CN112626127B

CN112626127B - Recombinant lentiviral vector and preparation method and application thereof

Info

Publication number: CN112626127B
Application number: CN202011584923.8A
Authority: CN
Inventors: 蒋明贵; 刘军鹏; 方娟; 刘彩云; 屈飞
Original assignee: Hunan Fenghui Biotechnology Co ltd
Current assignee: Hunan Fenghui Biotechnology Co ltd
Priority date: 2020-12-28
Filing date: 2020-12-28
Publication date: 2023-01-20
Anticipated expiration: 2040-12-28
Also published as: CN112626127A

Abstract

The invention discloses a recombinant lentiviral vector and a preparation method and application thereof. The recombinant lentiviral vector comprises a lentiviral vector inserted with green fluorescent gene EGFP and calmodulin-dependent protein kinase II genes. The recombinant lentiviral vector provided by the invention has small toxicity to cells, and the preparation method is simple and is easy for industrial production.

Description

Recombinant lentiviral vector as well as preparation method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a recombinant lentiviral vector and a preparation method and application thereof.

Background

Calcium ions play an important role in the physiological activities of cells, and the change of the concentration of free calcium ions is closely related to the functions of the cells, the transmission of signals and the damage and apoptosis of the cells. Calcium ion is a signal for the survival and death of single cells and regulates its various functions.

Calcium ions play a second role in signaling, and are involved and regulated in important activities such as cell contraction, movement, secretion and division. The messenger effect of calcium ions is achieved by increasing or decreasing their concentration. The concentration of intracellular free calcium ions was 10 ^-8 -10 ^-7 M, 10 lower than the extracellular calcium ion concentration ⁴ -10 ⁵ And (4) doubling. When the cells are stimulated by specific signals, calcium channels of calcium reservoirs (endoplasmic reticulum and sarcoplasmic reticulum) in the cells or calcium channels on plasma membranes are opened, so that the concentration of calcium ions in the cells is quickly increased to generate calcium signals, and further the activity and protein function of certain enzymes in the cells are changed,resulting in cell efficiencies.

Currently, the most common method for detecting calcium ion concentration is based on fluorescent probe detection, and therefore, it is necessary to ensure that the cells to be detected are non-fluorescent. However, in scientific research, when the function of the calcium regulation-related protein is explored, the calcium regulation-related protein needs to be subjected to gene manipulation, such as overexpression or interference. At this time, in order to visually observe the over-expression or interference effect, a fluorescence label is often added by a scientific research worker, and the subsequent calcium ion concentration detection is influenced.

Disclosure of Invention

The present invention is directed to solving at least one of the problems of the prior art. Therefore, the invention provides a recombinant lentiviral vector which can detect the change of the calcium ion concentration.

The invention also provides a recombinant lentivirus.

The invention also provides a recombinant cell containing the recombinant lentiviral vector.

The invention also provides a preparation method of the recombinant lentiviral vector.

The invention also provides an application of the recombinant lentiviral vector.

The recombinant lentiviral vector comprises a lentiviral vector inserted with a green fluorescent gene EGFP and a calmodulin-dependent protein kinase II (CAMKII) gene, and the lentiviral vector adopts a Tet-On inducible expression lentiviral system.

According to some embodiments of the invention, the lentiviral vector comprises pLVX-Tentone-puro.

According to some embodiments of the invention, the nucleotide sequence of the gene encoding calmodulin-dependent protein kinase II (CAMKII) is set forth in SEQ ID No. 18.

According to some embodiments of the invention, the nucleotide sequence of the coding gene of the green fluorescent gene EGFP is shown in SEQ ID No. 19.

The recombinant lentivirus according to the second aspect of the embodiment of the present invention is prepared by co-transfecting mammalian cells with the recombinant lentivirus vector and the packaging plasmid as described above.

According to some embodiments of the invention, the mammalian cells comprise any one of 293 cells, 293T cells or 293F cells or a combination of at least two thereof.

According to some embodiments of the invention, the mammalian cell is a 293T cell.

According to some embodiments of the invention, the packaging plasmid comprises a psPAX2, pmd2.G vector.

According to a third aspect of the present invention, there is provided a recombinant cell containing the recombinant lentiviral vector described above, the recombinant cell comprising the recombinant lentiviral vector described above and/or a host cell for the recombinant lentiviral vector described above.

According to some embodiments of the invention, the host cell is a human glioblastoma U87-MG cell.

A method for producing a recombinant lentiviral vector according to a fourth embodiment of the present invention, the method comprising the steps of: and respectively cloning the EGFP gene and the CAMKII gene into a lentiviral vector to obtain the recombinant lentiviral vector.

According to some embodiments of the invention, the recombinant vector is constructed by the steps of:

s1, taking an upstream primer and a downstream primer of an EGFP gene and a CAMKII gene and a template for coding the EGFP gene and the CAMKII gene, and then amplifying the EGFP gene and the CAMKII gene by adopting PCR;

s2, taking a pLVX-Tetone-puro lentiviral vector, and cloning the EGFP gene and the CAMKII gene amplified in the step S1 into the pLVX-Tetone-puro lentiviral vector to obtain the recombinant lentiviral vector.

According to some embodiments of the invention, the nucleotide sequences of the upstream primer and the downstream primer of the EGFP gene in step S1 are shown as SEQ ID No.11 and SEQ ID No.12, respectively.

According to some embodiments of the invention, the nucleotide sequences of the upstream primer and the downstream primer of the CAMKII gene in step S1 are shown as SEQ ID No.7 and SEQ ID No.8, respectively.

According to some embodiments of the invention, in step S1, the gene template encoding the EGFP gene is a plasmid containing a human EGFP gene sequence.

According to some embodiments of the invention, in step S1, the gene template encoding the CAMKII gene is a plasmid containing a human CAMKII gene sequence.

According to some embodiments of the invention, the nucleotide sequence of the primer of the pLVX-Tetone-puro lentiviral vector in step S2 is represented by SEQ ID No.1 to SEQ ID No. 6.

According to some embodiments of the invention, the nucleotide sequence of the pLVX-Tetone-puro lentiviral vector primer is shown in SEQ ID No.1-SEQ ID No.6, such that the sequence of SEQ ID No.2 is fully reverse complementary to the sequence of SEQ ID No.3, and the sequence of SEQ ID No.4 is fully reverse complementary to the sequence of SEQ ID No. 5; the nucleotide sequence of the forward primer CAMKII-F of the CAMKII gene is shown as SEQ ID NO.7, the nucleotide sequence of the reverse primer CAMKII-R is shown as SEQ ID NO.8, wherein the homologous arm sequence of SEQ ID NO.7 is completely reversely complementary with the sequence of SEQ ID NO.6, and the homologous arm sequence of SEQ ID NO.8 is completely reversely complementary with the sequence of SEQ ID NO. 1; the nucleotide sequence of the forward primer EGFP-F of the EGFP gene is shown as SEQ ID No.11, and the nucleotide sequence of the reverse primer EGFP-R is shown as SEQ ID No. 12.

According to some embodiments of the invention, in step S2, the EGFP gene is subcloned into the MCS region downstream of the lentiviral vector TRE3GS promoter by homologous recombination, so that TRE3GS promoter controls its expression.

According to some embodiments of the present invention, in step S2, the CAMKII gene is amplified by reverse segmentation, and the linearized vector and the CAMKII gene segment are recombined by seamless cloning to replace the original lentiviral vector puro element sequence, so as to complete subcloning, and the SV40 promoter controls the expression of the recombinant lentiviral vector puro element sequence.

According to some embodiments of the invention, the CAMKII gene is inserted behind the TRE3 promoter, the expression of which is regulated by dox.

The recombinant lentiviral vector according to an embodiment of a fifth aspect of the invention is used for the fluorescent detection of a gene associated with cell function.

According to some embodiments of the invention, the fluorescence detection is regulated by doxycycline hydrochloride (Dox), tetR binds to TetO when no Dox is present in the cell, thereby blocking downstream EGFP fluorescent gene expression; when Dox is present, tetR separates from TetO, causing the inhibition of the EGFP fluorescent gene to be released, thereby enabling the expression of green fluorescence.

According to some embodiments of the invention, the use is for the detection of a calmodulin-related gene using a recombinant lentiviral vector.

According to some embodiments of the invention, the use is of a recombinant lentiviral vector for the detection of intracellular calcium ion concentration.

A method for detecting changes in intracellular calcium ion concentration, comprising the steps of: the recombinant lentiviral vector is used for infecting target cells, and the change of the calcium ion concentration is measured according to the change of the fluorescence intensity.

According to some embodiments of the invention, the change in calcium ion concentration is detected using an intracellular calcium ion detection kit.

According to some embodiments of the present invention, the calcium ion concentration change detection may be performed by a fluorescence microscope, a microplate reader, a laser confocal microscope or a flow cytometer.

A fluorescent-labeled regulatable lentiviral vector prepared by a method comprising the steps of: the green fluorescent gene EGFP is inserted into the TRE3 promoter regulated by dox in the recombinant lentiviral vector.

The recombinant lentiviral vector according to an embodiment of the present invention has at least the following beneficial effects: according to the scheme, the green fluorescent gene EGFP and calmodulin-dependent protein kinase II (CAMKII) are subcloned into a lentiviral vector pLVX-Tentone-puro to obtain the recombinant lentiviral vector, so that the defects of complex operation, time consumption, high failure rate and the like of the traditional cloning method are overcome; the fluorescent marker of the recombinant lentiviral vector is positioned behind a TRE3 promoter regulated by dox to obtain the recombinant lentiviral vector with the existence of the fluorescent marker and adjustable, and the puro of the original lentiviral vector is replaced by the target gene, so that the expression of the target gene is not influenced while the existence of the fluorescent marker is regulated; the recombinant lentiviral vector provided by the invention has small toxicity to cells, and the preparation method is simple and is easy for industrial production.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

FIG. 1 is a diagram of the linearized electrophoresis of pLVX-Tetone-puro in example 1 of the present invention;

FIG. 2 is the CAMKII gene fragment amplification electrophoretogram in example 1 of the present invention;

FIG. 3 is a map of the intermediate vector pLVX-TetOne-SV40-CAMKII in example 1 of the present invention;

FIG. 4 is a colony PCR electrophoresis diagram of the intermediate vector pLVX-TetOne-SV40-CAMKII in example 1 of the present invention;

FIG. 5 is a schematic diagram of the sequencing verification alignment of the intermediate vector pLVX-TetOne-SV40-CAMKII in example 1 of the present invention;

FIG. 6 is a single-restriction electrophoresis of the intermediate vector pLVX-TetOne-SV40-CAMKII in example 1 of the present invention;

FIG. 7 is an electrophoretogram of amplification of an EGFP gene fragment in example 1 of the present invention;

FIG. 8 is a map of the final vector pLVX-TetOne-EGFP-SV40-CAMKII in example 1 of the present invention;

FIG. 9 is a PCR electrophoretogram of the final vector pLVX-TetOne-EGFP-SV40-CAMKII colony in example 1 of the present invention;

FIG. 10 is a schematic diagram of sequencing and check-up comparison of the final vector pLVX-TetOne-EGFP-SV40-CAMKII in example 1 of the present invention;

FIG. 11 is a graph showing the effect of U87-MG on target cells after infection with lentivirus in example 3 of the present invention;

FIG. 12 is a graph showing the results of QPCR detection of the relative expression level of CAMKII gene in example 3 of the present invention;

FIG. 13 is a graph showing the flow detection results of the NC group and the lentivirus overexpression group (lentivirus group 3) in example 3 of the present invention.

Detailed Description

In order to explain technical contents, achieved objects, and effects of the present invention in detail, the following description is made with reference to the accompanying drawings in combination with the embodiments. The test methods used in the examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available reagents and materials unless otherwise specified.

EXAMPLE 1 construction of recombinant Lentiviral vectors

The construction method of the recombinant lentiviral vector comprises the following steps:

1. primer design

Designing a linearized circular vector pLVX-Tetone-puro primer according to a base sequence (shown as SEQ ID NO. 17) of the vector pLVX-Tetone-puro, wherein the nucleotide sequence of the pLVX-Tetone-puro primer is shown as SEQ ID NO.1-SEQ ID NO.6, so that the sequence SEQ ID NO.2 is completely reverse-complementary to the sequence SEQ ID NO.3, and the sequence SEQ ID NO.4 is completely reverse-complementary to the sequence SEQ ID NO. 5; using a plasmid containing a human CAMKII gene sequence as a template, and designing primer nucleotide sequences as shown in SEQ ID NO.7 and SEQ ID NO.8, wherein the homologous arm sequence of SEQ ID NO.7 is completely complementary to the sequence of SEQ ID NO.6 in a reverse direction, and the homologous arm sequence of SEQ ID NO.8 is completely complementary to the sequence of SEQ ID NO.1 in a reverse direction; a plasmid containing a human EGFP gene sequence is used as a template, and the nucleotide sequences of the designed primers are shown as SEQ ID NO.11 and SEQ ID NO. 12; the nucleotide sequence of the primer adopted by colony PCR is shown as SEQ ID NO.9 in the nucleotide sequence of the forward primer Fp, and the nucleotide sequence of the reverse primer Rp is shown as SEQ ID NO.10 in the nucleotide sequence of the reverse primer Rp. The primer sequences are specifically shown in Table 1.

TABLE 1 primer sequence Listing

2. Construction of intermediate vector pLVX-TetOne-SV40-CAMKII

(1) The lentiviral vector pLVX-Tetone-Puro primary plasmid (purchased from NTCC under the accession number pLVX-TetOne-Puro) was extracted using a plasmid extraction kit (purchased from magenta under the accession number P1155-03).

(2) The circular vector pLVX-Tetone-puro was linearized and amplified using a hot start high fidelity enzyme (purchased from TAKARA, cat # R040A) using primer pairs SEQ ID No.1 and SEQ ID No.2 (amplification product size 2738 bp), SEQ ID No.3 and SEQ ID No.4 (amplification product size 3010 bp), and SEQ ID No.5 and SEQ ID No.6 (amplification product size 2925 bp), and the puro elements were removed. The electrophoretogram of the amplified product is shown in FIG. 1, from which it can be seen that the amplified PCR product fragment is correct in size.

(3) A plasmid containing a human CAMKII gene sequence (shown as SEQ ID NO. 18) is used as a template, primer nucleotide sequences are added as shown in SEQ ID NO.7 and SEQ ID NO.8, and a hot-start high-fidelity enzyme (purchased from TAKARA, commodity number R040A) is used for amplification to obtain a CAMKII gene fragment with a homology arm, wherein the amplification result is shown in figure 2, and the amplified PCR product fragment is correct in size.

(4) Three carrier fragments obtained by reverse amplification and 4 fragments of CAMKII gene fragments with homologous arms are seamlessly cloned (purchased from Vazyme, a commodity number of C115-01), a recombinant plasmid is obtained according to the operation instruction, then the recombinant plasmid is transformed into a competent cell (purchased from Tsingke, a commodity number of TSC 01), the competent cell is verified by colony PCR (shown in figure 4), forward primers of primer nucleotide sequences adopted by the colony PCR are shown as SEQ ID NO.9 and SEQ ID NO.10, and strains which are correctly identified by the colony PCR are sent out for sequencing verification. The competent cells with correct sequence were subjected to amplification culture, and the intermediate vector pLVX-TetOne-SV40-CAMKII was extracted using a plasmid extraction kit, and its map is shown in FIG. 3.

3. Construction of final vector pLVX-TetOne-EGFP-SV40-CAMKII

(1) The intermediate vector pLVX-TetOne-SV40-CAMKII is subjected to single enzyme digestion, the intermediate vector pLVX-TetOne-SV40-CAMKII is linearized by selecting an enzyme digestion site BamHI (purchased from NEB, cat # R0136T), the enzyme digestion effect is shown in figure 6, and the successful linearization of the intermediate vector can be seen from the figure.

(2) A plasmid containing a human EGFP gene sequence (shown as SEQ ID NO. 19) is used as a template, primers SEQ ID NO.11 and SEQ ID NO.12 are added, and the amplification is performed by using a hot start high fidelity enzyme (purchased from TAKARA, cat # R040A), so that an EGFP gene fragment with a homologous arm is obtained as shown in FIG. 7.

(3) Carrying out homologous recombination on 2 fragments of a linearization fragment of an intermediate vector pLVX-TetOne-SV40-CAMKII and an EGFP gene fragment with a homology arm to obtain a recombinant plasmid, then transforming the recombinant plasmid into competent cells, and identifying the competent cells by colony PCR, wherein the nucleotide sequence of a forward primer adopted by the colony PCR is as follows: ACAGGGACAGCAGAGCTACCA (shown in SEQ ID NO. 13); the reverse primer nucleotide sequence is: CTGGACGGCGACGTAAACGG (shown as SEQ ID NO. 14). The strains with correct colony PCR identification are sent out for sequencing verification, and the comparison diagram of the sequencing verification is shown in figure 5. And (3) performing amplification culture on the competent cells with the correct sequence, and extracting a final vector pLVX-TetOne-EGFP-SV40-CAMKII by adopting a plasmid endotoxin removal extraction kit, wherein the map of the final vector is shown in figure 8.

The final vector pLVX-TetOne-EGFP-SV40-CAMKII colony PCR electrophoresis diagram is shown in FIG. 9, the sequencing verification comparison diagram is shown in FIG. 10, and it can be seen that the final vector pLVX-TetOne-EGFP-SV40-CAMKII was successfully constructed and can be used in the following examples.

Example 2 Lentiviral packaging and Titer assay

The lentivirus packaging adopts a three-plasmid system: packaging plasmids (psPAX 2, pMD2. G) and a target plasmid (pLVX-TetOne-EGFP-SV 40-CAMKII).

(1) 293T cells were prepared. The cell density at transfection was 70-80% as 8X 10 ⁶ The cells were inoculated per 10cm dish.

(2) The plasmids were co-transfected. The medium was changed to 10ml DMEM basal medium before transfection, the desired plasmid and packaging plasmid were incubated with 1ml DMEM basal medium for 5min, while lipoiter was incubated with 1ml DMEM basal medium for 5min, and then the plasmid and lipoiter were gently mixed and incubated for further 20min. Then 2ml of the liquid was added dropwise to the petri dish. After 6h the medium was changed to 10ml complete medium (no double antibody, dox,1 ug/ml).

(3) Fluorescence was observed. Fluorescence was observed by fluorescence microscopy 24h after transfection to confirm the success of transfection.

(4) And (4) toxic materials are collected. Viral supernatants were harvested 48h after transfection and stored at 4 ℃.

(5) And (5) concentrating. Centrifugation and concentration of the virus were performed using a spin column. After the concentration is finished, the filtered sample is subpackaged according to the requirement, 10 mu L of the sample is reserved for titer detection and is marked, and the sample is stored at the temperature of minus 80 ℃ or under the condition of liquid nitrogen.

(6) And (4) determining the titer. The titer is detected by adopting a gradient dilution method, and finally the virus titer is ensured to be not less than 2 multiplied by 10 ⁸ TU/mL。

EXAMPLE 3 infection and validation of cells of interest

Calcium ions play an important role in the physiological activities of cells. The change of the concentration of the free calcium ions is closely related to the functions of cells, the transmission of signals and the damage and apoptosis of the cells, and particularly the physiological function of related cells of the nervous system is regulated and controlled. Human glioblastoma U87-MG was used in this example. Glioblastoma is the most common and most malignant astrocytoma of the central nervous system, and belongs to a malignant tumor. The best sites are the frontal and temporal deep white matter regions, with basal ganglia and posterior cranial fossa also being involved, the latter being most commonly seen with the cerebellar hemisphere and brainstem. The clinical manifestations are headache, vomiting, decreased vision and other symptoms of increased intracranial pressure. High malignancy and poor prognosis.

1. Infection of target cell

(1) U87-MG cells were treated with DMEM medium containing 10% fetal calf serum and 1% pen/strep at 37 ℃ saturation humidity, containing 5% CO ₂ Culturing in an incubator. Taking U87-MG cells with good growth state in logarithmic growth phase, digesting with 0.25% pancreatin, and counting the cells;

(2) U87-MG cells were seeded in 6-well plates at a density of 3.0X 105/well and 24h after plating, grouped as follows: control group (Dox added at 1u/ml without lentivirus infection); NC group (infected lentivirus no-load, dox induction added at 1 ug/ml); lentiviral group 1 (infected with pLVX-TetOne-EGFP-SV40-CAMKII induced by addition of 1ug/ml Dox); lentivirus group 2 (infected with pLVX-TetOne-EGFP-SV40-CAMKII, without Dox induction); lentivirus group 3 (pLVX-TetOne-EGFP-SV 40-CAMKII infected, 1ug/ml dox induction was added first, and dox induction was removed) and after 48h pictures were taken under a fluorescence microscope at 100 x.

The effect of the target cell U87-MG after lentivirus infection is shown in FIG. 11, and it can be seen from the figure that the Control group has fluorescence, the NC group does not have fluorescence, but the cell state has no significant difference, which indicates that the infection of the virus has little influence on the cell morphology and state. In the lentivirus group, the group 1 added with 1ug/ml dox has fluorescence expression, and the group 2 not added with dox has no fluorescence expression, which indicates that the Tet-on system runs normally. And the virus group 3 can show fluorescent expression after dox is added, the dox is removed after 48h, almost no fluorescent expression is observed after passage for 72h, and the cell state difference before and after the dox is removed is small, so that the Tet-on system operates normally and the cell state is not greatly influenced by the addition of dox medicines.

2. Verification of expression of overexpression Effect

(1) And (3) carrying out RNA extraction and reverse transcription on the 5 groups of samples infected by the virus to obtain cDNA.

(2) Designing a QPCR detection primer of CAMKII, wherein the QPCR primer of the CAMKII is CAMKII-F: AGCTTGGCAAGGGTGCTTTC (shown as SEQ ID NO. 15); CAMKII-R: TTCTGGTGATCCGGGCAGA (shown in SEQ ID NO. 16). Expression of 4 distinct CAMKII was detected by QPCR.

The results of QPCR detection of the relative expression amount of CAMKII gene are shown in FIG. 12, and it can be seen from the figure that CAMKII of the lentivirus groups (group 1 and group 2) is significantly higher than that of the control group and the NC group, and the

groups

1, 2 and 3 have no statistical difference, which indicates that CAMKII overexpression is successful and is not influenced by Tet-on system and dox drugs.

3. Calcium ion concentration detection

The calcium ion concentration was measured using an intracellular calcium ion assay kit (BBcellProbe F3 method, product No. BB-48112-1) purchased from Bebo. The working principle of the kit is that the fluorescent probe of the concentration of calcium ions in BBcellProbeTM F3 cells is adopted to detect the calcium ions. BBcellProbeTM F3 penetrates cell membranes to enter cells, and is cut by intracellular esterase to form Fluo-3, so that the Fluo-3 is retained in the cells. Fluo-3 free ligand is almost non-fluorescent, and its fluorescence does not increase with increasing calcium ion concentration. However, when it is combined with intracellular calcium ions, strong fluorescence can be generated, the fluorescence can be increased by 60 to 100 times, the maximum excitation wavelength is 506nm, and the maximum emission wavelength is 526nm. The recommended excitation wavelength for practical detection is about 488nm, and the emission wavelength is 525-530 nm. Changes in intracellular calcium ion concentration were detected by using fluorescence microscopy, microplate reader, laser confocal microscopy or flow cytometry.

(1) Respectively culturing U87-MG cells of an NC group (infected by lentivirus with no load and added with 1ug/ml of Dox induction) and a lentivirus group 3 (infected by recombinant lentivirus, firstly added with 1ug/ml of Dox induction and then removed with Dox induction);

(2) The treatment was carried out according to the instructions of the intracellular calcium ion detection kit, and the flow analysis was carried out by a flow cytometer.

The flow assay results of the NC group and the lentivirus overexpression group (lentivirus group 3) are shown in FIG. 13, and it can be seen that the calcium ion concentration is increased after CAMKII is overexpressed.

The Tet-On induced expression is established On the basis of a Tet resistance operon On a transposon of escherichia coli Tn10, a Tet repressor protein (Tet decompressor protein, tetR and a Tet operator (Tetoperator, tetO) DNA sequence have specific affinity, when no Tet exists in a cell, the TetR can be combined with TetO, so that the expression of a downstream resistance gene is blocked, when the Tet exists, the drug enables the conformation of the TetR to be changed, so that the TetR and the TetO are separated, so that the inhibition of the resistance gene is released, and the resistance protein expression enables bacteria to generate drug resistance.

The Tet system has the characteristics of low background and high induction multiple, the expression level of the target gene is low when no induction is carried out, the expression level is increased when the induction is carried out, and the highest induction multiple can reach 10000 times. The induction multiple of the target gene has a certain relation with the quantity of an inducer and the induction time, so people can adopt a Tet induction regulation expression system to accurately regulate the gene expression. The combination specificity of the prokaryotic source TetR and TetO is high, and no similar DNA target sequence exists in mammalian cells, so that the system has high regulation specificity, host genes are not influenced, and the system is suitable for regulating and controlling the expression of various genes in vivo and in vitro.

The induction drug of the Tet system is Tet or a derivative thereof (such as Dox/4-ED and the like). Tet has been used by people for a long time as an antibiotic and is a drug which is safe to the human body. In addition, the expression of the genes can be regulated by low-dose Tet in a Tet system, so that strong toxicity is not generated to animals or cells, the time required by the induction of the system is short, and the expression of the target genes can be detected within 30 minutes after the inducer is added; the system can be shut down after a certain time after removal of the inducer and then be re-opened by addition of the inducer, so that the induction system is a reversible system.

The lentiviral vector constructed based on the Tet system has the significance that when no Tet exists in a cell, tetR can be combined with TetO, so that the downstream EGFP fluorescent gene expression is blocked, when Tet exists, the drug enables the conformation of TetR to be changed, so that TetR and TetO are separated, the EGFP fluorescent gene inhibition is relieved, and the EGFP fluorescent gene expression enables experimenters to conveniently judge the transfection efficiency of over-expressed plasmids. The expression of CAMKII gene is not affected, and the CAMKII gene is normally over-expressed and participates in calcium regulation in cells. Due to the subsequent intracellular Ca ²⁺ At present, the most adopted fluorescent probe kit is used for detecting the change of the concentration level, so that Tet induction is removed before detection, the EGFP fluorescent gene expression is restored and inhibited, and the fluorescent interference is eliminated. This is also an advantage of selecting the pLVX-Tetone-puro vector Tet-On system.

Therefore, the expression of the fluorescent expression system is inconsistent with that of the protein related to the calcium concentration regulatory protein through the regulatory system, the cells are fluorescent when the engineering cell strain is obtained, the fluorescence can be lost in the subsequent calcium ion detection process, and the target gene expression is not influenced by the fluorescent loss process.

The above description is only an embodiment of the present invention, and not intended to limit the scope of the present invention, and all equivalent changes made by using the contents of the present specification and the drawings, or applied directly or indirectly to the related technical fields, are included in the scope of the present invention.

Sequence listing

<110> Hu nan fenghui biotech Co., ltd

<120> recombinant lentiviral vector, and preparation method and application thereof

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

acgcgtctgg aacaatcaac ct 22

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cattggtaac tgtcagacca ag 22

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cttggtctga cagttaccaa tg 22

<210> 4

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tgtgattcca aatctgttcc agag 24

<210> 5

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctctggaaca gatttggaat caca 24

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtcgcgttt tgcaaaagcc t 21

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

aggcttttgc aaaacgcgac catggccacc accgccacct gcacc 45

<210> 8

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

aggttgattg ttccagacgc gttcactgca gcggtgcggc a 41

<210> 9

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gaggcctaca cgaagatttg tga 23

<210> 10

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gccacaactc ctcataaaga gacag 25

<210> 11

<211> 47

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctcgcagggg aggtggtctg gatccttact tgtacagctc gtccatg 47

<210> 12

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

cgtatacacc ggtgccggcg gatccatggt gagcaagggc gagga 45

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

acagggacag cagagatcca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctggacggcg acgtaaacgg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

agcttggcaa gggtgctttc 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

ttctggtgat cccgggcaga 20

<210> 17

<211> 9227

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840

aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900

caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960

gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020

cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080

ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140

aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200

tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260

aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320

gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380

cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440

gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500

ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560

actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620

gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680

aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740

ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800

tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860

actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920

cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980

cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccttt aaaagaaaag 2040

gggggattgg ggggtacagt gcaggggaaa gaatagtaga cataatagca acagacatac 2100

aaactaaaga actacaaaaa caaattacaa aaattcaaaa ttttcgggtt tattacaggg 2160

acagcagaga tccagtttat cgacttaact tgtttattgc agcttataat ggttacaaat 2220

aaggcaatag catcacaaat ttcacaaata aggcattttt ttcactgcat tctagttttg 2280

gtttgtccaa actcatcaat gtatcttatc atgtctggat ctcaaatccc tcggaagctg 2340

cgcctgtctt aggttggagt gatacatttt tatcactttt acccgtcttt ggattaggca 2400

gtagctctga cggccctcct gtcttaggtt agtgaaaaat gtcactctct tacccgtcat 2460

tggctgtcca gcttagctcg caggggaggt ggtctggatc cgccggcacc ggtgtatacg 2520

ggaattcttt acgagggtag gaagtggtac ggaaagttgg tataagacaa aagtgttgtg 2580

gaattgaagt ttactcaaaa aatcagcact cttttatagg cgccctggtt tacataagca 2640

aagcttatac gttctctatc actgataggg agtaaactgg atatacgttc tctatcactg 2700

atagggagta aactgtagat acgttctcta tcactgatag ggagtaaact ggtcatacgt 2760

tctctatcac tgatagggag taaactcctt atacgttctc tatcactgat agggagtaaa 2820

gtctgcatac gttctctatc actgataggg agtaaactct tcatacgttc tctatcactg 2880

atagggagta aactcgaggt gataattcca cggggttggg gttgcgcctt ttccaaggca 2940

gccctgggtt tgcgcaggga cgcggctgct ctgggcgtgg ttccgggaaa cgcagcggcg 3000

ccgaccctgg gtctcgcaca ttcttcacgt ccgttcgcag cgtcacccgg atcttcgccg 3060

ctacccttgt gggccccccg gcgacgcttc ctgctccgcc cctaagtcgg gaaggttcct 3120

tgcggttcgc ggcgtgccgg acgtgacaaa cggaagccgc acgtctcact agtaccctcg 3180

cagacggaca gcgccaggga gcaatggcag cgcgccgacc gcgatgggct gtggccaata 3240

gcggctgctc agcagggcgc gccgagagca gcggccggga aggggcggtg cgggaggcgg 3300

ggtgtggggc ggtagtgtgg gccctgttcc tgcccgcgcg gtgttccgca ttctgcaagc 3360

ctccggagcg cacgtcggca gtcggctccc tcgttgaccg aatcaccgac ctctctcccc 3420

agggggatca tcgaattacc atgtctagac tggacaagag caaagtcata aactctgctc 3480

tggaattact caatggagtc ggtatcgaag gcctgacgac aaggaaactc gctcaaaagc 3540

tgggagttga gcagcctacc ctgtactggc acgtgaagaa caagcgggcc ctgctcgatg 3600

ccctgccaat cgagatgctg gacaggcatc atacccactc ctgccccctg gaaggcgagt 3660

catggcaaga ctttctgcgg aacaacgcca agtcataccg ctgtgctctc ctctcacatc 3720

gcgacggggc taaagtgcat ctcggcaccc gcccaacaga gaaacagtac gaaaccctgg 3780

aaaatcagct cgcgttcctg tgtcagcaag gcttctccct ggagaacgca ctgtacgctc 3840

tgtccgccgt gggccacttt acactgggct gcgtattgga ggaacaggag catcaagtag 3900

caaaagagga aagagagaca cctaccaccg attctatgcc cccacttctg aaacaagcaa 3960

ttgagctgtt cgaccggcag ggagccgaac ctgccttcct tttcggcctg gaactaatca 4020

tatgtggcct ggagaaacag ctaaagtgcg aaagcggcgg gccgaccgac gcccttgacg 4080

attttgactt agacatgctc ccagccgatg cccttgacga ctttgacctt gatatgctgc 4140

ctgctgacgc tcttgacgat tttgaccttg acatgctccc cgggtaaacg cgcgaatgtg 4200

tgtcagttag ggtgtggaaa gtccccaggc tccccagcag gcagaagtat gcaaagcatg 4260

catctcaatt agtcagcaac caggtgtgga aagtccccag gctccccagc aggcagaagt 4320

atgcaaagca tgcatctcaa ttagtcagca accatagtcc cgcccctaac tccgcccatc 4380

ccgcccctaa ctccgcccag ttccgcccat tctccgcccc atggctgact aatttttttt 4440

atttatgcag aggccgaggc cgcctcggcc tctgagctat tccagaagta gtgaggaggc 4500

ttttttggag gcctaggctt ttgcaaaacg cgaccatgac cgagtacaag cccacggtgc 4560

gcctcgccac ccgcgacgac gtcccccggg ccgtacgcac cctcgccgcc gcgttcgccg 4620

actaccccgc cacgcgccac accgtcgacc cggaccgcca catcgagcgg gtcaccgagc 4680

tgcaagaact cttcctcacg cgcgtcgggc tcgacatcgg caaggtgtgg gtcgcggacg 4740

acggcgccgc ggtggcggtc tggaccacgc cggagagcgt cgaagcgggg gcggtgttcg 4800

ccgagatcgg cccgcgcatg gccgagttga gcggttcccg gctggccgcg cagcaacaga 4860

tggaaggcct cctggcgccg caccggccca aggagcccgc gtggttcctg gccaccgtcg 4920

gcgtctcgcc cgaccaccag ggcaagggtc tgggcagcgc cgtcgtgctc cccggagtgg 4980

aggcggccga gcgcgccggg gtgcccgcct tcctggagac ctccgcgccc cgcaacctcc 5040

ccttctacga gcggctcggc ttcaccgtca ccgccgacgt cgaggtgccc gaaggaccgc 5100

gcacctggtg catgacccgc aagcccggtg cctgaacgcg tctggaacaa tcaacctctg 5160

gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta 5220

tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt 5280

ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc 5340

aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt 5400

gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg 5460

gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac 5520

aattccgtgg tgttgtcggg gaagctgacg tcctttccat ggctgctcgc ctgtgttgcc 5580

acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac 5640

cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct 5700

cagacgagtc ggatctccct ttgggccgcc tccccgcctg gaattaattc tgcagtcgag 5760

acctagaaaa acatggagca atcacaagta gcaatacagc agctaccaat gctgattgtg 5820

cctggctaga agcacaagag gaggaggagg tgggtttttc cagtcacacc tcaggtacct 5880

ttaagaccaa tgacttacaa ggcagctgta gatcttagcc actttttaaa agaaaagagg 5940

ggactggaag ggctaattca ctcccaacga agacaagata tccttgatct gtggatctac 6000

cacacacaag gctacttccc tgattagcag aactacacac cagggccagg ggtcagatat 6060

ccactgacct ttggatggtg ctacaagcta gtaccagttg agccagataa ggtagaagag 6120

gccaataaag gagagaacac cagcttgtta caccctgtga gcctgcatgg gatggatgac 6180

ccggagagag aagtgttaga gtggaggttt gacagccgcc tagcatttca tcacgtggcc 6240

cgagagctgc atccggagta cttcaagaac tgctgatatc gagcttgcta caagggactt 6300

tccgctgggg actttccagg gaggcgtggc ctgggcggga ctggggagtg gcgagccctc 6360

agatcctgca tataagcagc tgctttttgc ctgtactggg tctctctggt tagaccagat 6420

ctgagcctgg gagctctctg gctaactagg gaacccactg cttaagcctc aataaagctt 6480

gccttgagtg cttcaagtag tgtgtgcccg tctgttgtgt gactctggta actagagatc 6540

cctcagaccc ttttagtcag tgtggaaaat ctctagcagt agtagttcat gtcatcttat 6600

tattcagtat ttataacttg caaagaaatg aatatcagag agtgagaggc cttgacattg 6660

ctagcgtttt accgtcgacc tctagctaga gcttggcgta atcatggtca tagctgtttc 6720

ctgtgtgaaa ttgttatccg ctcacaattc cacacaacat acgagccgga agcataaagt 6780

gtaaagcctg gggtgcctaa tgagtgagct aactcacatt aattgcgttg cgctcactgc 6840

ccgctttcca gtcgggaaac ctgtcgtgcc agctgcatta atgaatcggc caacgcgcgg 6900

ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc gctcactgac tcgctgcgct 6960

cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca 7020

cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga 7080

accgtaaaaa ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc 7140

acaaaaatcg acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg 7200

cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat 7260

acctgtccgc ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt 7320

atctcagttc ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc 7380

agcccgaccg ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg 7440

acttatcgcc actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg 7500

gtgctacaga gttcttgaag tggtggccta actacggcta cactagaaga acagtatttg 7560

gtatctgcgc tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg 7620

gcaaacaaac caccgctggt agcggttttt ttgtttgcaa gcagcagatt acgcgcagaa 7680

aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct cagtggaacg 7740

aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc acctagatcc 7800

ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa acttggtctg 7860

acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta tttcgttcat 7920

ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc ttaccatctg 7980

gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat ttatcagcaa 8040

taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta tccgcctcca 8100

tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt aatagtttgc 8160

gcaacgttgt tgccattgct acaggcatcg tggtgtcacg ctcgtcgttt ggtatggctt 8220

cattcagctc cggttcccaa cgatcaaggc gagttacatg atcccccatg ttgtgcaaaa 8280

aagcggttag ctccttcggt cctccgatcg ttgtcagaag taagttggcc gcagtgttat 8340

cactcatggt tatggcagca ctgcataatt ctcttactgt catgccatcc gtaagatgct 8400

tttctgtgac tggtgagtac tcaaccaagt cattctgaga atagtgtatg cggcgaccga 8460

gttgctcttg cccggcgtca atacgggata ataccgcgcc acatagcaga actttaaaag 8520

tgctcatcat tggaaaacgt tcttcggggc gaaaactctc aaggatctta ccgctgttga 8580

gatccagttc gatgtaaccc actcgtgcac ccaactgatc ttcagcatct tttactttca 8640

ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc cgcaaaaaag ggaataaggg 8700

cgacacggaa atgttgaata ctcatactct tcctttttca atattattga agcatttatc 8760

agggttattg tctcatgagc ggatacatat ttgaatgtat ttagaaaaat aaacaaatag 8820

gggttccgcg cacatttccc cgaaaagtgc cacctgacgt cgacggatcg ggagatcaac 8880

ttgtttattg cagcttataa tggttacaaa taaagcaata gcatcacaaa tttcacaaat 8940

aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 9000

catgtctgga tcaactggat aactcaagct aaccaaaatc atcccaaact tcccacccca 9060

taccctatta ccactgccaa ttacctagtg gtttcattta ctctaaacct gtgattcctc 9120

tgaattattt tcattttaaa gaaattgtat ttgttaaata tgtactacaa acttagtagt 9180

ttttaaagaa attgtatttg ttaaatatgt actacaaact tagtagt 9227

<210> 18

<211> 1620

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

atggccacca ccgccacctg cacccgtttc accgacgact accagctctt cgaggagctt 60

ggcaagggtg ctttctctgt ggtccgcagg tgtgtgaaga aaacctccac gcaggagtac 120

gcagcaaaaa tcatcaatac caagaagttg tctgcccggg atcaccagaa actagaacgt 180

gaggctcgga tatgtcgact tctgaaacat ccaaacatcg tgcgcctcca tgacagtatt 240

tctgaagaag ggtttcacta cctcgtgttt gaccttgtta ccggcgggga gctgtttgaa 300

gacattgtgg ccagagagta ctacagtgaa gcagatgcca gccactgtat acatcagatt 360

ctggagagtg ttaaccacat ccaccagcat gacatcgtcc acagggacct gaagcctgag 420

aacctgctgc tggcgagtaa atgcaagggt gccgccgtca agctggctga ttttggccta 480

gccatcgaag tacagggaga gcagcaggct tggtttggtt ttgctggcac cccaggttac 540

ttgtcccctg aggtcttgag gaaagatccc tatggaaaac ctgtggatat ctgggcctgc 600

ggggtcatcc tgtatatcct cctggtgggc tatcctccct tctgggatga ggatcagcac 660

aagctgtatc agcagatcaa ggctggagcc tatgatttcc catcaccaga atgggacacg 720

gtaactcctg aagccaagaa cttgatcaac cagatgctga ccataaaccc agcaaagcgc 780

atcacggctg accaggctct caagcacccg tgggtctgtc aacgatccac ggtggcatcc 840

atgatgcatc gtcaggagac tgtggagtgt ttgcgcaagt tcaatgcccg gagaaaactg 900

aagggtgcca tcctcacgac catgcttgtc tccaggaact tctcagttgg caggcagagc 960

tccgcccccg cctcgcctgc cgcgagcgcc gccggcctgg ccgggcaagc tgccaaaagc 1020

ctattgaaca agaagtcgga tggcggtgtc aagccacaga gcaacaacaa aaacagtctc 1080

gtaagcccag cccaagagcc cgcgcccttg cagacggcca tggagccaca aaccactgtg 1140

gtacacaacg ctacagatgg gatcaagggc tccacagaga gctgcaacac caccacagaa 1200

gatgaggacc tcaaagtgcg aaaacaggag atcattaaga ttacagaaca gctgattgaa 1260

gccatcaaca atggggactt tgaggcctac acgaagattt gtgatccagg cctcacttcc 1320

tttgagcctg aggcccttgg taacctcgtg gaggggatgg atttccataa gttttacttt 1380

gagaatctcc tgtccaagaa cagcaagcct atccatacca ccatcctaaa cccacacgtc 1440

cacgtgattg gggaggacgc agcgtgcatc gcctacatcc gcctcaccca gtacatcgac 1500

gggcagggtc ggcctcgcac cagccagtca gaagagaccc gggtctggca ccgtcgggat 1560

ggcaagtggc tcaatgtcca ctatcactgc tcaggggccc ctgccgcacc gctgcagtga 1620

<210> 19

<211> 720

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 60

ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga tgccacctac 120

ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 180

ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga ccacatgaag 240

cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatcttc 300

ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg cgacaccctg 360

gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 420

aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa gcagaagaac 480

ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt gcagctcgcc 540

gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 600

tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 660

ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct gtacaagtaa 720

Claims

1. The application of a recombinant lentiviral vector in the detection of the calcium ion concentration in a cell is characterized in that: the recombinant lentiviral vector comprises a green fluorescent gene insertedEGFPAnd a lentiviral vector of a calmodulin-dependent protein kinase II gene, wherein the lentiviral vector adopts a Tet-On inducible expression lentiviral system; the sequence of the slow virus starting vector is shown as SEQ ID NO.17EGFPThe gene is inserted into an MCS region at the downstream of a TRE3 promoter of a slow virus starting slow virus vector, the expression of the gene is controlled by the TRE3 promoter, and the expression of the gene is regulated and controlled by dox; the gene of calmodulin-dependent protein kinase II replaces puro element behind SV40 promoter on the original vector of lentivirus.

2. A recombinant lentivirus, wherein: the recombinant lentivirus is prepared by co-transfecting a mammalian cell with the recombinant lentivirus vector of claim 1 and a packaging plasmid.

3. The recombinant lentivirus of claim 2, wherein: the mammalian cells include 293T cells or 293F cells.

4. A recombinant cell, wherein: the recombinant cell includes a host cell comprising the recombinant lentiviral vector of claim 1 and/or the recombinant lentivirus of claim 2 or 3.

5. A method of producing the recombinant lentiviral vector of claim 1, wherein: the method comprises the following steps: will be provided withEGFPGenes andCAMKIIthe genes are respectively cloned into a lentivirus vector to obtain the recombinant lentivirus vector.

6. A method for detecting changes in intracellular calcium ion concentration, comprising: the method comprises the following steps: infecting a target cell to be detected with the recombinant lentiviral vector of claim 1, judging the transfection efficiency of the plasmid according to the expression of EGFP, wherein the expression of the calmodulin-dependent protein kinase II gene is not affected, removing Tet induction to inhibit the expression of EGFP, detecting calcium ions in the cell by using a calcium ion fluorescent probe, and determining the change of the calcium ion concentration according to the change of the fluorescence intensity of the target cell.