claims 1 to 4 and a PCR reaction system.
6. The kit of claim 5, wherein the PCR reaction system comprises: buffer, dNTP, PCR amplification enzyme and enzyme-free water.
7. The kit of claim 6, wherein the kit comprises:
2-2.5 μ L of 10 XBuffer, 2-2.5 μ L of dNTP, 1-1.25 μ L of SEQ ID NO.1, 1-1.25 μ L of SEQ ID NO.2, 0.2-0.25 μ L of PCR amplification enzyme, and enzyme-free water to 20-25 μ L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.3, 1-1.25. mu.L of SEQ ID NO.4, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.5, 1-1.25. mu.L of SEQ ID NO.6, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.7, 1-1.25. mu.L of SEQ ID NO.8, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.9, 1-1.25. mu.L of SEQ ID NO.10, 0.2-0.25. mu.L of PCR amplification enzyme, enzyme-free water to 20-25. mu.L;
or, 2-2.5. mu.L of 10 XBuffer, 2-2.5. mu.L of dNTP, 1-1.25. mu.L of SEQ ID NO.11, 1-1.25. mu.L of SEQ ID NO.12, 0.2-0.25. mu.L of PCR amplification enzyme, and enzyme-free water to 20-25. mu.L.
8. The kit of claim 5, wherein the PCR amplification program of the PCR reaction system is:
first stage, pre-denaturation at 95 ℃ for 5 min;
second stage, denaturation at 94 ℃ for 30s, annealing at 61 ℃ for 1min and extension at 70 ℃ for 1min, 30 cycles;
and a third stage, extending at 60 ℃ for 30min, and keeping at 4 ℃.
9. The primer composition of any one of claims 1 to 3 or the kit of any one of claims 4 to 8 provides for the use of the primer composition or the kit to detect microsatellite instability states in tumor tissue, normal tissue or peripheral blood.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110049693.3A CN112626219A (en) | 2021-01-14 | 2021-01-14 | Primer composition for microsatellite instability detection, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110049693.3A CN112626219A (en) | 2021-01-14 | 2021-01-14 | Primer composition for microsatellite instability detection, kit and application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112626219A true CN112626219A (en) | 2021-04-09 |
Family
ID=75294222
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110049693.3A Withdrawn CN112626219A (en) | 2021-01-14 | 2021-01-14 | Primer composition for microsatellite instability detection, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112626219A (en) |
-
2021
- 2021-01-14 CN CN202110049693.3A patent/CN112626219A/en not_active Withdrawn
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021128519A1 (en) | Combination of dna methylation biomarkers, and detection method therefor and kit thereof | |
| CN113755603B (en) | Marker, primer probe and kit for early screening and diagnosis of endometrial cancer | |
| CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
| WO2016019900A1 (en) | Multielement gene composition and use therefor | |
| WO2020020072A1 (en) | Methylation modification-based tumor marker stamp-ep2 | |
| WO2023071890A1 (en) | Methylation biomarker related to lymph node metastasis of gastric cancer, and combination and detection kit thereof | |
| WO2020135859A1 (en) | Tumor marker stamp-ep3 based on methylation modification | |
| CN109593847B (en) | Primer pair, kit and method for detecting stability of NR24 locus of microsatellite | |
| WO2020135862A1 (en) | Tumor marker stamp-ep5 based on methylated modification | |
| CN111235238A (en) | DNA methylation detection method and related application | |
| JP2024020392A (en) | Composition for diagnosing liver cancer using CPG methylation changes in specific genes and its use | |
| CN110484621A (en) | A kind of method of liver cancer early warning | |
| Huang et al. | The emergent landscape of detecting EGFR mutations using circulating tumor DNA in lung cancer | |
| CN109996891B (en) | Methods for performing early detection of colon cancer and/or colon cancer precursor cells and for monitoring colon cancer recurrence | |
| WO2023226939A1 (en) | Methylation biomarker for detecting colorectal cancer lymph node metastasis and use thereof | |
| CN113249471A (en) | Biomarker combination for detecting liver cancer | |
| KR102112951B1 (en) | Ngs method for the diagnosis of cancer | |
| US7217515B2 (en) | HURP gene as a molecular marker for bladder cancer | |
| CN113430272B (en) | Reagent and kit for diagnosis or auxiliary diagnosis of esophageal cancer or precancerous lesion and application of reagent and kit | |
| CN113005199B (en) | Primer composition for detecting microsatellite instability, kit and application | |
| CN112626219A (en) | Primer composition for microsatellite instability detection, kit and application | |
| CN113005199A (en) | Primer composition for microsatellite instability detection, kit and application | |
| WO2005021743A1 (en) | Primers for nucleic acid amplification and method of examining colon cancer using the same | |
| CN105969874B (en) | Primer for detecting KRAS gene mutation in microcomponent combines and its application | |
| JP4207187B2 (en) | HURP gene as a molecular marker for bladder cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| WW01 | Invention patent application withdrawn after publication |
Application publication date: 20210409 |
|
| WW01 | Invention patent application withdrawn after publication |