CN112626104A - Method for producing plectasin by using pichia pastoris - Google Patents

Abstract

The invention discloses a method for producing plectasin by using pichia pastoris, which comprises the following steps: a. according to the codon preference of pichia pastoris, a plectasin gene is modified and amplified; b. constructing recombinant plasmid pGAPZ alpha B-Plec for expressing plectasin gene in pichia pastoris cells; c. transforming pichia pastoris X33 cells by using a recombinant plasmid pGAPZ alpha B-Plec; d. screening and identifying positive strains; e. culturing the transformed bacteria to obtain a bacterial liquid secreting antibacterial peptide plectasin; f. and (3) identifying the activity of the antibacterial peptide plectasin.

Description

Method for producing plectasin by using pichia pastoris

Technical Field

The invention relates to the technical field of biotechnology and genetic engineering, in particular to a method for producing plectasin by using pichia pastoris.

Background

China is a big livestock breeding country, the amount of the produced animal feed reaches more than 1 hundred million tons every year, and the loss caused by the putrefaction of the feed in the storage process exceeds 10 hundred million yuan. At present, a commonly adopted measure for solving the problem is to add a chemical preservative into the feed, but the chemical preservative remained in an animal body not only influences the quality of livestock and poultry products, but also threatens the health of people, such as diseases such as gastroenteritis and the like, and influences the liver and kidney functions and the like. On the other hand, because of adding a large amount of antibiotics in animal feed in China for a long time, the microecological balance of the digestive tract of animals is seriously influenced, and the occurrence of drug resistance of some pathogenic bacteria is caused, so that the prevention and treatment of infection caused by the pathogenic bacteria become very difficult. Therefore, the use of chemical antiseptics and antibiotics in animal breeding is replaced, and the harmonious and healthy development of animal husbandry is really realized, so that the problem that the animal husbandry industry in China is urgently needed to overcome is solved.

The conventional antibiotics have the bacteriostatic or bactericidal effect by binding with receptors at specific parts of microorganisms so as to destroy the normal structures of the microorganisms or block the activity of enzymes and necessary metabolic pathways, and the like. Simple genetic mutation at the target site of the microorganism can be used for resisting the attack of antibiotics, thereby generating drug resistance. The process of resistance of microorganisms to antimicrobial peptides is much more difficult than with traditional antibiotics. This is because the main mechanism of action of the antimicrobial peptide is to penetrate the cell membrane and kill the bacteria by interacting with amino acids on the cell membrane, so that the bacteria must change the surface structure of the membrane, i.e., change a considerable portion of genes, to cope with the attack of the antimicrobial peptide, which is almost impossible. Another significant advantage of antimicrobial peptides is the broad spectrum of action, with conventional antibiotics being resistant only to a certain class of bacteria, whereas antimicrobial peptides are generally resistant to G⁺And G^-The bacteria are resistant. In addition, the problem of antibiotic residues is becoming more and more important, and antimicrobial peptide is a small molecule polypeptide that can be degraded into amino acids in the digestive tract of animals, so that there is no residue problem. In foreign countries, a variety of mature antibacterial peptide products have been applied in clinical medicine, and have achieved good effects. For example, the antimicrobial peptide marguerin (magainin) from amphibians has been used in the clinical treatment of certain infectious diseases; the antimicrobial peptide nisin (nisin) from microorganisms has been approved by the FDA in the united states as an additive component for blood preservatives. China is still in an exploration stage in the research aspect of antibacterial peptides, and is immature in key technology. Antibiotic residues become one of the biggest obstacles for domestic animal products to move to the international market, so that the development of novel antibacterial peptide products with independent intellectual property rights to replace chemical preservatives and antibiotics has important significance for the safe, healthy and harmonious development of domestic animal husbandry.

Plectasin is the first fungal defensin isolated from secreted proteins of saprophytic ascomycetes by danish biotechnology in 2005. Defensins are a class of natural cysteine-rich antimicrobial peptides present in animals and higher plants, which have strong defense ability against a variety of microorganisms, and thus, defensins are a new class of attractive antibacterial candidates at present. The mature functional fragment of plectasin is only 40 amino acids, has a molecular weight of about 4.4KDa, and has a spatial structure consisting of an alpha-helix and two antiparallel beta-sheets, which is a typical defensin CS alpha beta structure. The biological activity of the compound mainly shows that the compound has stronger bactericidal action on gram-positive bacteria, particularly streptococcus pneumoniae, streptococcus pyogenes, staphylococcus aureus and the like, and the antibacterial mode of the plectasin is similar to that of vancomycin widely used at present. In addition, plectasin has the advantages of no cytotoxicity, no hemolytic property, good cerebrospinal fluid permeability and the like in vitro antibacterial tests, animal tests and some clinical tests, can effectively treat experimental peritonitis and pneumonia mice caused by streptococcus pneumoniae, can also effectively kill some strains with resistance to traditional antibiotics, has curative effects on pneumococci causing pneumonia, meningitis and streptococcal tonsillitis, does not generate drug resistance, does not have cross resistance with the traditional antibiotics, and therefore has huge development potential as a new generation antibiotic substitute.

The existing plectasin expression system has the following sources, 1) the plectasin is separated from the secretory protein of the saprophytic ascomycetes, but the content is very low and the plectasin is difficult to separate and purify; 2) the chemical synthesis production of plectasin has short period, but the method has high cost; 3) is obtained by means of gene engineering, and mainly adopts prokaryotic expression and eukaryotic expression systems. Although the prokaryotic expression system has high expression quantity and short growth cycle, the post-translational processing modification system is imperfect, the activity of the expression product is low, and the difficulty of separating and purifying the product is large. Saccharomyces cerevisiae in eukaryotic expression system also has limitation, poor secretion efficiency, easy loss of plasmid, rigorous culture and price adjustment, high cost, and is not suitable for industrial large-scale production.

Disclosure of Invention

The invention provides a method for expressing antibacterial peptide plectasin by using pichia pastoris, aiming at overcoming the defects of the prior art, such as high separation and purification difficulty, long production period, high cost, harm caused by residual methanol, low product activity and the like.

A method for producing plectasin by using pichia pastoris comprises the following steps:

(1) transforming plectasin gene, synthesizing and amplifying plectasin gene, the sequence is shown in SEQ ID NO.1:

GGTTTTGGTTGTAATGGTCCATGGGATGAAGATGACATGCAATGCCATAATCATTGCAAGTCCATTAAGGGTTACAAAGGTGGTTATTGTGCTAAGGGTGGTTTTGTCTGTAAGTGTTAT；

(2) constructing recombinant plasmid pGAPZ alpha B-Plec of the plectasin gene after expression and modification in the pichia pastoris, wherein the sequence of the recombinant plasmid pGAPZ alpha B-Plec is shown as SEQ ID NO. 2;

(3) transforming Pichia pastoris X33 with recombinant plasmid pGAPZ alpha B-Plec;

(4) screening and identifying recombinant yeast;

(5) and (5) obtaining antibacterial peptide plectasin bacterial liquid, precipitating and concentrating plectasin.

Preferably, the method further comprises the following step after step (5):

A. identifying the expression quantity of the plectasin gene by a real-time PCR method;

B. and measuring the diameters of inhibition zones of the plectasin on escherichia coli and staphylococcus aureus and identifying the inhibition effect of the plectasin.

Preferably, the procedure of step a is as follows:

1) culturing plectasin produced by pichia pastoris;

2) producing plectasin according to the production conditions of the saccharomyces cerevisiae and the sweet wormwood respectively; the production conditions of the saccharomyces cerevisiae are as follows: yeast complete culture medium YPD, pH value of 4.5-5.0, optimum growth temperature of 28-30 deg.C, transferring into liquid culture medium for culture when the solid culture dish is inverted to culture room for 2-3d, and using rotary or reciprocating shaking table at least every 200r/min to ensure sufficient ventilation; the production conditions of the sweet wormwood herb are as follows: culturing in MS culture medium at 25-26 deg.C under 1000-1500 lx illumination for 14h, and replacing the culture medium every 20 d;

3) RNA was extracted and the expression level of plectasin was determined.

Preferably, the process of step B is as follows:

1) respectively culturing Escherichia coli and Staphylococcus aureus at 37 deg.C and 200rpm overnight;

2) respectively taking 200 mul of respective bacterial liquid of escherichia coli and staphylococcus aureus, uniformly coating the bacterial liquid on an LB (LB) flat plate without antibiotics, and lightly placing an oxford cup;

3) sucking 200 μ l of Pichia pastoris supernatant, adding into Oxford cup, adding ampicillin AMP 0.5mg/ml in positive control, adding myceliomycin produced by Saccharomyces cerevisiae and herba Artemisiae Annuae in parallel control, culturing at 37 deg.C in constant temperature incubator overnight, and observing antibacterial effect the next day.

Preferably, the process of modifying the plectasin gene in the step (1) and synthesizing and amplifying the plectasin gene comprises the following steps:

(a) synthesizing a modified plectasin gene sequence, and storing the modified plectasin gene sequence in PMD19 Simple plasmid, wherein the modified plectasin gene sequence is shown as SEQ ID NO. 1;

(b) the modified plectasin gene stored in PMD19 Simple plasmid was amplified with the following primers:

primer Plec F1: 5'-CCGCTCGAGAAAAGAGGTTTTGGTTGTAATGGT-3' (SEQ ID NO. 3);

primer Plec R1: 5'-GCTCTAGAGCCTTATCATCGTCGTCATAACACTTAC-3' (SEQ ID NO. 4);

(c) and (3) carrying out 2.0% agarose gel electrophoresis on the modified plectasin gene obtained by PCR amplification, and recovering and purifying a target fragment.

Preferably, the process for constructing the recombinant plasmid pGAPZ alpha B-Plec for expressing the modified plectasin gene in Pichia pastoris, which is described in the step (2), is as follows:

(a) carrying out enzyme digestion on Xho I and Xba I, recovering a purified modified plectasin gene obtained by PCR amplification, and recovering a Plec gene fragment after a product is subjected to 2.0% agarose gel electrophoresis;

(b) the pGAPZ alpha B vector is cut by Xho I and Xba I, and the pGAPZ alpha B vector fragment is recovered after the product is subjected to 1.2% agarose gel electrophoresis;

(c) t4 ligase, and obtaining pGAPZ alpha B-Plec vector after 2h of ligation at 16 ℃;

(d) transforming Escherichia coli DH5 alpha strain;

(e) and extracting plasmid DNA after transformation for enzyme digestion identification.

Preferably, the process of transforming Pichia pastoris X33 with the recombinant plasmid pGAPZ α B-Plec in step (3) is as follows:

(a) preparing pichia pastoris X33 competent cells;

1) inoculating Pichia pastoris X33 into a 50ml sterilized centrifuge tube containing 5ml YPD medium, culturing at 30 ℃ and 200rpm overnight;

2) taking 50 ul of overnight cultured Pichia pastoris and putting in 50ml YPD medium, culturing until OD600 is 1.3-1.5, and putting on ice for 10 min;

3) the cells were collected by centrifugation at 1500g for 5min at 4 ℃ and the cell pellet was resuspended in 50ml of pre-cooled sterile ddH 2O;

4) repeating the step 3;

5) centrifuging at 4 deg.C for 5min at 1500g to collect cells, and resuspending the cell pellet with pre-cooled 10ml sterilized 1M Sorbitol (Sorbitol);

6) the cells were harvested by centrifugation at 1500g for 5min at 4 ℃ and resuspended in a precooled 160. mu.l sterile 1M Sorbitol (Sorbitol) pellet, gently swirled and mixed, and dispensed into 1.5ml EP tubes, 80ul per tube, and placed on ice until ready for use.

(b) Linearizing the recombinant plasmid pGAPZ alpha B-Plec, carrying out single restriction enzyme digestion on the recombinant plasmid pGAPZ alpha B-Plec by using Avr II, carrying out electrophoresis identification on a product by using 1.2% agarose gel, and then carrying out gel-cutting recovery;

(c) transforming the linearized plasmid pGAPZ alpha B-Plec into a Pichia pastoris X33 competent cell;

1) sucking 80 μ L yeast competent cells into 5-10 μ g linearized plasmid DNA, flicking with hand until mixing;

2) transferring to a precooled 2mm electric shock cup, and standing for 5min in an ice bath;

3) and wiping water outside the electric shock cup, placing the electric shock cup in an electric conversion instrument, and electrically shocking and converting the yeast. The transformation procedure was: 1.5KV, 25 muF and 200 omega, ensures the discharge time to be between 4.5 and 4.9mS, and indicates that the concentration of DNA salt is too high when the discharge time is less than 4;

4) immediately adding 1mL of precooled 1M sorbitol, transferring to a 2mL centrifuge tube, and standing and culturing for 1h at 30 ℃;

5) adding 1mL YPD, culturing at 30 deg.C and 200rpm for 1 h;

6) centrifuging at 5000rpm for 5min, discarding part of supernatant, leaving 200 μ L of resuspended thallus, and coating on YPDS plate containing 100 μ g/mL;

7) culturing at 30 deg.C in dark for 2-3 days.

Preferably, the process of screening and identifying recombinant yeast in step (4) is as follows:

(a) selecting single clone, streaking on plate for bacteria preservation, and mixing with 10 μ l ddH2O to obtain 1.5 μ l;

(b) adding 1 μ l of 5U/μ l Lyticase, and incubating at 30 deg.C for 10 min;

(c) quickly freezing for 1min with liquid nitrogen to obtain 2.5 μ l Cell Lysate;

(d) adding PCR reaction system (without Taq enzyme), and heating at 95 deg.C for 5 min;

(e) adding 0.15 mul Taq enzyme to carry out PCR reaction;

(f) positive clones were identified by 1.2% agarose gel electrophoresis.

The invention constructs the pichia pastoris expression strain for producing plectasin, and has the advantages that: 1. can grow rapidly on a simple culture medium, and can ferment efficiently to produce heterologous protein; 2. has eukaryotic cell protein synthesis pathway, and can perform eukaryotic modification such as glycosylation, disulfide bond formation, protein processing, etc.; 3. the protein product expressed and secreted is easy to separate and purify; 4. the genetic stability of the foreign protein gene is realized, and the foreign protein gene is integrated on the chromosome of the pichia pastoris, is copied along with the copy of the chromosome and is not easy to lose; 5. the research adopts a pichia pastoris pGAPZ alpha B constitutive expression vector, the promoter does not need methanol induction, the operation is simple, toxic substances are not introduced, and the commercialization of an expression product is facilitated. 6. Compared with the expression level (PP) of the plectasin in the pichia pastoris, the expression level of the plectasin in the pichia pastoris is improved by 40 percent compared with that in saccharomyces cerevisiae (YP) and is improved by 75 percent compared with that in artemisia Apiacea (AP); 7. the size of the inhibition zone is used for expressing the inhibition effect of the expression product, and compared with the plectasin (PP) expressed in pichia pastoris, the inhibition effect on escherichia coli is improved by 62.5 percent compared with that of saccharomyces cerevisiae (YP) and artemisia Apiacea (AP), and the inhibition effect on the escherichia coli is improved by 75 percent compared with that of the saccharomyces cerevisiae (YP) and the artemisia Apiacea (AP).

Drawings

FIG. 1 is a schematic diagram of the construction process of recombinant plasmid pGAPZ alpha B-Plec;

FIG. 2 is an electrophoretogram of PCR amplification products of the plectasin gene;

FIG. 3 is a restriction enzyme identification electrophoresis diagram of the transformation of Escherichia coli DH5 alpha after plectasin is linked with vector pGAPZ alpha B, and plasmid extraction;

FIG. 4 shows a single restriction enzyme linearized identification electrophoresis of recombinant plasmid pGAPZ alpha B-Plec;

FIG. 5 is a colony PCR identification electrophoretogram after the vector pGAPZ alpha B-Plec is transformed into Pichia pastoris X33;

FIG. 6 is a diagram showing the real-time PCR method for detecting the expression level of mycelial mycin after modification;

FIG. 7 is a comparison graph of the bacteriostatic effect of Artemisia annua before and after modification.

In FIG. 2, lane M is 5000bp DNA marker (5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp), and lane 3 is PCR amplification product of Plectasin.

In FIG. 3, lane M is 5000bp DNA marker (5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp), and lane 1 is the cleavage product of Plec-pGAPZ. alpha.B vector.

In FIG. 4, lane M is 5000bp DNA marker (5000bp, 3000bp, 2000bp, 1500bp, 1000bp, 750bp, 500bp, 250bp, 100bp), lane 4 is plasmid Plec-pGAPZ. alpha.B, and 5-6 are Plec-pGAPZ. alpha.B single cleavage products.

In FIG. 5, lane M is a 2000bp DNA marker (2000bp, 1000bp, 750bp, 500bp, 250bp, 100bp), lane 1 is a blank control, lane 1 is a positive control, and 3-11 are PCR screening results for randomly selected clones.

In FIG. 6, PP represents that plectasin is expressed by Pichia pastoris after transformation, YP is plectasin expressed by Saccharomyces cerevisiae before transformation, and AP is plectasin expressed by Artemisia annua before transformation.

In FIG. 7, PP represents the expression of mycelial by Pichia pastoris, YP before modification by Saccharomyces cerevisiae, and AP before modification by Artemisia annua.

The sequences used in the examples of the embodiments are all the sequences mentioned above

The invention is described in detail below with reference to the drawings and the detailed description without limiting the invention.

As shown in FIG. 1, the method for producing plectasin by using Pichia pastoris includes the following steps:

(1) transforming plectasin gene, synthesizing and amplifying plectasin gene, the sequence is shown in SEQ ID NO. 1;

(2) constructing recombinant plasmid pGAPZ alpha B-Plec of the plectasin gene after expression and modification in the pichia pastoris, wherein the sequence of the recombinant plasmid pGAPZ alpha B-Plec is shown as SEQ ID NO. 2;

(3) transforming Pichia pastoris X33 with recombinant plasmid pGAPZ alpha B-Plec;

(4) screening and identifying recombinant yeast;

(5) obtaining antibacterial peptide plectasin bacterial liquid, precipitating and concentrating plectasin;

(6) identifying the expression quantity of the plectasin gene by a real-time PCR method;

(7) and measuring the diameters of inhibition zones of the plectasin on escherichia coli and staphylococcus aureus and identifying the inhibition effect of the plectasin.

The method for producing plectasin by using pichia pastoris has the specific operation process that:

1. transforming plectasin gene, synthesizing and amplifying plectasin gene

The plectasin gene is synthesized and cloned, the gene sequence of plectasin mature peptide in NCBI GenBank is modified, the modified sequence is shown in a sequence table, and the DNA fragment is stored in PMD19 Simple plasmid (purchased from Boehringer Biotech engineering (Dalian) Co., Ltd.). Then, a pair of specific primers is artificially designed and synthesized according to the gene sequence, and a target gene fragment is cloned and amplified by a PCR technology by taking a Plectasin gene fragment stored in a PMD19 Simple plasmid as a template (figure 2). And (3) PCR reaction conditions: pre-denaturation at 94 deg.C for 5min, 30-50 deg.C for 30s-72 deg.C for 20s at 94 deg.C, 30 cycles, and 5min at 72 deg.C. After electrophoresis in 1.2% agarose gel, the purified target fragment was recovered and stored at-20 ℃ for further use.

Primer sequences used in Table 1

2. Construction of secretory expression vector pGAPZ alpha B-Plec

The pGAPZ alpha B vector (purchased from Changsha Ying-Rui Biotechnology Co., Ltd.) and the purified PCR amplified target fragment Plec were digested with Xho I and Xbal I, respectively, and the product was subjected to 1.2% agarose gel electrophoresis to recover the Plec gene fragment and pGAPZ alpha B vector fragment. T4 ligase, ligated for 2h at 16 ℃ to obtain pGAPZ alpha B-Plec vector, and transformed into E.coli DH5 alpha strain. After transformation, plasmid DNA was extracted and subjected to restriction enzyme identification (FIG. 3).

3. Pichia pastoris X33 transformed by recombinant vector pGAPZ alpha B-Plec

1) Preparing pichia pastoris X33 competent cells:

inoculating pichia pastoris into a 50ml sterilized centrifuge tube containing 5ml of YPD culture medium, and culturing at 30 ℃ and 200rpm overnight;

② taking 50 mul of overnight cultured pichia pastoris to be cultured in 50ml YPD culture medium until OD600 is 1.3-1.5, and placing on ice for 10 min;

③ at 4 ℃,1500g,5min, centrifugally collecting cells, and using precooled 50ml sterilized ddH2O to resuspend the cell sediment;

and fourthly, repeating the step III.

Fifthly, centrifuging at 4 ℃ for 1500g for 5min to collect cells, and resuspending the cell pellet with precooled 10ml sterilized 1M Sorbitol (Sorbitol).

Sixthly, the cells are collected by centrifugation at 1500g for 5min at 4 ℃, and the cell sediment is resuspended by precooled 160 mu l sterilized 1M Sorbitol (Sorbitol), and the mixture is evenly mixed by gentle rotation and is subpackaged into 1.5ml of EP tubes, each tube has 80 mu l, and the tubes are placed on ice for use on the same day.

2) The recombinant plasmid pGAPZ alpha B-Plec was linearized, digested singly with AvrII, and the product identified by 1.2% agarose gel electrophoresis (FIG. 4), and recovered by gel cutting.

3) Transformation of plasmid pGAPZ. alpha.B-Plec into Pichia pastoris X33 competent cells:

firstly, sucking 80 mu L of yeast competent cells into 5-10 mu g of linearized plasmid DNA, and flicking by hand until the cells are uniformly mixed;

secondly, transferring the mixture into a precooled 2mm electric shock cup, and standing for 5min in an ice bath;

thirdly, wiping the water outside the electric shock cup, placing the electric shock cup in an electric rotating instrument, and electrically shocking and converting the yeast. The transformation procedure was: 1.5KV, 25 muF, 200 omega, ensuring a discharge time between 4.5 and 4.9mS, less than 4 indicating a too high DNA salt concentration.

Fourthly, 1mL of precooled 1M sorbitol is immediately added, transferred to a 2mL centrifuge tube, and subjected to static culture for 1h at 30 ℃;

adding 1mL YPD, culturing at 30 deg.C and 200rpm for 1 h;

sixthly, centrifuging for 5min at 5000rpm, discarding part of supernatant, leaving 200 mu L of resuspended thallus, and coating on YPDS plate containing 100 mu g/mL;

seventhly, culturing 2-3days at 30 ℃ in a dark place.

4. Screening and identifying recombinant yeasts.

1) Colony PCR screening of recombinant yeast:

firstly, selecting a single clone, marking the single clone on a flat plate for bacterium preservation, and simultaneously uniformly mixing the single clone with 10 mu l of ddH2O to obtain 1.5 mu l of the single clone;

② adding 1 mul of 5U/mul Lyticase, and incubating for 10min at 30 ℃;

③ carrying out quick freezing for 1min by using liquid nitrogen to obtain 2.5 mu l of Cell Lysate;

adding a PCR reaction system (without Taq enzyme), designing the following upstream and downstream primers in order to ensure that the alpha signal peptide, the target gene and the label at the C end are in the same reading frame at 95 ℃ for 5min, wherein the upstream and downstream primers are respectively a sequence at the upstream of the alpha signal peptide and a sequence at the downstream of the label at the C end, and the sequences are as follows:

primer 5' pGAP: 5'-GTCCCTATTTCAATCAATTGAA-3' (SEQ ID NO. 5);

primer 3' AOX 1: 5'-GCAAATGGCATTCTGACATCC-3' (SEQ ID NO. 6);

the reaction system is as follows:

adding 0.15 mul Taq enzyme to carry out PCR reaction;

the thermal cycle is set as follows: pre-denaturation at 94 ℃ for 5 min; denaturation at 94 ℃ for 30s, annealing at 50 ℃ for 30s, extension at 72 ℃ for 1min for 5s, 32 cycles; extension at 72 ℃ for 5 min. Negative no-template control and positive plasmid control were set simultaneously.

Sixthly, identifying positive clones by 1.2 percent agarose gel electrophoresis (figure 5);

2) sequencing again identified the integration of the gene of interest into the yeast cell chromosome:

transferring the positive clones screened in the last step to a YPDS liquid culture medium, culturing at 30 ℃ and 200rpm until the OD600 of a bacterial liquid is 600-1.0, extracting a yeast genome and sequencing. A detection primer is designed on the upstream of the alpha signal peptide and sent to a company for sequencing to confirm that the alpha signal peptide and the plectasin are in the same reading frame and successfully integrated into the yeast chromosome.

Sequencing primer:

Test Primer：5'-GTCCCTATTTCAATCAATTGAA-3'(SEQ ID NO.5)。

5. obtaining antibacterial peptide plectasin bacterial liquid, precipitating and concentrating plectasin

1) Culturing engineering bacteria to express recombinant plectasin:

firstly, transferring 100 mul of antibacterial peptide plectasin pichia pastoris engineering bacteria into 10ml of YPD liquid culture medium, and carrying out shake culture at 30 ℃ and 200rpm until the OD600 value of the bacteria liquid is 1.3-1.5.

Transferring 1ml of the activated bacterial liquid obtained in the step I to 100ml of YPD liquid culture medium, and carrying out shake culture at 30 ℃ and 200rpm for 3-5 days.

2) Protein concentrate in ultrafiltration cups

Firstly, taking 50ml of bacterial liquid, centrifuging for 15min at 4000rpm, and collecting supernatant;

② concentrating and collecting supernatant to about 250 μ l by Millipore ultrafiltration cup with molecular weight cutoff of 3000 Da;

3) trichloroacetic acid is concentrated to precipitate protein;

preparing a 1.5mL clean centrifuge tube, and transferring 200 mu L of protein sample solution;

adding 50 mu L of precipitation liquid A, and carrying out vortex oscillation for 10sec to fully and uniformly mix the solution A;

③ incubating for one hour on ice or on the lower layer of the refrigerating chamber of the refrigerator;

fourthly, centrifuging for 15min at the temperature of 4 ℃ and the rpm of 15000 (20000 g);

carefully removing the supernatant, the liquid on the tube wall and the tube bottom, and keeping the precipitate;

sixthly, adding 600 mu L of washing liquid B, and carrying out vortex oscillation for 10 sec;

seventhly, refrigerating the lower layer of the refrigerator refrigerating chamber for 10min, and centrifuging the lower layer of the refrigerator refrigerating chamber for 15min at 12000rpm (12830g) at 4 ℃ to obtain precipitates;

pouring out the supernatant in a fume hood, and airing the precipitate for 30min in a ventilating manner or drying the precipitate in a freeze dryer;

ninthly, adding 20 mu L of solution C and carrying out vortex oscillation for 10sec, and if the solution is yellow, adding 1-5 mu L of blending solution D to change the solution back to blue;

6. and (3) identifying the expression condition of the plectasin gene by real-time PCR:

1) culturing plectasin produced by Pichia pastoris by the method in the above 5;

2) respectively producing plectasin according to the appropriate production conditions of the saccharomyces cerevisiae and the sweet wormwood;

3) RNA was extracted, and the expression level of plectasin was determined according to the use of the kit (FIG. 6).

7. Activity detection of antibacterial peptide plectasin

1) Coli and Staphylococcus aureus were cultured at 37 ℃ overnight at 200rpm, respectively.

2) Respectively taking 200 mul of respective bacterial liquid of escherichia coli and staphylococcus aureus, uniformly coating the bacterial liquid on an LB (LB) flat plate without antibiotics, and lightly placing an oxford cup.

3) Sucking 200 μ l of Pichia pastoris supernatant, adding into Oxford cup, adding ampicillin AMP 0.5mg/ml in positive control, adding myceliomycin produced by Saccharomyces cerevisiae and herba Artemisiae Annuae in parallel control, culturing at 37 deg.C overnight, and observing antibacterial effect the next day (FIG. 7).

Sequence listing

<110> Changsha Zhongke Jingbo Biotech Co., Ltd

<120> method for producing plectasin by using pichia pastoris

<141> 2020-12-24

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 120

<212> DNA

<213> null

<400> 1

ggttttggtt gtaatggtcc atgggatgaa gatgacatgc aatgccataa tcattgcaag 60

tccattaagg gttacaaagg tggttattgt gctaagggtg gttttgtctg taagtgttat 120

<210> 2

<211> 3209

<212> DNA

<213> null

<400> 2

agatcttttt tgtagaaatg tcttggtgtc ctcgtccaat caggtagcca tctctgaaat 60

atctggctcc gttgcaactc cgaacgacct gctggcaacg taaaattctc cggggtaaaa 120

cttaaatgtg gagtaatgga accagaaacg tctcttccct tctctctcct tccaccgccc 180

gttaccgtcc ctaggaaatt ttactctgct ggagagcttc ttctacggcc cccttgcagc 240

aatgctcttc ccagcattac gttgcgggta aaacggaggt cgtgtacccg acctagcagc 300

ccagggatgg aaaagtcccg gccgtcgctg gcaataatag cgggcggacg catgtcatga 360

gattattgga aaccaccaga atcgaatata aaaggcgaac acctttccca attttggttt 420

ctcctgaccc aaagacttta aatttaattt atttgtccct atttcaatca attgaacaac 480

tatttcgaaa cgatgagatt tccttcaatt tttactgctg ttttattcgc agcatcctcc 540

gcattagctg ctccagtcaa cactacaaca gaagatgaaa cggcacaaat tccggctgaa 600

gctgtcatcg gttactcaga tttagaaggg gatttcgatg ttgctgtttt gccattttcc 660

aacagcacaa ataacgggtt attgtttata aatactacta ttgccagcat tgctgctaaa 720

gaagaagggg tatctctcga gaaaagaggt tttggttgta atggtccatg ggatgaagat 780

gacatgcaat gccataatca ttgcaagtcc attaagggtt acaaaggtgg ttattgtgct 840

aagggtggtt ttgtctgtaa gtgttatgac gacgatgata aggctctaga acaaaaactc 900

atctcagaag aggatctgaa tagcgccgtc gaccatcatc atcatcatca ttgagtttta 960

gccttagaca tgactgttcc tcagttcaag ttgggcactt acgagaagac cggtcttgct 1020

agattctaat caagaggatg tcagaatgcc atttgcctga gagatgcagg cttcattttt 1080

gatacttttt tatttgtaac ctatatagta taggattttt tttgtcattt tgtttcttct 1140

cgtacgagct tgctcctgat cagcctatct cgcagctgat gaatatcttg tggtaggggt 1200

ttgggaaaat cattcgagtt tgatgttttt cttggtattt cccactcctc ttcagagtac 1260

agaagattaa gtgagacctt cgtttgtgcg gatcccccac acaccatagc ttcaaaatgt 1320

ttctactcct tttttactct tccagatttt ctcggactcc gcgcatcgcc gtaccacttc 1380

aaaacaccca agcacagcat actaaatttt ccctctttct tcctctaggg tgtcgttaat 1440

tacccgtact aaaggtttgg aaaagaaaaa agagaccgcc tcgtttcttt ttcttcgtcg 1500

aaaaaggcaa taaaaatttt tatcacgttt ctttttcttg aaattttttt ttttagtttt 1560

tttctctttc agtgacctcc attgatattt aagttaataa acggtcttca atttctcaag 1620

tttcagtttc atttttcttg ttctattaca acttttttta cttcttgttc attagaaaga 1680

aagcatagca atctaatcta agggcggtgt tgacaattaa tcatcggcat agtatatcgg 1740

catagtataa tacgacaagg tgaggaacta aaccatggcc aagttgacca gtgccgttcc 1800

ggtgctcacc gcgcgcgacg tcgccggagc ggtcgagttc tggaccgacc ggctcgggtt 1860

ctcccgggac ttcgtggagg acgacttcgc cggtgtggtc cgggacgacg tgaccctgtt 1920

catcagcgcg gtccaggacc aggtggtgcc ggacaacacc ctggcctggg tgtgggtgcg 1980

cggcctggac gagctgtacg ccgagtggtc ggaggtcgtg tccacgaact tccgggacgc 2040

ctccgggccg gccatgaccg agatcggcga gcagccgtgg gggcgggagt tcgccctgcg 2100

cgacccggcc ggcaactgcg tgcacttcgt ggccgaggag caggactgac acgtccgacg 2160

gcggcccacg ggtcccaggc ctcggagatc cgtccccctt ttcctttgtc gatatcatgt 2220

aattagttat gtcacgctta cattcacgcc ctccccccac atccgctcta accgaaaagg 2280

aaggagttag acaacctgaa gtctaggtcc ctatttattt ttttatagtt atgttagtat 2340

taagaacgtt atttatattt caaatttttc ttttttttct gtacagacgc gtgtacgcat 2400

gtaacattat actgaaaacc ttgcttgaga aggttttggg acgctcgaag gctttaattt 2460

gcaagctgga gaccaacatg tgagcaaaag gccagcaaaa ggccaggaac cgtaaaaagg 2520

ccgcgttgct ggcgtttttc cataggctcc gcccccctga cgagcatcac aaaaatcgac 2580

gctcaagtca gaggtggcga aacccgacag gactataaag ataccaggcg tttccccctg 2640

gaagctccct cgtgcgctct cctgttccga ccctgccgct taccggatac ctgtccgcct 2700

ttctcccttc gggaagcgtg gcgctttctc aatgctcacg ctgtaggtat ctcagttcgg 2760

tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc ccccgttcag cccgaccgct 2820

gcgccttatc cggtaactat cgtcttgagt ccaacccggt aagacacgac ttatcgccac 2880

tggcagcagc cactggtaac aggattagca gagcgaggta tgtaggcggt gctacagagt 2940

tcttgaagtg gtggcctaac tacggctaca ctagaaggac agtatttggt atctgcgctc 3000

tgctgaagcc agttaccttc ggaaaaagag ttggtagctc ttgatccggc aaacaaacca 3060

ccgctggtag cggtggtttt tttgtttgca agcagcagat tacgcgcaga aaaaaaggat 3120

ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc tcagtggaac gaaaactcac 3180

gttaagggat tttggtcatg catgagatc 3209

<210> 3

<211> 33

<212> DNA

<213> null

<400> 3

ccgctcgaga aaagaggttt tggttgtaat ggt 33

<210> 4

<211> 36

<212> DNA

<213> null

<400> 4

gctctagagc cttatcatcg tcgtcataac acttac 36

<210> 5

<211> 22

<212> DNA

<213> null

<400> 5

gtccctattt caatcaattg aa 22

<210> 6

<211> 21

<212> DNA

<213> null

<400> 6

gcaaatggca ttctgacatc c 21

Claims (8)

1. A method for producing plectasin by using pichia pastoris is characterized by comprising the following steps:

(1) transforming plectasin gene, synthesizing and amplifying plectasin gene, the sequence is shown in SEQ ID NO. 1;

(2) constructing recombinant plasmid pGAPZ alpha B-Plec of the plectasin gene after expression and modification in the pichia pastoris, wherein the sequence of the recombinant plasmid pGAPZ alpha B-Plec is shown as SEQ ID NO. 2;

(3) transforming Pichia pastoris X33 with recombinant plasmid pGAPZ alpha B-Plec;

(4) screening and identifying recombinant yeast;

(5) and (5) obtaining antibacterial peptide plectasin bacterial liquid, precipitating and concentrating plectasin.

2. The method for producing plectasin using pichia pastoris, according to claim 1, wherein the method further comprises the following steps after step (5):

A. identifying the expression quantity of the plectasin gene by a real-time PCR method;

B. and measuring the diameters of inhibition zones of the plectasin on escherichia coli and staphylococcus aureus and identifying the inhibition effect of the plectasin.

3. The method for producing plectasin by using pichia pastoris, according to the claim 1, wherein the plectasin gene is modified in the step (1), and the process of synthesizing and amplifying the plectasin gene is as follows:

(a) synthesizing a modified plectasin gene sequence, and storing the modified plectasin gene sequence in PMD19 Simple plasmid, wherein the modified plectasin gene sequence is shown as SEQ ID NO. 1;

(b) the modified plectasin gene stored in PMD19 Simple plasmid was amplified with the following primers:

primer Plec F1: 5 'CCGCTCGAGAAAAGAGGTTTTGGTTGTAATGGT 3';

primer Plec R1: 5 'GCTCTAGAGCCTTATCATCGTCGTCATAACACTTAC 3';

(c) and (3) carrying out 2.0% agarose gel electrophoresis on the modified plectasin gene obtained by PCR amplification, and recovering and purifying a target fragment.

4. The method for producing plectasin by using pichia pastoris, according to claim 1, wherein the process for constructing the recombinant plasmid pGAPZ α B-Plec for expressing the modified plectasin gene in pichia pastoris, as shown in step (2), is as follows:

(a) carrying out enzyme digestion on Xho I and Xba I, recovering a purified modified plectasin gene obtained by PCR amplification, and recovering a Plec gene fragment after a product is subjected to 2.0% agarose gel electrophoresis;

(b) the pGAPZ alpha B vector is cut by XhoI and XbaI, and the pGAPZ alpha B vector fragment is recovered after the product is subjected to 1.2% agarose gel electrophoresis;

(c) t4 ligase, and obtaining pGAPZ alpha B-Plec vector after 2h of ligation at 16 ℃;

(d) transforming Escherichia coli DH5 alpha strain;

(e) and extracting plasmid DNA after transformation for enzyme digestion identification.

5. The method for producing plectasin by using pichia pastoris, according to claim 1, wherein the transformation of pichia pastoris X33 with the recombinant plasmid pGAPZ α B-Plec in step (3) is as follows:

(a) preparing pichia pastoris X33 competent cells;

1) inoculating Pichia pastoris X33 into a 50ml sterilized centrifuge tube containing 5ml YPD medium, culturing at 30 ℃ and 200rpm overnight;

2) taking 50 ul of overnight cultured Pichia pastoris and putting in 50ml YPD medium, culturing until OD600 is 1.3-1.5, and putting on ice for 10 min;

3) the cells were collected by centrifugation at 1500g for 5min at 4 ℃ and the cell pellet was resuspended in 50ml of pre-cooled sterile ddH 2O;

4) repeating the step 3;

5) centrifuging at 4 deg.C for 5min at 1500g to collect cells, and resuspending the cell pellet with pre-cooled 10ml sterilized 1M Sorbitol (Sorbitol);

6) the cells were harvested by centrifugation at 1500g for 5min at 4 ℃ and resuspended in a precooled 160. mu.l sterile 1M Sorbitol (Sorbitol) pellet, gently swirled and mixed, and dispensed into 1.5ml EP tubes, 80. mu.l per tube, and placed on ice until ready for use.

(b) Linearizing the recombinant plasmid pGAPZ alpha B-Plec, carrying out single restriction enzyme digestion on the recombinant plasmid pGAPZ alpha B-Plec by using Avr II, carrying out electrophoresis identification on a product by using 1.2% agarose gel, and then carrying out gel-cutting recovery;

(c) transforming the linearized plasmid pGAPZ alpha B-Plec into a Pichia pastoris X33 competent cell;

1) sucking 80 μ L yeast competent cells into 5-10 μ g linearized plasmid DNA, flicking with hand until mixing;

2) transferring to a precooled 2mm electric shock cup, and standing for 5min in an ice bath;

3) and wiping water outside the electric shock cup, placing the electric shock cup in an electric conversion instrument, and electrically shocking and converting the yeast. The transformation procedure was: 1.5KV, 25 muF and 200 omega, ensures the discharge time to be 4.5-4.9mS, and the concentration of DNA salt is too high when the discharge time is less than 4;

4) immediately adding 1mL of precooled 1M sorbitol, transferring to a 2mL centrifuge tube, and standing and culturing for 1h at 30 ℃;

5) adding 1mL YPD, culturing at 30 deg.C and 200rpm for 1 h;

6) centrifuging at 5000rpm for 5min, discarding part of supernatant, leaving 200 μ L of resuspended thallus, and coating on YPDS plate containing 100 μ g/mL;

7) culturing at 30 deg.C in dark for 2-3 days.

6. The method for producing plectasin using Pichia pastoris according to claim 1, wherein the process of screening and identifying the recombinant yeasts of step (4) is as follows:

(a) selecting single clone, streaking on plate for bacteria preservation, and mixing with 10 μ lddH2O to obtain 1.5 μ l;

(b) adding 1 μ l of 5U/μ l Lyticase, and incubating at 30 deg.C for 10 min;

(c) quickly freezing for 1min with liquid nitrogen to obtain 2.5 μ l Cell Lysate;

(d) adding PCR reaction system (without Taq enzyme), and heating at 95 deg.C for 5 min;

(e) adding 0.15 mul Taq enzyme to carry out PCR reaction;

(f) positive clones were identified by 1.2% agarose gel electrophoresis.

7. The method for producing plectasin by using pichia pastoris, according to claim 2, wherein the process of the step a is as follows:

1) culturing plectasin produced by pichia pastoris;

2) producing plectasin according to the production conditions of the saccharomyces cerevisiae and the sweet wormwood respectively; the production conditions of the saccharomyces cerevisiae are as follows: yeast complete culture medium YPD, pH value of 4.5-5.0, optimum growth temperature of 28-30 deg.C, transferring into liquid culture medium for culture when the solid culture dish is inverted to culture room for 2-3d, and using rotary or reciprocating shaking table at least every 200r/min to ensure sufficient ventilation; the production conditions of the sweet wormwood herb are as follows: culturing in MS culture medium at 25-26 deg.C under 1000-1500 lx illumination for 14h, and replacing the culture medium every 20 d;

3) RNA was extracted and the expression level of plectasin was determined.

8. The method for producing plectasin by using pichia pastoris, according to claim 2, wherein the process of the step B is as follows:

1) respectively culturing Escherichia coli and Staphylococcus aureus at 37 deg.C and 200rpm overnight;

2) respectively taking 200 mul of respective bacterial liquid of escherichia coli and staphylococcus aureus, uniformly coating the bacterial liquid on an LB (LB) flat plate without antibiotics, and lightly placing an oxford cup;

3) sucking 200 μ l of Pichia pastoris supernatant, adding into Oxford cup, adding ampicillin AMP 0.5mg/ml in positive control, adding myceliomycin produced by Saccharomyces cerevisiae and herba Artemisiae Annuae in parallel control, culturing at 37 deg.C in constant temperature incubator overnight, and observing antibacterial effect the next day.

Images