CN111534535B - Method for constructing ergothioneine producing strain - Google Patents

Abstract

The rhodotorula toruloides engineering bacteria can express exogenous egt1 enzyme, so that the capacity of producing ergothioneine is improved, the yield of the ergothioneine after fermentation is close to 1.5g/L, the genetic character of the engineering bacteria is stable, and the rhodotorula toruloides engineering bacteria have industrial application prospect.

Description

Method for constructing ergothioneine producing strain

Technical Field

The invention belongs to the field of genetic engineering, relates to a method for constructing ergothioneine-producing bacteria, and particularly relates to a method for constructing rhodotorula toruloides for producing ergothioneine.

Background

Ergothioneine (L-ergothinine, EGT) with the chemical name of 2-sulfhydryl histidine trimethyl inner salt has the following structural formula:

ergothioneine is the only natural 2-thioimidazole amino acid known to date. Ergothioneine has antioxidant, antiinflammatory, cell life cycle prolonging or anti-cell aging activity, and nerve cell generation improving effects. Meanwhile, the traditional Chinese medicine composition has better effects of protecting cells and resisting damage in various disease models including complications of Alzheimer disease, diabetes and the like, and has wide market application prospect.

At present, ergothioneine can be obtained by chemical synthesis, edible fungus extraction and microbial fermentation production. A variety of microorganisms have been demonstrated to have ergothioneine synthesis ability, including various microorganisms such as mycobacteria, Streptomyces, molds and yeasts. There are many patent technologies relating to the production of ergothioneine by microbial fermentation, such as CN102978121B, which discloses that edible mushroom Pleurotus nebrodensis catalyzes histidine substrate to produce ergothioneine, the substrate conversion rate can reach 70%, and the product yield is not reported; CN103184246A discloses that the yield of ergothioneine is 51mg/L after the fermentation of the large filamentous fungus Lepista sordida in a shake flask for 10 days; WO2017150304A1 discloses that the yield of ergothioneine is 900mg/L after fermentation of Streptomyces lividans for 7 days; WO2015180492A1 discloses Pleurotus ostreatus with an ergothioneine yield of 352mg/L when fermented in a 75L fermenter for 14 days; CN103734022 discloses that edible fungus Pleurotus ostreatus is fermented for 7-15 days, and the highest yield of ergothioneine reaches 143.7 mg/L; CN107250347 discloses genetically engineered aspergillus including Aspergillus oryzae, Aspergillus sojae and Aspergillus niger, which are genetically engineered to achieve a fermentation yield of 438 mg/L; e.coli is transformed by genetic engineering, the ergothioneine gene of the heterologous expression mycobacterium is clustered, and the yield of the ergothioneine is 640 mg/L; CN106661585 discloses that Escherichia coli is transformed by genetic engineering, the ergothioneine gene of the heterologously expressed mycobacteria is synthesized into clusters, and the yield of the ergothioneine is 12mg/L by fermentation of engineering bacteria; CN105296559A discloses Pleurotus ostreatus edible fungus, which is fermented for at least 6 days by adjusting the components of the multiple fermentation formula, and the highest yield of ergothioneine is 315.7 mg/L; CN201910664772.8A discloses that the yield of ergothioneine of the constructed genetically engineered bacterium reaches 568.4mg/L by using bacillus subtilis 168 as a host to express exogenous genes.

Literature (Takusagawa, S., Y.Satoh, I.Ohtsu and T.Dairi (2018). "Ergotheine production with Aspergillus oryzae".Bioscience,Biotechnology,and Biochemistry1-4.) discloses that Aspergillus oryzae has been genetically engineered to produce an ergothioneine yield of 231 mg/L. In addition, the highest yield of microbial fermentation ergothioneine is currently in the literature (Tanaka, n., y.kawano, y.satoh, t.dairi and i.ohtsu (2019). "Gram-scale fermentation production of ergothioneine drive by overproduction of cysteine in Escherichia coli"Scientific reports1895-1895), which utilizes genetic engineering means to heterologously express the synthesis of ergothioneine from mycobacteria in Escherichia coli, to study and obtain engineering bacteria, to culture in a fermentation tank, to induce and open a synthesis switch by adding IPTG, to continuously supplement precursor histidine, to ferment for 9 days as long as 216h, and finally to obtain the yield of 1.3g/L ergothioneine. But as a conditional pathogen and a transgenic strain, the product application prospect is worried about. The method is particularly important for solving the problem of high-efficiency production of ergothioneine by searching for microorganisms with natural sources and food source safety attributes and developing a proper production process. Literature (van der Hoek, s.a., b.darbani, k.e.zugaj, b.k.prabhala, m.b.bion, m.randelovic, j.b.medina, d.b.kell and i.borodina (2019). "Engineering the year&lt；em&gt；Saccharomyces cerevisiae&lt；/em&gt；for the production of L-(+)-ergothioneine."bioRxiv667592.) discloses that the Saccharomyces cerevisiae Saccharomyces cerevisiae expresses exogenous genes through genetic engineering, can synthesize ergothioneine, and has the yield of 630 mg/L.

Disclosure of Invention

In order to explore an industrial approach for producing ergothioneine by using food-source safe microorganisms through a fermentation method, the invention utilizes a genetic engineering technology to carry out genetic transformation on natural Rhodotorula toruloides (or Rhodotorula toruloides) so as to construct a strain with high yield of the ergothioneine. Specifically, the invention comprises the following technical scheme:

an EGT1 gene expression cassette selected from SEQ ID NO 1, SEQ ID NO 2 or SEQ ID NO 3.

Wherein SEQ ID NO. 1 comprises promoter pGPD, gene NcEGT1 coding for enzyme egt1 derived from Neurospora crassa and a Saccharomyces cerevisiae-derived CYC1t terminator, XbaI cleavage sites and PmeI cleavage sites are respectively added from head to tail for subsequent plasmid construction, and the sequence is named Pgpd-NcEGT1-ScCYC1 t;

2 contains promoter pGPD, coding gene CpEGT1 of enzyme egt1 derived from Claviceps purpurea of rye ergot bacteria and CYC1t terminator derived from saccharomyces cerevisiae, adds XbaI and PmeI restriction sites from head to tail respectively for subsequent plasmid construction, and is named Pgpd-CpEGT1-ScCYC1t in the text;

SEQ ID NO 3 contains promoter pGPD, gene RmEGT1 encoding enzyme egt1 derived from Rhodotorula mucilaginosa and Saccharomyces cerevisiae-derived CYC1t terminator, and XbaI and PmeI cleavage sites are added head and tail respectively for the subsequent plasmid construction, herein named Pgpd-RmEGT1-ScCYC1 t.

According to a second aspect of the present invention, there is provided an EGT1 gene expression plasmid obtained by cloning the above-described gene expression cassette on Puc57 plasmid. Corresponding to the names of the gene expression cassettes, the gene expression cassettes are named as Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1 t.

According to a third aspect of the present invention, there is provided an ergothioneine functional gene expression plasmid (or EGT1 gene transformation plasmid) constructed by a method comprising the steps of:

1) the EGT1 gene expression plasmid Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t are subjected to enzyme digestion by using restriction enzyme XbaI/PmeI, and 3.7kb, 3.6kb and 4.9kb fragments are respectively recovered by gel to obtain an EGT1 gene expression fragment;

2) carrying out enzyme digestion on plasmid pZPK-PGPD-Hyg-Tnos with the nucleotide sequence of SEQ ID NO. 4 by using restriction enzyme XbaI/PmeI, and carrying out gel recovery on an 8.3kb fragment to obtain a plasmid skeleton;

3) connecting the EGT1 gene expression fragment obtained in the step 1) with the plasmid skeleton obtained in the step 2) to obtain an ergothioneine functional gene expression plasmid. The ergothioneine functional gene expression plasmids are pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1 plasmids corresponding to the plasmids Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1 t.

The plasmid pZPK-PGPD-Hyg-Tnos described above is described in "Functional integration of multiple genes to the genes" FEMS Yeast Research 14(4):547-555 "(Lin, X., et al (2014)).

According to a fourth aspect of the present invention, there is provided a method of constructing an ergothioneine-producing bacterium, comprising the steps of: the above-mentioned ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) were transformed into a strain capable of producing ergothioneine to obtain a positive clone.

The strain can be Rhodotorula toruloides (or Rhodotorula toruloides).

In one embodiment, the above method is to transfect rhodotorula toruloides with Agrobacterium mediated transformation of ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) to obtain positive transformants.

For example, the method may specifically include the following steps:

A. transforming the ergothioneine functional gene expression plasmids (pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1) into agrobacterium-infected cells to obtain agrobacterium engineering bacteria; preferably the agrobacterium is agrobacterium tumefaciens;

B. the liquid phase of the agrobacterium engineering bacteria is mixed with the rhodotorula toruloides, resistance screening is carried out, and positive transformants are obtained through phenotype and PCR verification, so that agrobacterium-mediated transfection of rhodotorula toruloides is realized.

According to a fifth aspect of the present invention, there is provided an ergothioneine-producing bacterium obtained by the method of constructing the ergothioneine-producing bacterium.

In one embodiment, the ergothioneine-producing bacteria is Rhodotorula toruloides 2.1389, preferably Rhodotorula toruloides 2.1389.

The ergothioneine-producing bacteria can be used for producing ergothioneine by fermentation.

The invention carries out genetic modification on natural rhodotorula toruloides by means of genetic engineering to obtain the ergothioneine high-yield strain with food source safety. Fermentation verifies that the yield of the ergothioneine can reach about 1.5g/L, and the constructed engineering strain has relatively stable genetic characters after multiple passages and has better industrial application potential.

Drawings

FIG. 1 is a map structure diagram of plasmid pZPK-PGPD-Hyg-Tnos constructed by the invention.

Detailed Description

egt1 is a multifunctional enzyme that catalyzes the formation of S- (hercyn-2-yl) -L-cysteine S-oxide (S- (hercyn-2-yl) -L-cysteine S-oxide), the ergothioneine precursor, by catalyzing the substrate histidine. It was found that the ergothioneine production could be promoted by expressing the egt1 gene in a strain producing ergothioneine.

For the sake of simplicity of description herein, a protein such as egt1 will sometimes be used in combination with its encoding gene (DNA) name, and one skilled in the art will understand that they will represent different substances at different instances of description. Their meaning will be readily understood by those skilled in the art based on the context and context. For example, for egt1, when used to describe an enzyme function or class, refers to a protein; when described as a gene, refers to the gene encoding the enzyme.

We screened three microbial sources of egt1 enzymes, respectively from Neurospora crassa, Claviceps purpurea and Rhodotorula mucilaginosa, encoding genes NcEGT1, CpEGT1 and RmEGT 1.

The gene NcEGT1 can obtain the following base sequences through codon optimization according to the NCBI database, Genbank access: XP-956324.3 sequence:

atgccatccgctgagtcgatgaccccgtcctccgctttgggccagctcaaagccaccggccagcacgtcctctcgaagctccagcagcaaacttcgaacgccgacatcatcgacattcgccgcgtcgctgttgagatcaacctcaagaccgagatcacctcgatgttcagaccgaaggacggtccgagacaactcccgactttgctcttgtacaatgagcgcggcctccaattgtttgagcgcattacctatttggaggagtactacctcactaatgatgagattaagatcctcaccaagcacgctaccgaaatggcctcgtttatcccgtccggcgccatgatcatcgagctcggttcgggtaacttgcgcaaggttaacttgctcctcgaggccctcgataacgctggtaaggccatcgactactacgctctcgacttgtcgcgcgaggaattggagcgcactctcgctcaagtcccgtcgtacaagcacgttaagtgccacggtctcctcggcacctacgacgatggccgcgactggctcaaggccccagagaacatcaacaaacagaagtgcatcctccacttgggctcctccattggcaactttaaccgctccgacgctgccacttttttgaagggcttcactgacgtcctcggtccgaacgacaaaatgctcatcggtgtcgatgcttgcaatgacccggcccgcgtctaccatgcctacaacgacaaagtcggcatcacccacgaattcatcttgaacggcttgcgcaacgccaacgagattatcggcgagaccgcctttatcgaaggcgactggagagtcatcggcgaatacgtctacgacgaggagggtggtcgccaccaagccttctatgccccaactcgcgatactatggtcatgggcgagctcatcagatcccacgatcgcatccagatcgagcagtccctcaagtactccaaggaggagtccgagcgcctctggtcgactgctggtctcgaacaagtctccgaatggacctacggcaacgaatacggtctccatttgctcgccaaatccagaatgtcgttctccctcatcccgtcggtctatgcccgctcggctctcccaactctcgacgattgggaagccttgtgggccacttgggacgtcgtcaccagacagatgttgccgcaagaggaactcctcgagaagccgatcaagctccgcaacgcttgcatcttctacctcggccacattccaaccttcctcgacatccagttgaccaagaccaccaaacaagccccgtccgagccagctcacttctgcaagatcttcgagcgcggtatcgacccggatgtcgataatccggagctctgccacgctcactccgagatcccggacgagtggccaccagtcgaggagatcctcacctatcaagagaccgttcgctcgcgcttgcgcggtttgtacgcccacggtattgctaacatcccgcgcaacgttggtagagctatttgggtcggtttcgagcacgagctcatgcacatcgagaccctcctctacatgatgttgcagtcggacaagaccctcattccgacccatattccacgcccggacttcgataagttggcccgcaaggctgaatcggagagagtcccgaaccagtggttcaagatcccggcccaagagatcactatcggtctcgacgacccggaggacggttccgacatcaataaacactacggctgggataacgagaagccaccgcgcagagttcaagtcgccgcctttcaagcccaaggtagaccaatcactaacgaggagtacgcccaatacttgctcgagaagaacatcgacaaactcccagcctcgtgggctcgcttggacaatgagaacatctccaacggcaccaccaattccgtttccggtcaccactccaaccgcacctccaagcagcagctcccgtcctcgttcttggagaaaaccgccgtcagaaccgtttatggtttggttccactcaagcacgccctcgactggccggtcttcgcttcgtatgacgaactcgctggttgcgccgcttacatgggcggtcgcatcccgactttcgaagagacccgctccatctatgcctatgccgacgccctcaagaaaaagaaggaagctgaacgccagttgggtcgcaccgtcccagctgttaacgcccacctcaccaataacggcgttgaaatcaccccgccgtcgtcgccgtcgtccgaaaccccggccgaatcctcctccccgtcggattcgaacaccactctcatcaccactgaggacttgttctcggacctcgacggcgccaacgtcggcttccataactggcacccgatgccaatcacctcgaagggtaacactctcgtcggtcaaggtgagctcggcggtgtctgggaatggacctcgtcggtcctccgcaagtgggagggcttcgagccgatggagctctatccgggctacactgctgacttcttcgacgaaaagcacaatatcgtcctcggcggttcgtgggctacccacccaagaatcgccggccgcaagtcctttgtcaactggtaccagcgcaactacccgtatgcttgggtcggcgccagagttgtcagagacctctaa；

CpEGT1 sequence reference van der Hoek, S.A., et al (2019). "Engineering the yeast Saccharomyces cerevisiae for the production of L- (+) -Ergothioeine." bioRxiv:667592. it is

atgactgccgttaagcaaattcctgaaagaaaggtgttgatagattcaaatcataagtctccatcaaaaccgggtaaacatcctaattctgtcattgatatcaggtctaataaggacgatttaaatttacgtcatgccctagtctcatcttttaatccacacgatggaaaacctaggtggctacctactatgttattgtacgacgaaaaaggtttacaattgtttgaagatataacttacttagatgagtattatttgactggctacgaaattgaattattgaagaaacattcagcagaaattgcagctgctattcctgatggttctatggtcatcgaattgggctctggtaatttgagaaagatctgtttgttgttacaagcctttgaggattcacataagtctatcgactactatgcattagatttatcacaaaaggaattagaaagaactttgagccatgttcctgactttaaatatgtctcttgtcatggactgctaggtacatatgatgatggtgttacatggttgaaacaaccaggtatagtcaataagactaagtgcatcatccatcttggttcgtctattgggaattttcatagaaatgaagctgccgatttcctgcagacatttgctgatgtaatgaaaccagacgactctatggttattggtcttgattcatgcggtaatccagagatgtctcgcattcaaagattcattttgaacggcttatccaatgctaatagcgtttatggcaaggaaatattctatgttccagattggagagtaattggtgaatatgtttacgatgatgaaggtggcagacaccaggcttttatttcacctttgaaagaagtcactgctttagggtctgttattaaagcccatgaaagaattaaaattgaacaatctttgaagtactctaaggcctcagctgacgatttatggagaaatgctggctttcgagaaactcaaacttggacgagaaacggtgaatatggactacatatgttgcaaagagctgatccgcccttctctaaggctccttctttgtatgcagctaatactcttccctctctttctgattggagagcattgtggtgtgcctgggatattgtcactagagctatgttgccacaacaggaattgactgagaaacctatagagttaagacatgcctacatcttttaccttggtcatattcctaccttcttagacatccagttaaccaaaacatcagcatgggctccaacctctccagtttcttatcatgccattttcgagcgcggcattgatcccgatgttgataacccagaaaagtgtcatgatcactcagagattccagatgaatggccaccagtcgaagaaattattgcttatcaagatagggtgcgtgttagattgacagaactgtataaacagggtgtgcacacaattacaagaaaggctgctagagctatctgggtttcatttgaacatgaagctatgcatttggaaaccttgttgtatatgatgctacaaagtgataaagtgttgccacctccacacactggcgttccagactttgaaagaatggcaactaaggctttcgaagctcgtacgcaaaatatgtggttcgaaattccagaacagactattagtcttggaacagatgatccagaagatggggatgaagacgttcattttggatgggacaacgaaaaaccagttagaagagttaaggttcacgcgttgcaagctcaaggaagaccaattacaaatgaggaatacgcattatatatttaccataccaactcttctaaactgccagcatcttggagttcgtccccttcatcttctctgtctaacggcgtgtctcatcccagctcccataacaagcatattccaactgatttgcctcattccttcttgcaaggtaagtttgttagaaccgtatatggtttgatacctttatctttggcgttggattggcctgttcaagcttcttatgatgaattagctgactgtgcattatggatgggtggaagaattccaaccttagaggaagccagatcaatctatgcctttgttgaatctaaaacgcaaatagcaacaggtaacacattggtcaagaaagttcctgctgttaatggacacttggttaataacggagttgaggaaactccaccacatgaatcctcttcggcagttgagaattctttattcatcgacttagccggtttgaacgtgggttttaaaagttggaatcctgaacctgttacatcttctggtacgtctttggctggacaatcctctatgggtggtgtatgggagtggacctcttctgttttaagaccacatgaagggttccacccaatggagttgtatcctggttatacagccgatttctttgatgaaaaacataatattgttctcggaggatcatgggctactcatccaagaatagcgggtagaaaaagctttgttaactggtatcaaagaaactatccgtacgcctgggctggtgccagacttgttaaagatgcttga；

RmEGT1, using the NcEGT1 protein sequence, in the NCBI database blastp tool, to define the Rhodotorula mucilaginosa Rhodotorula muscilaginosa genome, and performing sequence alignment to obtain the following egt1 sequence:

atgccagacgccgcctcaaccgccgctgttcagcctccgcccttcatcctcgacctgcggaaccgctcgccgccgacctcgccgagccaggtcgcctccgatgccgctcgctcgtcctctccgtcgtccctgggcgaatcggagggcactacctcgaccaatgctacccccgaggccccctccgatccgctccgcgagcagatcatcgccggcttgatcggatcgcccaagcccaccgttccaggcaagacggaaaaggatcgcgcgtatgcgtaccgccgcacgatcccgaccatgacactgtacagcgagcgtggcctgtctatctacgaggaaatcaccaagaccaaggtatgctcggccctttccgtccgctttggttcacgaggggccaatgctttctcagcaggccctcgcgcgccgtcggccccacttgccctacggcgtgcgggctctccttcggactaggtggctggcaagcatcccctttgcagacgcactgacctcgtctttgcgtttcgattcaggcctactacccattcgaagccgaaaaggagattctcgaaaagtatggagacgaaattgcctgccgcatgtttggactgccgtcggccttgctcgtcccggacgacgtagtccgtggcaaagacgaccagtacgaaccctctccggcttcaaacatcggcgcgaagaaggagaagtggtgagccggcgttcggaactataacggctcctcatccgcggtacaggcgctgacgcactgcttacaggggcgacgtcgctgtcggtctccacaactacggtgtcaacggctctgcgaacctcgcgcagaacaatgtcgtcgccacgcagggcctcgcggtcgagcttggctcgggctcgctcgacaagacccgtcatctcctccgctctatggccaagctgttgcagtctcgcgacgagggcagctgcccggtctctcctctgcgctccattgactacaaagcagtgcgtttggcgaaacctccgcgagtataggaaatcaatactgacctcccacgtctgccgctgaacagctcgaccttgaagcggcgtcgctctactcgacactgtcctcgcttgcatcggtcgaaggcgattgcgtcacgacggcggtcgacggacagccaaacgcgacgaaacgccgcgtttcggtctcgggtcttcacgccacctacgacgagggcctcgccttcttgaaggcgcagaacgatgctggcagcccgtcgagcgtcttctcagacctccccgacttgcccacgagtccaaagtcggttccgactaccttgtccagtgtcctggaggacgacagcgacgaaggcgagaccgctcaagcgtctcgcggcgagaacgctgcggaacgccgcgcgacttcgatcatgtggctcggttcctcgtgcggcaactacacccgcgaggaagcggtgcagttcctccgcaacatcgagctgcgcgagggcgataccatgctgatcggcatcgacggctgcgcggacgaacctcgtatcgagactgcctacaacgacccgcaggtgagtctgatgtcctgccaaactgaccagtatgagctgctctgacccttgtttgccgctgatcctccagggcgtcacccgcgcgttcattctcgagggcatcgatgtcgcaggccgcaccctcggcggagacgcggccgaagtgctgcagcagaagaactttgactatgtcaaccgctggaacgccgagctcggaaggcacgaggtgagctgccttccgctgtccagaggagagcagcctgagttgcaccggcagccctgttctgacccgtccccgcgacaccctcgcaggcttacgtccgcgccaacaaagatctcacaatcccgatcacgggcgcagacgacgtcaccgaggtcaagctcgaagagggagagtaagtcccgcacttttgcgcgttgagccggtgccatcacaagagcccttcctgacgtttcctctcgcaccaggctcctcaacattgaagtctcttacaagtacacctatgcggaggcggcggcgctcttccacttggcgggcttccggctcatccagcactggaccgactcgtcgcgctcgcattacctctacctggtcgaaaagccccgcatgtggttcccgtcgacgaccgagagcgctgccaagatgctcggtatcgaggtcgagcccgaggagaaggagaccgactacggtgtcccgactctggaaaagtgggaagaaatgtggcgggcgtgggacggcttgatggtgaggatgccctcgtcggcgaaggaattccgcaagcgatgagtggacgctcacctgaaaccgcttcttctaccagctcgagatcatccccaagtcgctgcacttccagaagccgatcccgctccgccacatcccgctcttctacgtcgggcacatacccgctttccgggatattcacctcgcgaggtacttcaacgagccgctgaccgaaccggcaaagtttgccgacatcttcgagcgcggaatcgatccctgtgtcgacgaccccgagaccgtcacgcactggcactcggaagtcccgaaggacgaagcgtgctggccttctctccaggagattacggcgtacgaagcgtccgttcgcgatcgcgtccgcaaggtgtacgccgaacacgagggcaagtggacgaccaagctcgcccgtgtgctgatgatgacttttgagcacgagatgtgcgtccttcctgcttcgggctgattcggtacccatgtcatcactcgactcactcatcctcttgggtccccttgggccccacaggatgcactgggagacctccgtctacatctgtctccaagccgcgagctcgctcaaccttccgccgggaacggcgattcctgatttccgctcgctggcacgtcaagcaaaacgtgatctgcatcagaacggcggcggacagcgactctccttccccgctcaggaggtcacagtcggtcacgacgacgacgataccatcgacgaccagacgccgtttgaccctgcccgagaatacggctgggatgtcgagcaccctcgccgccagcttcgcgtcgacgcattcgagatcgaggtcctcccgatctcgaacggagagtacaaaacctggcttaccgagacgcagcaactctcgaacaaggcgctcatcccgtcgagctggacggacgagactggcgaactctgcgtgaaaacgttgttcggcttggtccccctcactctcgccgaggagtggcccgtggctgcgagcgcggaacagctcgagaagtttgccaaggtgggtatcctttgctcgagcaagaatagggaccgaagaagactgactcgtaactttctgcactcgacaggccaaaggaggacgcttgccgacgttcggcgagctgtcggcgttcaaccagcacaaccctagctctacgcctctcgccaacatcggcctcgcaaacctgcatccggttgccccttcggtacccgggaaagcgcgtgacggcagccagctcccgatcaccgacggaggcctgtggcaatggacctcgacggtcctcgagccctgggctggttacagcggatcggttctttaccctggttactccagtgacgtgagtcgagtgcgactgtgaatgaagtgagatggggcaactgacattaagcgccctctcttccctctagttcttcgacggcaaacaccacatcgtgctgggcgcgagctacgcgagtcctcgtcgcttggcccgcccttctttcctgaactggtaccagaagaactgtgcgtttctggcgctcttccaaggaccgttgccgccagatccccgtactgacatgctctgccgcagaccctttcatgctcggcggcgctcgtgtggcgtacgatgtgtga。

in the engineered bacteria constructed by the invention, the egt1 gene exists in the form of a gene expression cassette. The terms "egt 1 gene expression cassette", "gene expression cassette" and "expression cassette" are used herein in the same sense and are used interchangeably.

Using NcEGT1, CpEGT1 and RmEGT1 as the target genes, three egt1 gene expression cassettes, Pgpd-NcEGT1-ScCYC1t (SEQ ID NO:1), Pgpd-CpEGT1-ScCYC1t (SEQ ID NO:2) and Pgpd-RmEGT1-ScCYC1t (SEQ ID NO:3) were constructed. XbaI and PmeI restriction sites are respectively designed and added at the head and the tail of the three expression cassettes for subsequent plasmid construction.

The element sequence of the gene expression cassette is sent to Jinzhi biotechnology company of Suzhou to be synthesized, and plasmids of Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t are respectively obtained and are used for subsequent restriction enzyme ligation cloning construction.

The ability of Rhodotorula toruloides to produce ergothioneine is increased by expressing the egt1 gene in a suitable host such as certain Rhodotorula toruloides. When the constructed rhodotorula toruloides engineering bacteria are used for producing the ergothioneine through fermentation, a large amount of the ergothioneine can be produced without adding histidine betaine, histidine or cysteine and the like into a culture solution.

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing herein were performed by the national King Only Biotech, Suzhou.

The molecular biological experiments herein include plasmid construction, enzyme digestion, competent cell preparation, transformation, etc., which are mainly performed with reference to molecular cloning, a guide to experiments (third edition), J. SammBruk, D.W. Lassel (America), Huangpetang, et al, scientific Press, Beijing, 2002). For example, the methods for competent cell transformation and competent cell preparation are described in Chapter 1, 96 of molecular cloning, A laboratory Manual (third edition). The specific experimental conditions can be determined by simple experiments if necessary.

Main medium and solution:

LB culture medium: 5g/L yeast extract, 10g/L tryptone, 10g/L sodium chloride. (20 g/L agar powder was additionally added to LB solid medium.)

YEB Medium: beef extract 5g/L, yeast extract 1g/L, peptone 5g/L, sucrose 5g/L, MgSO₄·7H₂O0.5g/L, pH 7.4. (YEB 15g/L agar powder in solid culture medium.)

YPD medium: 1 wt% of yeast extract, 2 wt% of peptone and 2 wt% of glucose.

Agrobacterium-mediated yeast transformation solution and medium:

MM solution: 3.625g KH₂PO₄，5.125g K₂HPO₄，1.250g MgSO₄·7H₂O，0.375g NaCl，0.165g CaCl₂·2H₂O，0.0062g FeSO₄·7H₂O，1.250g(NH₄)₂SO₄Dissolved in ddH₂Fixing the volume in O to 1L;

m-100 trace element solution: 30mg H₃BO₃，70mg MnCl₂·4H₂O，200mg ZnCl₂，20mg Na₂MoO₄·2H₂O，50mg FeCl₃·6H₂O，200mg CuSO₄·5H₂O, dissolved in ddH₂And (4) adding water to 500ml in O.

M-100 salt solution: 16g KH₂PO₄，4g Na₂SO₄，8g KCl，2g MgSO₄·7H₂O，1g CaCl₂8ml of M-100 trace element solution dissolved in ddH₂The volume in O is up to 1L.

IM liquid medium: 80ml MM solution, 0.36g glucose, 1ml glycerol, dissolved in ddH₂And (4) keeping the volume to 200ml in O. Sterilizing, cooling to about 50 deg.C, and adding the following components: 8ml of 1M MES, 4ml of 10mM AS, the final concentrations of MES and AS being 40mM and 200. mu.M, respectively.

IM solid medium: 160ml of MM salt solution, 0.36g of glucose, 2ml of glycerol, dissolved in ddH₂And (4) adding 6g of agar powder into the mixture until the volume is up to 400 ml. Sterilizing, cooling to about 50 deg.C, and adding the following components: 16ml of 1M MES, 8ml of 10mM AS, with final concentrations of MES and AS of 40mM and 200. mu.M, respectively.

Ergothioneine detection materials and methods:

ergothioneine standards were purchased from Shanghai chemical Co., Ltd, China medicine (group).

The HPLC detection conditions are as follows: agilent high performance liquid chromatograph 1260 definition II, Etilit ODS-BP chromatographic column, column temperature 40 ℃, mobile phase: a, ammonium dihydrogen phosphate (preparation method, 1.1503g of ammonium dihydrogen phosphate and 400mL of purified water are weighed, the pH value is adjusted to 5.0 by ammonia water, and then 100mL of purified water is added); b: and (3) acetonitrile. And the A and B are 99:1, the flow rate is 1mg/min, the sample injection amount is 10 mu l, and the detection wavelength is 258 nm.

And (3) detecting extracellular products: the fermentation broth was centrifuged at 10000rpm for 4min, the supernatant was collected and filtered through a 2 μm filter, and the sample was subjected to HPLC.

And (3) detecting an intracellular product: centrifuging the zymophyte liquid at 10000rpm for 4min, collecting thalli, weighing 100mg of wet thalli, transferring the thalli to a clean 1.5ml centrifuge tube, adding 1ml of sterile water, whirling, suspending the thalli, then carrying out warm bath at 90 ℃ for 30min, finishing the warm bath, centrifuging at 12000rpm for 10min, taking supernatant, filtering by using a 2 mu m filter, and then carrying out HPLC detection on a sample.

Example 1: original strain screening

According to the retrieved literature reports, food-safe microorganisms capable of producing ergothioneine are screened. A plurality of rhodotorula toruloides strains are purchased from the China general microbiological culture collection center for preliminary screening comparison, and the ergothioneine yield of each strain is evaluated.

And inoculating the purchased strains in a yeast culture medium, and performing shake flask fermentation. The yeast seed culture medium comprises the following components: 20g/L of glucose, 10g/L of yeast powder and 20g/L of peptone.

The Glycerin seeds are inoculated with a seed culture medium and cultured at 30 ℃ and 250rpm for 17h, and can be transferred when the OD600 is more than 16.

Yeast shake flask fermentation medium: 0.5g/L of ammonium sulfate, 10g/L of yeast powder, 10g/L of peptone, 3g/L of glutamic acid, 0.6mg/L of biotin, 0.1g/L of thiamine hydrochloride, 5g/L of magnesium sulfate, 0.278g/L of ferrous sulfate heptahydrate, 0.085g/L of manganese sulfate monohydrate, 25g/L of glucose and 2.5g/L of potassium dihydrogen phosphate.

And (3) shaking flask fermentation: a250 ml triangular flask was used, the liquid loading was 50ml, the inoculation rate was 2%, and the cells were cultured for 72 hours at 30 ℃ on a shaker at 250 rpm.

After shake flask fermentation, intracellular and extracellular ergothioneine yields were assessed after fermentation by each strain. The results are shown in Table 1.

TABLE 1 comparison of the ability of Rhodotorula toruloides to ferment ergothioneine

Rhodotorula toruloides strain	Total yield mg/L
		Rhodotorula toruloides 2.2424	120
Rhodotorula toruloides 2.1003	230
		Rhodotorula toruloides 2.1609	187
Rhodotorula toruloides 2.1389	385
		Rhodotorula toruloides 2.499	281
Rhodotorula toruloides 2.278	80
		Rhodotorula toruloides 2.107	34

As can be seen from Table 1, the ability of different Rhodotorula toruloides to produce ergothioneine differed, with Rhodotorula toruloides 2.1389 being optimal. In the following examples, the strain was used as a genetically modified starter.

Example 2: construction of plasmid pZPK-PGPD-Hyg-Tnos

The following references can be made to the genetic manipulation of Rhodotorula toruloides: lin, X., et al (2014), "Functional integration of multiple genes of the multiphase Yeast extract," FEMS Yeast Research 14(4):547-555.

Referring to the literature, the complete sequence of plasmid pZPK-PGPD-Hyg-Tnos is determined according to the published sequence, and synthesized by Jinzhi Biotech Ltd, Suzhou to obtain plasmid pZPK-PGPD-Hyg-Tnos (SH205), the structure of which is shown in FIG. 1, and the base sequence of which is SEQ ID NO:4, 8378 bp.

Taking the plasmid as a plasmid skeleton, and carrying out subsequent plasmid construction.

Example 3: construction of EGT1 Gene expression cassette and expression plasmid

For target genes NcEGT1, CpEGT1 and RmEGT1 derived from three microorganisms, pGPD is designed as a promoter to control the expression of the functional gene; the CYC1t terminator from saccharomyces cerevisiae is used for controlling the expression termination of the functional gene; and XbaI enzyme cutting sites (tctaga) and PmeI enzyme cutting sites (gtttaaac) are designed and added at the head and the tail respectively so as to be used for the subsequent plasmid construction. The designed gene expression cassettes were Pgpd-NcEGT1-ScCYC1t (i.e., SEQ ID NO:1), Pgpd-CpEGT1-ScCYC1t (i.e., SEQ ID NO:2) and Pgpd-RmEGT1-ScCYC1t (i.e., SEQ ID NO:3)

The designed gene expression cassette sequence is sent to Suzhou Jinzhi biotechnology company for synthesis, and the gene expression cassette is cloned on Puc57 plasmid to obtain EGT1 gene expression plasmid for subsequent restriction enzyme ligation cloning construction. Corresponding to the names of the gene expression cassettes, the gene expression cassettes are named as Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1 t.

The Pgpd-NcEGT1-ScCYC1t (i.e., SEQ ID NO:1), Pgpd-CpEGT1-ScCYC1t (i.e., SEQ ID NO:2) and Pgpd-RmEGT1-ScCYC1t (i.e., SEQ ID NO:3) plasmids were obtained, respectively.

Example 4: construction of expression plasmid for ergothioneine functional gene

4.1 after receiving the above-mentioned three plasmids Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t, they were digested with XbaI/PmeI restriction enzymes, respectively, and the 3.7kb, 3.6kb and 4.9kb fragments were gel-recovered, respectively.

4.2 backbone plasmid pZPK-PGPD-Hyg-Tnos was digested with XbaI/PmeI, and 8.3kb fragment was recovered. The fragment is respectively connected with enzyme digestion fragments of the 3 gene expression cassettes to obtain three ergothioneine functional gene expression plasmids (also called EGT1 gene transformation plasmids) pZPK-NcEGT1, p ZPK-CpEGT1 and p ZPK-RmEGT1 which are used for transforming a host. The connection method comprises the following steps: using T4 ligase system purchased from NEB company, adding the vector and gene expression cassette into T4 ligase system according to the molar ratio of 1:5, connecting at 16 ℃ for 2h, transforming the ligation product into DH5a escherichia coli, performing clone screening by using kanamycin, and obtaining the three ergothioneine functional gene expression plasmids (also called EGT1 gene transformation plasmid) pZPK-NcEGT1, p ZPK-CpEGT1 and p ZPK-RmEGT1 after colony PCR, plasmid digestion and plasmid sequencing verification.

Example 5: preparation of Agrobacterium tumefaciens engineering bacteria

5.1 preparation of Agrobacterium tumefaciens Strain AGL-1 competence: a single colony of the strain AGL-1 (biosciences, Shanghai Kanglang, Ltd.) was picked from a YEB plate containing 50. mu.g/ml carbenicillin (Carb) into 5ml of YEB liquid medium (containing 50. mu.g/ml Carb), and shake-cultured overnight at 200rpm and 28 ℃. 2ml of the suspension was transferred to 50ml of YEB (containing 50. mu.g/ml Carb), and shake-cultured at 28 ℃ and 200rpm until the OD absorbance at 600nm of the suspension became about 0.5. Taking out bacterial liquid, ice-cooling for 30min, centrifuging at 8000rpm for 5min at 4 deg.C, and collecting thallus. With 10ml ddH₂And washing once. The cells were again collected by centrifugation at 8000rpm for 5min at 4 ℃. Discarding the supernatant, adding 2ml of 10% sterile glycerol, and subpackaging 100 μ l each to obtain the Agrobacterium tumefaciens strain AGL-1 competence.

5.2 transformation of the plasmid into Agrobacterium tumefaciens AGL-1: the Agrobacterium is sensitized and placed on ice for 10 min. 1-2. mu.g of the EGT1 gene transformation plasmids pZPK-NcEGT1, pZPK-CpEGT1 and pZPK-RmEGT1 constructed in example 4 were added, gently and uniformly blown by a pipette, transferred to a 0.2cm sterile electric cuvette, placed on ice for 5min, shocked at 2.5kv, added with 1ml of liquid YEB, and cultured at 28 ℃ and 150rpm for 3 h. The cells were collected by centrifugation at 8000rpm for 2 min. After removing the supernatant, the cells were resuspended in 100. mu.l of liquid YEB, spread evenly on YEB plates (containing 50. mu.g/ml Carb and 50. mu.g/ml Kan), and cultured at 28 ℃ for 2-3 days. Transformants were picked and shaken with 3ml of liquid YEB (containing 50. mu.g/ml Carb and 50. mu.g/ml Kan) at 28 ℃ and 220rpm overnight. And (3) verifying a transformant by PCR, and storing a bacterial liquid of the transformant at-80 ℃ (containing 15% of glycerol) to obtain agrobacterium engineering bacteria AGL-1/pZPK-NcEGT1, AGL-1/pZPK-CpEGT1 and AGL-1/pZPK-RmEGT 1.

Example 6: agrobacterium mediated transfection rhodotorula toruloides

6.1 culturing the agrobacterium engineering bacteria: single colonies of the engineered Agrobacterium AGL-1/pZPK-NcEGT1, AGL-1/pZPK-CpEGT1 and AGL-1/pZPK-RmEGT1 constructed in example 5 were inoculated into 4-5ml of LB medium (containing antibiotics Amp and Kan) and cultured overnight at 30 ℃. Determination of OD value, generally required to reach OD₆₀₀The dilution factor was calculated at 4.2 or more, and the OD was 0.6 when the dilution factor was calculated as a factor (according to the calculation). Taking a certain amount of bacterial liquid in a 1.5ml centrifuge tube, centrifuging at 12000rpm for 30s, settling the bacterial cells, adding sterilized distilled water for suspension, and centrifuging again to settle the bottom. Finally, the bacteria were suspended to an OD of 0.6 using the calculated volume of water. And (5) standby.

6.2 Rhodotorula toruloides host culture: rhodotorula toruloides 2.1389 was inoculated in 4-5ml of YPD medium for overnight culture for about 15-16 h. Determination of OD₆₀₀Value, calculate dilution fold, should dilute (calculated as a real) fold, dilute OD to 0.6. According to the requirement, taking a certain amount of bacterial liquid in a 1.5ml centrifuge tube, centrifuging at 13000rpm for 30s, settling the bacterial cells, adding sterilized distilled water for suspension, and centrifuging again for settling. Finally, the bacteria were suspended to an OD of 0.6 using the calculated volume of water. And (5) standby.

6.3 plating transfection: mixing the diluted agrobacterium engineering bacteria liquid and yeast bacteria liquid, coating a flat plate: 100ul of each was mixed and spread on an IM plate, and cultured at 24 ℃ for 2-3 days.

6.4 resistance selection: colonies obtained on the IM plates were scraped off using YPD liquid medium, and the bacterial suspension was spread on YPD + hygromycin-resistant plates and cultured at 30 ℃ for 4 days. After a transformant appears, selecting a clone, carrying out streak subculture on a YPD + hygromycin resistance plate, carrying out continuous passage for 3 generations, carrying out genome extraction on the clone with stable continuous passage resistance phenotype, carrying out PCR verification on a specific target sequence, and carrying out phenotype verification to obtain a positive transformant.

Example 7: engineering bacteria shake flask fermentation investigation

The positive transformants obtained in example 6 were investigated by shake flask fermentation according to the procedure of example 1. After shake flask fermentation, intracellular and extracellular ergothioneine yields after fermentation of each engineering bacterium were evaluated. The results are shown in Table 2.

TABLE 2 comparison of the ability of different Rhodotorula toruloides engineering bacteria to produce ergothioneine by shake flask fermentation

As can be seen from Table 2, the ability of three different microbially derived EGT1 genes expressed in Rhodotorula toruloides 2.1389 of the same Rhodotorula toruloides was different in their ability to promote ergothioneine production, with NcEGT1 being the most preferred gene, and the expression of different microbially derived EGT1 genes increased ergothioneine production.

Example 8: fermentation investigation of engineering bacteria fermentation tank

On a rhodotorula torvus streak plate, using an inoculating loop to take a test tube of a single colony inoculum culture medium (20 g/L of glucose, 10g/L of peptone, 5g/L of yeast extract, pH7.0), and culturing at 30 ℃ and 230rpm for overnight in a liquid containing 4 ml; the seed was prepared by inoculating the seed culture medium in an amount of 5% v/v in a shake flask, 50ml in a 250ml Erlenmeyer flask, shaking at 30 ℃ and 230rpm overnight. The seed solution was transferred to a fermenter medium (glucose 60g/L, peptone 10g/L, corn steep liquor 10g/L, ferrous sulfate 10mg/L, pH6.5) at an inoculation ratio of 10% v/v.

Stirring speed of a fermentation tank is 400-800 rpm, dissolved oxygen coupling is realized, dissolved oxygen is controlled to be 40%, the temperature is 30 ℃, air flow is 3L/min, ammonia water and histidine are supplemented, pH is controlled to be 6.5, and fermentation can be continued for 120 h. Meanwhile, 500g/L glucose solution is fed at the rate of 20ml/h within 12-24 h; 24h-72h, feeding 500g/L glucose solution at the rate of 10 ml/h; adding 500g/L glucose solution at the rate of 3-5ml/h for 72-96 h; and (3) 24-96h, and feeding 100g/L of corn steep liquor solution at the rate of 5-8 ml/h. And after the fermentation is finished, evaluating the yield of intracellular and extracellular ergothioneine after the fermentation of each engineering bacterium. The results are shown in Table 3.

TABLE 3 comparison of the ability of fermentation tanks of different Rhodotorula toruloides for ergothioneine production

As can be seen from Table 3, similar to the shake flask fermentation, the ability of promoting the ergothioneine production by expressing three different microorganism-derived EGT1 genes in the same Rhodotorula torula toruloides 2.1389 is different, and the ergothioneine yield can be improved by expressing the different microorganism-derived EGT1 genes, wherein the NcEGT1 is still optimal, the ergothioneine yield after fermentation is close to 1.5g/L, and the method has an industrial application prospect.

Example 9: engineering bacteria genetic stability assessment

Carrying out streak subculture on the strains including Rhodotorula toruloides 2.1389, Rhodotorula toruloides 2.1389-NcEGT1, Rhodotorula toruloides 2.1389-CpEGT1 and Rhodotorula toruloides 2.1389-RmEGT1, carrying out shake flask fermentation verification on the strains after passage, evaluating the yield and judging the genetic stability of engineering bacteria.

The experimental results show that the product yield of the genetic engineering strain constructed by the method is still higher than that of the original strain Rhodotorula toruloides 2.1389 after 6 passages, and the genetic characters of the engineering strain are relatively stable.

Sequence listing

<110> Zhejiang HuaRui Biotechnology Ltd

<120> method for constructing ergothioneine-producing bacteria

<130> SHPI2010310

<150> CN202010194710.8

<151> 2020-03-19

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 3667

<212> DNA

<213> Artificial sequence ()

<400> 1

tctagagatc tcttctccgg ctttccgtcc ctcgagtacc gtcgcggcgg ctgttttgca 60

tagcggagta agtcatgcgg tcctgtgcaa gcaagtgtcg tcgagaccgg cgactaaccc 120

cggaggccga gcgggtagtc ctccctgcgc aacaacgcga tttcatcagt gggccgtttc 180

gccagaagtt gtcccactcg cagggtgctc acatgaggat ctgaggcggg atcaggggtc 240

ggatgttctt gatccggcgg tcatcgaggt cgttgctggt cgtcgcacat gtccatcatg 300

acgagttgag tcagtctgtc agtcaggctc tgaagcgggg cggtaggctg cgtggctcac 360

agcgccgtct tgacgttggc ttgaggtgtc tgagtgccgt ctgcgcgcat cttgccctgg 420

atccgagtgt agttggttgg tcaatcagga tcttgcgaaa aagttgcgcg tgcgtgggcg 480

ccacgctcgt tcaagcgctc gttgattcat tcattgcctc caaacagggg ggaaccaggc 540

agcgtaaacc ccgcggagtt gtgcccgtcg ggttgccagc ggaacgtcag ccggacaatc 600

tcgcctcgct cgctcgtcac cctagacgca gaactagaga agcgaatcta ccctggcttg 660

tttgctgagg acgactctgc gccgcgctcc gtcaacgaca ccgctcgcca cctcgctcgt 720

ccagttcacc tctcttcgct caactactac cccaaccgat tcgcttcgct ctagctctac 780

ccgccgcgcg ttcagccagt cgagctacaa gatgccatcc gctgagtcga tgaccccgtc 840

ctccgctttg ggccagctca aagccaccgg ccagcacgtc ctctcgaagc tccagcagca 900

aacttcgaac gccgacatca tcgacattcg ccgcgtcgct gttgagatca acctcaagac 960

cgagatcacc tcgatgttca gaccgaagga cggtccgaga caactcccga ctttgctctt 1020

gtacaatgag cgcggcctcc aattgtttga gcgcattacc tatttggagg agtactacct 1080

cactaatgat gagattaaga tcctcaccaa gcacgctacc gaaatggcct cgtttatccc 1140

gtccggcgcc atgatcatcg agctcggttc gggtaacttg cgcaaggtta acttgctcct 1200

cgaggccctc gataacgctg gtaaggccat cgactactac gctctcgact tgtcgcgcga 1260

ggaattggag cgcactctcg ctcaagtccc gtcgtacaag cacgttaagt gccacggtct 1320

cctcggcacc tacgacgatg gccgcgactg gctcaaggcc ccagagaaca tcaacaaaca 1380

gaagtgcatc ctccacttgg gctcctccat tggcaacttt aaccgctccg acgctgccac 1440

ttttttgaag ggcttcactg acgtcctcgg tccgaacgac aaaatgctca tcggtgtcga 1500

tgcttgcaat gacccggccc gcgtctacca tgcctacaac gacaaagtcg gcatcaccca 1560

cgaattcatc ttgaacggct tgcgcaacgc caacgagatt atcggcgaga ccgcctttat 1620

cgaaggcgac tggagagtca tcggcgaata cgtctacgac gaggagggtg gtcgccacca 1680

agccttctat gccccaactc gcgatactat ggtcatgggc gagctcatca gatcccacga 1740

tcgcatccag atcgagcagt ccctcaagta ctccaaggag gagtccgagc gcctctggtc 1800

gactgctggt ctcgaacaag tctccgaatg gacctacggc aacgaatacg gtctccattt 1860

gctcgccaaa tccagaatgt cgttctccct catcccgtcg gtctatgccc gctcggctct 1920

cccaactctc gacgattggg aagccttgtg ggccacttgg gacgtcgtca ccagacagat 1980

gttgccgcaa gaggaactcc tcgagaagcc gatcaagctc cgcaacgctt gcatcttcta 2040

cctcggccac attccaacct tcctcgacat ccagttgacc aagaccacca aacaagcccc 2100

gtccgagcca gctcacttct gcaagatctt cgagcgcggt atcgacccgg atgtcgataa 2160

tccggagctc tgccacgctc actccgagat cccggacgag tggccaccag tcgaggagat 2220

cctcacctat caagagaccg ttcgctcgcg cttgcgcggt ttgtacgccc acggtattgc 2280

taacatcccg cgcaacgttg gtagagctat ttgggtcggt ttcgagcacg agctcatgca 2340

catcgagacc ctcctctaca tgatgttgca gtcggacaag accctcattc cgacccatat 2400

tccacgcccg gacttcgata agttggcccg caaggctgaa tcggagagag tcccgaacca 2460

gtggttcaag atcccggccc aagagatcac tatcggtctc gacgacccgg aggacggttc 2520

cgacatcaat aaacactacg gctgggataa cgagaagcca ccgcgcagag ttcaagtcgc 2580

cgcctttcaa gcccaaggta gaccaatcac taacgaggag tacgcccaat acttgctcga 2640

gaagaacatc gacaaactcc cagcctcgtg ggctcgcttg gacaatgaga acatctccaa 2700

cggcaccacc aattccgttt ccggtcacca ctccaaccgc acctccaagc agcagctccc 2760

gtcctcgttc ttggagaaaa ccgccgtcag aaccgtttat ggtttggttc cactcaagca 2820

cgccctcgac tggccggtct tcgcttcgta tgacgaactc gctggttgcg ccgcttacat 2880

gggcggtcgc atcccgactt tcgaagagac ccgctccatc tatgcctatg ccgacgccct 2940

caagaaaaag aaggaagctg aacgccagtt gggtcgcacc gtcccagctg ttaacgccca 3000

cctcaccaat aacggcgttg aaatcacccc gccgtcgtcg ccgtcgtccg aaaccccggc 3060

cgaatcctcc tccccgtcgg attcgaacac cactctcatc accactgagg acttgttctc 3120

ggacctcgac ggcgccaacg tcggcttcca taactggcac ccgatgccaa tcacctcgaa 3180

gggtaacact ctcgtcggtc aaggtgagct cggcggtgtc tgggaatgga cctcgtcggt 3240

cctccgcaag tgggagggct tcgagccgat ggagctctat ccgggctaca ctgctgactt 3300

cttcgacgaa aagcacaata tcgtcctcgg cggttcgtgg gctacccacc caagaatcgc 3360

cggccgcaag tcctttgtca actggtacca gcgcaactac ccgtatgctt gggtcggcgc 3420

cagagttgtc agagacctct aaacaggccc cttttccttt gtcgatatat gtaattagtt 3480

atgtcacgct tacattcacg ccctcctccc acatccgctc taaccgaaaa ggaaggagtt 3540

agacaacctg aagtctaggt ccctatttat tttttttaat agttatgtta gtattaagaa 3600

cgttatttat atttcaaatt tttctttttt ttctgtacaa acgcgtgtac gcatgtaacg 3660

tttaaac 3667

<210> 2

<211> 3565

<212> DNA

<213> Artificial sequence ()

<400> 2

tctagagatc tcttctccgg ctttccgtcc ctcgagtacc gtcgcggcgg ctgttttgca 60

tagcggagta agtcatgcgg tcctgtgcaa gcaagtgtcg tcgagaccgg cgactaaccc 120

cggaggccga gcgggtagtc ctccctgcgc aacaacgcga tttcatcagt gggccgtttc 180

gccagaagtt gtcccactcg cagggtgctc acatgaggat ctgaggcggg atcaggggtc 240

ggatgttctt gatccggcgg tcatcgaggt cgttgctggt cgtcgcacat gtccatcatg 300

acgagttgag tcagtctgtc agtcaggctc tgaagcgggg cggtaggctg cgtggctcac 360

agcgccgtct tgacgttggc ttgaggtgtc tgagtgccgt ctgcgcgcat cttgccctgg 420

atccgagtgt agttggttgg tcaatcagga tcttgcgaaa aagttgcgcg tgcgtgggcg 480

ccacgctcgt tcaagcgctc gttgattcat tcattgcctc caaacagggg ggaaccaggc 540

agcgtaaacc ccgcggagtt gtgcccgtcg ggttgccagc ggaacgtcag ccggacaatc 600

tcgcctcgct cgctcgtcac cctagacgca gaactagaga agcgaatcta ccctggcttg 660

tttgctgagg acgactctgc gccgcgctcc gtcaacgaca ccgctcgcca cctcgctcgt 720

ccagttcacc tctcttcgct caactactac cccaaccgat tcgcttcgct ctagctctac 780

ccgccgcgcg ttcagccagt cgagctacaa gatgactgcc gttaagcaaa ttcctgaaag 840

aaaggtgttg atagattcaa atcataagtc tccatcaaaa ccgggtaaac atcctaattc 900

tgtcattgat atcaggtcta ataaggacga tttaaattta cgtcatgccc tagtctcatc 960

ttttaatcca cacgatggaa aacctaggtg gctacctact atgttattgt acgacgaaaa 1020

aggtttacaa ttgtttgaag atataactta cttagatgag tattatttga ctggctacga 1080

aattgaatta ttgaagaaac attcagcaga aattgcagct gctattcctg atggttctat 1140

ggtcatcgaa ttgggctctg gtaatttgag aaagatctgt ttgttgttac aagcctttga 1200

ggattcacat aagtctatcg actactatgc attagattta tcacaaaagg aattagaaag 1260

aactttgagc catgttcctg actttaaata tgtctcttgt catggactgc taggtacata 1320

tgatgatggt gttacatggt tgaaacaacc aggtatagtc aataagacta agtgcatcat 1380

ccatcttggt tcgtctattg ggaattttca tagaaatgaa gctgccgatt tcctgcagac 1440

atttgctgat gtaatgaaac cagacgactc tatggttatt ggtcttgatt catgcggtaa 1500

tccagagatg tctcgcattc aaagattcat tttgaacggc ttatccaatg ctaatagcgt 1560

ttatggcaag gaaatattct atgttccaga ttggagagta attggtgaat atgtttacga 1620

tgatgaaggt ggcagacacc aggcttttat ttcacctttg aaagaagtca ctgctttagg 1680

gtctgttatt aaagcccatg aaagaattaa aattgaacaa tctttgaagt actctaaggc 1740

ctcagctgac gatttatgga gaaatgctgg ctttcgagaa actcaaactt ggacgagaaa 1800

cggtgaatat ggactacata tgttgcaaag agctgatccg cccttctcta aggctccttc 1860

tttgtatgca gctaatactc ttccctctct ttctgattgg agagcattgt ggtgtgcctg 1920

ggatattgtc actagagcta tgttgccaca acaggaattg actgagaaac ctatagagtt 1980

aagacatgcc tacatctttt accttggtca tattcctacc ttcttagaca tccagttaac 2040

caaaacatca gcatgggctc caacctctcc agtttcttat catgccattt tcgagcgcgg 2100

cattgatccc gatgttgata acccagaaaa gtgtcatgat cactcagaga ttccagatga 2160

atggccacca gtcgaagaaa ttattgctta tcaagatagg gtgcgtgtta gattgacaga 2220

actgtataaa cagggtgtgc acacaattac aagaaaggct gctagagcta tctgggtttc 2280

atttgaacat gaagctatgc atttggaaac cttgttgtat atgatgctac aaagtgataa 2340

agtgttgcca cctccacaca ctggcgttcc agactttgaa agaatggcaa ctaaggcttt 2400

cgaagctcgt acgcaaaata tgtggttcga aattccagaa cagactatta gtcttggaac 2460

agatgatcca gaagatgggg atgaagacgt tcattttgga tgggacaacg aaaaaccagt 2520

tagaagagtt aaggttcacg cgttgcaagc tcaaggaaga ccaattacaa atgaggaata 2580

cgcattatat atttaccata ccaactcttc taaactgcca gcatcttgga gttcgtcccc 2640

ttcatcttct ctgtctaacg gcgtgtctca tcccagctcc cataacaagc atattccaac 2700

tgatttgcct cattccttct tgcaaggtaa gtttgttaga accgtatatg gtttgatacc 2760

tttatctttg gcgttggatt ggcctgttca agcttcttat gatgaattag ctgactgtgc 2820

attatggatg ggtggaagaa ttccaacctt agaggaagcc agatcaatct atgcctttgt 2880

tgaatctaaa acgcaaatag caacaggtaa cacattggtc aagaaagttc ctgctgttaa 2940

tggacacttg gttaataacg gagttgagga aactccacca catgaatcct cttcggcagt 3000

tgagaattct ttattcatcg acttagccgg tttgaacgtg ggttttaaaa gttggaatcc 3060

tgaacctgtt acatcttctg gtacgtcttt ggctggacaa tcctctatgg gtggtgtatg 3120

ggagtggacc tcttctgttt taagaccaca tgaagggttc cacccaatgg agttgtatcc 3180

tggttataca gccgatttct ttgatgaaaa acataatatt gttctcggag gatcatgggc 3240

tactcatcca agaatagcgg gtagaaaaag ctttgttaac tggtatcaaa gaaactatcc 3300

gtacgcctgg gctggtgcca gacttgttaa agatgcttga acaggcccct tttcctttgt 3360

cgatatatgt aattagttat gtcacgctta cattcacgcc ctcctcccac atccgctcta 3420

accgaaaagg aaggagttag acaacctgaa gtctaggtcc ctatttattt tttttaatag 3480

ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacaaac 3540

gcgtgtacgc atgtaacgtt taaac 3565

<210> 3

<211> 4932

<212> DNA

<213> Artificial sequence ()

<400> 3

tctagagatc tcttctccgg ctttccgtcc ctcgagtacc gtcgcggcgg ctgttttgca 60

tagcggagta agtcatgcgg tcctgtgcaa gcaagtgtcg tcgagaccgg cgactaaccc 120

cggaggccga gcgggtagtc ctccctgcgc aacaacgcga tttcatcagt gggccgtttc 180

gccagaagtt gtcccactcg cagggtgctc acatgaggat ctgaggcggg atcaggggtc 240

ggatgttctt gatccggcgg tcatcgaggt cgttgctggt cgtcgcacat gtccatcatg 300

acgagttgag tcagtctgtc agtcaggctc tgaagcgggg cggtaggctg cgtggctcac 360

agcgccgtct tgacgttggc ttgaggtgtc tgagtgccgt ctgcgcgcat cttgccctgg 420

atccgagtgt agttggttgg tcaatcagga tcttgcgaaa aagttgcgcg tgcgtgggcg 480

ccacgctcgt tcaagcgctc gttgattcat tcattgcctc caaacagggg ggaaccaggc 540

agcgtaaacc ccgcggagtt gtgcccgtcg ggttgccagc ggaacgtcag ccggacaatc 600

tcgcctcgct cgctcgtcac cctagacgca gaactagaga agcgaatcta ccctggcttg 660

tttgctgagg acgactctgc gccgcgctcc gtcaacgaca ccgctcgcca cctcgctcgt 720

ccagttcacc tctcttcgct caactactac cccaaccgat tcgcttcgct ctagctctac 780

ccgccgcgcg ttcagccagt cgagctacaa gatgccagac gccgcctcaa ccgccgctgt 840

tcagcctccg cccttcatcc tcgacctgcg gaaccgctcg ccgccgacct cgccgagcca 900

ggtcgcctcc gatgccgctc gctcgtcctc tccgtcgtcc ctgggcgaat cggagggcac 960

tacctcgacc aatgctaccc ccgaggcccc ctccgatccg ctccgcgagc agatcatcgc 1020

cggcttgatc ggatcgccca agcccaccgt tccaggcaag acggaaaagg atcgcgcgta 1080

tgcgtaccgc cgcacgatcc cgaccatgac actgtacagc gagcgtggcc tgtctatcta 1140

cgaggaaatc accaagacca aggtatgctc ggccctttcc gtccgctttg gttcacgagg 1200

ggccaatgct ttctcagcag gccctcgcgc gccgtcggcc ccacttgccc tacggcgtgc 1260

gggctctcct tcggactagg tggctggcaa gcatcccctt tgcagacgca ctgacctcgt 1320

ctttgcgttt cgattcaggc ctactaccca ttcgaagccg aaaaggagat tctcgaaaag 1380

tatggagacg aaattgcctg ccgcatgttt ggactgccgt cggccttgct cgtcccggac 1440

gacgtagtcc gtggcaaaga cgaccagtac gaaccctctc cggcttcaaa catcggcgcg 1500

aagaaggaga agtggtgagc cggcgttcgg aactataacg gctcctcatc cgcggtacag 1560

gcgctgacgc actgcttaca ggggcgacgt cgctgtcggt ctccacaact acggtgtcaa 1620

cggctctgcg aacctcgcgc agaacaatgt cgtcgccacg cagggcctcg cggtcgagct 1680

tggctcgggc tcgctcgaca agacccgtca tctcctccgc tctatggcca agctgttgca 1740

gtctcgcgac gagggcagct gcccggtctc tcctctgcgc tccattgact acaaagcagt 1800

gcgtttggcg aaacctccgc gagtatagga aatcaatact gacctcccac gtctgccgct 1860

gaacagctcg accttgaagc ggcgtcgctc tactcgacac tgtcctcgct tgcatcggtc 1920

gaaggcgatt gcgtcacgac ggcggtcgac ggacagccaa acgcgacgaa acgccgcgtt 1980

tcggtctcgg gtcttcacgc cacctacgac gagggcctcg ccttcttgaa ggcgcagaac 2040

gatgctggca gcccgtcgag cgtcttctca gacctccccg acttgcccac gagtccaaag 2100

tcggttccga ctaccttgtc cagtgtcctg gaggacgaca gcgacgaagg cgagaccgct 2160

caagcgtctc gcggcgagaa cgctgcggaa cgccgcgcga cttcgatcat gtggctcggt 2220

tcctcgtgcg gcaactacac ccgcgaggaa gcggtgcagt tcctccgcaa catcgagctg 2280

cgcgagggcg ataccatgct gatcggcatc gacggctgcg cggacgaacc tcgtatcgag 2340

actgcctaca acgacccgca ggtgagtctg atgtcctgcc aaactgacca gtatgagctg 2400

ctctgaccct tgtttgccgc tgatcctcca gggcgtcacc cgcgcgttca ttctcgaggg 2460

catcgatgtc gcaggccgca ccctcggcgg agacgcggcc gaagtgctgc agcagaagaa 2520

ctttgactat gtcaaccgct ggaacgccga gctcggaagg cacgaggtga gctgccttcc 2580

gctgtccaga ggagagcagc ctgagttgca ccggcagccc tgttctgacc cgtccccgcg 2640

acaccctcgc aggcttacgt ccgcgccaac aaagatctca caatcccgat cacgggcgca 2700

gacgacgtca ccgaggtcaa gctcgaagag ggagagtaag tcccgcactt ttgcgcgttg 2760

agccggtgcc atcacaagag cccttcctga cgtttcctct cgcaccaggc tcctcaacat 2820

tgaagtctct tacaagtaca cctatgcgga ggcggcggcg ctcttccact tggcgggctt 2880

ccggctcatc cagcactgga ccgactcgtc gcgctcgcat tacctctacc tggtcgaaaa 2940

gccccgcatg tggttcccgt cgacgaccga gagcgctgcc aagatgctcg gtatcgaggt 3000

cgagcccgag gagaaggaga ccgactacgg tgtcccgact ctggaaaagt gggaagaaat 3060

gtggcgggcg tgggacggct tgatggtgag gatgccctcg tcggcgaagg aattccgcaa 3120

gcgatgagtg gacgctcacc tgaaaccgct tcttctacca gctcgagatc atccccaagt 3180

cgctgcactt ccagaagccg atcccgctcc gccacatccc gctcttctac gtcgggcaca 3240

tacccgcttt ccgggatatt cacctcgcga ggtacttcaa cgagccgctg accgaaccgg 3300

caaagtttgc cgacatcttc gagcgcggaa tcgatccctg tgtcgacgac cccgagaccg 3360

tcacgcactg gcactcggaa gtcccgaagg acgaagcgtg ctggccttct ctccaggaga 3420

ttacggcgta cgaagcgtcc gttcgcgatc gcgtccgcaa ggtgtacgcc gaacacgagg 3480

gcaagtggac gaccaagctc gcccgtgtgc tgatgatgac ttttgagcac gagatgtgcg 3540

tccttcctgc ttcgggctga ttcggtaccc atgtcatcac tcgactcact catcctcttg 3600

ggtccccttg ggccccacag gatgcactgg gagacctccg tctacatctg tctccaagcc 3660

gcgagctcgc tcaaccttcc gccgggaacg gcgattcctg atttccgctc gctggcacgt 3720

caagcaaaac gtgatctgca tcagaacggc ggcggacagc gactctcctt ccccgctcag 3780

gaggtcacag tcggtcacga cgacgacgat accatcgacg accagacgcc gtttgaccct 3840

gcccgagaat acggctggga tgtcgagcac cctcgccgcc agcttcgcgt cgacgcattc 3900

gagatcgagg tcctcccgat ctcgaacgga gagtacaaaa cctggcttac cgagacgcag 3960

caactctcga acaaggcgct catcccgtcg agctggacgg acgagactgg cgaactctgc 4020

gtgaaaacgt tgttcggctt ggtccccctc actctcgccg aggagtggcc cgtggctgcg 4080

agcgcggaac agctcgagaa gtttgccaag gtgggtatcc tttgctcgag caagaatagg 4140

gaccgaagaa gactgactcg taactttctg cactcgacag gccaaaggag gacgcttgcc 4200

gacgttcggc gagctgtcgg cgttcaacca gcacaaccct agctctacgc ctctcgccaa 4260

catcggcctc gcaaacctgc atccggttgc cccttcggta cccgggaaag cgcgtgacgg 4320

cagccagctc ccgatcaccg acggaggcct gtggcaatgg acctcgacgg tcctcgagcc 4380

ctgggctggt tacagcggat cggttcttta ccctggttac tccagtgacg tgagtcgagt 4440

gcgactgtga atgaagtgag atggggcaac tgacattaag cgccctctct tccctctagt 4500

tcttcgacgg caaacaccac atcgtgctgg gcgcgagcta cgcgagtcct cgtcgcttgg 4560

cccgcccttc tttcctgaac tggtaccaga agaactgtgc gtttctggcg ctcttccaag 4620

gaccgttgcc gccagatccc cgtactgaca tgctctgccg cagacccttt catgctcggc 4680

ggcgctcgtg tggcgtacga tgtgtgaaca ggcccctttt cctttgtcga tatatgtaat 4740

tagttatgtc acgcttacat tcacgccctc ctcccacatc cgctctaacc gaaaaggaag 4800

gagttagaca acctgaagtc taggtcccta tttatttttt ttaatagtta tgttagtatt 4860

aagaacgtta tttatatttc aaatttttct tttttttctg tacaaacgcg tgtacgcatg 4920

taacgtttaa ac 4932

<210> 4

<211> 8378

<212> DNA

<213> Artificial sequence ()

<400> 4

agtactttga tccaacccct ccgctgctat agtgcagtcg gcttctgacg ttcagtgcag 60

ccgtcttctg aaaacgacat gtcgcacaag tcctaagtta cgcgacaggc tgccgccctg 120

cccttttcct ggcgttttct tgtcgcgtgt tttagtcgca taaagtagaa tacttgcgac 180

tagaaccgga gacattacgc catgaacaag agcgccgccg ctggcctgct gggctatgcc 240

cgcgtcagca ccgacgacca ggacttgacc aaccaacggg ccgaactgca cgcggccggc 300

tgcaccaagc tgttttccga gaagatcacc ggcaccaggc gcgaccgccc ggagctggcc 360

aggatgcttg accacctacg ccctggcgac gttgtgacag tgaccaggct agaccgcctg 420

gcccgcagca cccgcgacct actggacatt gccgagcgca tccaggaggc cggcgcgggc 480

ctgcgtagcc tggcagagcc gtgggccgac accaccacgc cggccggccg catggtgttg 540

accgtgttcg ccggcattgc cgagttcgag cgttccctaa tcatcgaccg cacccggagc 600

gggcgcgagg ccgccaaggc ccgaggcgtg aagtttggcc cccgccctac cctcaccccg 660

gcacagatcg cgcacgcccg cgagctgatc gaccaggaag gccgcaccgt gaaagaggcg 720

gctgcactgc ttggcgtgca tcgctcgacc ctgtaccgcg cacttgagcg cagcgaggaa 780

gtgacgccca ccgaggccag gcggcgcggt gccttccgtg aggacgcatt gaccgaggcc 840

gacgccctgg cggccgccga gaatgaacgc caagaggaac aagcatgaaa ccgcaccagg 900

acggccagga cgaaccgttt ttcattaccg aagagatcga ggcggagatg atcgcggccg 960

ggtacgtgtt cgagccgccc gcgcacgtct caaccgtgcg gctgcatgaa atcctggccg 1020

gtttgtctga tgccaagctg gcggcctggc cggccagctt ggccgctgaa gaaaccgagc 1080

gccgccgtct aaaaaggtga tgtgtatttg agtaaaacag cttgcgtcat gcggtcgctg 1140

cgtatatgat gcgatgagta aataaacaaa tacgcaaggg gaacgcatga aggttatcgc 1200

tgtacttaac cagaaaggcg ggtcaggcaa gacgaccatc gcaacccatc tagcccgcgc 1260

cctgcaactc gccggggccg atgttctgtt agtcgattcc gatccccagg gcagtgcccg 1320

cgattgggcg gccgtgcggg aagatcaacc gctaaccgtt gtcggcatcg accgcccgac 1380

gattgaccgc gacgtgaagg ccatcggccg gcgcgacttc gtagtgatcg acggagcgcc 1440

ccaggcggcg gacttggctg tgtccgcgat caaggcagcc gacttcgtgc tgattccggt 1500

gcagccaagc ccttacgaca tatgggccac cgccgacctg gtggagctgg ttaagcagcg 1560

cattgaggtc acggatggaa ggctacaagc ggcctttgtc gtgtcgcggg cgatcaaagg 1620

cacgcgcatc ggcggtgagg ttgccgaggc gctggccggg tacgagctgc ccattcttga 1680

gtcccgtatc acgcagcgcg tgagctaccc aggcactgcc gccgccggca caaccgttct 1740

tgaatcagaa cccgagggcg acgctgcccg cgaggtccag gcgctggccg ctgaaattaa 1800

atcaaaactc atttgagtta atgaggtaaa gagaaaatga gcaaaagcac aaacacgcta 1860

agtgccggcc gtccgagcgc acgcagcagc aaggctgcaa cgttggccag cctggcagac 1920

acgccagcca tgaagcgggt caactttcag ttgccggcgg aggatcacac caagctgaag 1980

atgtacgcgg tacgccaagg caagaccatt accgagctgc tatctgaata catcgcgcag 2040

ctaccagagt aaatgagcaa atgaataaat gagtagatga attttagcgg ctaaaggagg 2100

cggcatggaa aatcaagaac aaccaggcac cgacgccgtg gaatgcccca tgtgtggagg 2160

aacgggcggt tggccaggcg taagcggctg ggttgtctgc cggccctgca atggcactgg 2220

aacccccaag cccgaggaat cggcgtgacg gtcgcaaacc atccggcccg gtacaaatcg 2280

gcgcggcgct gggtgatgac ctggtggaga agttgaaggc cgcgcaggcc gcccagcggc 2340

aacgcatcga ggcagaagca cgccccggtg aatcgtggca agcggccgct gatcgaatcc 2400

gcaaagaatc ccggcaaccg ccggcagccg gtgcgccgtc gattaggaag ccgcccaagg 2460

gcgacgagca accagatttt ttcgttccga tgctctatga cgtgggcacc cgcgatagtc 2520

gcagcatcat ggacgtggcc gttttccgtc tgtcgaagcg tgaccgacga gctggcgagg 2580

tgatccgcta cgagcttcca gacgggcacg tagaggtttc cgcagggccg gccggcatgg 2640

ccagtgtgtg ggattacgac ctggtactga tggcggtttc ccatctaacc gaatccatga 2700

accgataccg ggaagggaag ggagacaagc ccggccgcgt gttccgtcca cacgttgcgg 2760

acgtactcaa gttctgccgg cgagccgatg gcggaaagca gaaagacgac ctggtagaaa 2820

cctgcattcg gttaaacacc acgcacgttg ccatgcagcg tacgaagaag gccaagaacg 2880

gccgcctggt gacggtatcc gagggtgaag ccttgattag ccgctacaag atcgtaaaga 2940

gcgaaaccgg gcggccggag tacatcgaga tcgagctagc tgattggatg taccgcgaga 3000

tcacagaagg caagaacccg gacgtgctga cggttcaccc cgattacttt ttgatcgatc 3060

ccggcatcgg ccgttttctc taccgcctgg cacgccgcgc cgcaggcaag gcagaagcca 3120

gatggttgtt caagacgatc tacgaacgca gtggcagcgc cggagagttc aagaagttct 3180

gtttcaccgt gcgcaagctg atcgggtcaa atgacctgcc ggagtacgat ttgaaggagg 3240

aggcggggca ggctggcccg atcctagtca tgcgctaccg caacctgatc gagggcgaag 3300

catccgccgg ttcctaatgt acggagcaga tgctagggca aattgcccta gcaggggaaa 3360

aaggtcgaaa aggtctcttt cctgtggata gcacgtacat tgggaaccca aagccgtaca 3420

ttgggaaccg gaacccgtac attgggaacc caaagccgta cattgggaac cggtcacaca 3480

tgtaagtgac tgatataaaa gagaaaaaag gcgatttttc cgcctaaaac tctttaaaac 3540

ttattaaaac tcttaaaacc cgcctggcct gtgcataact gtctggccag cgcacagccg 3600

aagagctgca aaaagcgcct acccttcggt cgctgcgctc cctacgcccc gccgcttcgc 3660

gtcggcctat cgcggccgct ggccgctcaa aaatggctgg cctacggcca ggcaatctac 3720

cagggcgcgg acaagccgcg ccgtcgccac tcgaccgccg gcgcccacat caaggcaccc 3780

tgcctcgcgc gtttcggtga tgacggtgaa aacctctgac acatgcagct cccggagacg 3840

gtcacagctt gtctgtaagc ggatgccggg agcagacaag cccgtcaggg cgcgtcagcg 3900

ggtgttggcg ggtgtcgggg cgcagccatg acccagtcac gtagcgatag cggagtgtat 3960

actggcttaa ctatgcggca tcagagcaga ttgtactgag agtgcaccat atgcggtgtg 4020

aaataccgca cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc 4080

tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg 4140

cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag 4200

gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc 4260

gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag 4320

gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga 4380

ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc 4440

atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg 4500

tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt 4560

ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca 4620

gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca 4680

ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag 4740

ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca 4800

agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg 4860

ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agccatattc 4920

aacgggaaac gtcttgctct aggccgcgat taaattccaa catggatgct gatttatatg 4980

ggtataaatg ggctcgcgat aatgtcgggc aatcaggtgc gacaatctat cgattgtatg 5040

ggaagcccga tgcgccagag ttgtttctga aacatggcaa aggtagcgtt gccaatgatg 5100

ttacagatga gatggtcaga ctaaactggc tgacggaatt tatgcctctt ccgaccatca 5160

agcattttat ccgtactcct gatgatgcat ggttactcac cactgcgatc cccgggaaaa 5220

cagcattcca ggtattagaa gaatatcctg attcaggtga aaatattgtt gatgcgctgg 5280

cagtgttcct gcgccggttg cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc 5340

gcgtatttcg tctcgctcag gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg 5400

attttgatga cgagcgtaat ggctggcctg ttgaacaagt ctggaaagaa atgcataaac 5460

ttttgccatt ctcaccggat tcagtcgtca ctcatggtga tttctcactt gataacctta 5520

tttttgacga ggggaaatta ataggttgta ttgatgttgg acgagtcgga atcgcagacc 5580

gataccagga tcttgccatc ctatggaact gcctcggtga gttttctcct tcattacaga 5640

aacggctttt tcaaaaatat ggtattgata atcctgatat gaataaattg cagtttcatt 5700

tgatgctcga tgagtttttc taatcacagg cagcaacgct ctgtcatcgt tacaatcaac 5760

atgctaccct ccgcgagatc atccgtgttt caaacccggc agcttagttg ccgttcttcc 5820

gaatagcatc ggtaacatga gcaaagtctg ccgccttaca acggctctcc cgctgacgcc 5880

gtcccggact gatgggctgc ctgtatcgag tggtgatttt gtgccgagct gccggtcggg 5940

gagctgttgg ctggctggtg gcaggatata ttgtggtgta aacaaattga cgcttagaca 6000

acttaataac acattgcgga cgtttttaat gtactgaatt aacgccgaat tgaattcgag 6060

ctcggtaccc gggcgttctc ctcgctccgc aagcattgga atgaaccttg ctctctagtt 6120

ccctcctccg tgacctcgtt tcgtccttta gacggcacga tggaaggaag aaatctctgc 6180

ggacaagcaa atctgctggc tcgccttgta ggtcgcctac cggagcaagc cttgtgccgc 6240

cgggatgcca acgtcgtttt ttgacgtttg caagacgtag aggacgcttc ggacgacgaa 6300

acaagctgtg aggacatgga agtcgtggga ggaacggcgc agagcggcgc cgcgggagca 6360

taaggcaagc gagatagtcc agaaatcgcg gcgccaagta cagtaattta ttggagcagg 6420

caccagaagc gggcagcagt atgcgcaggc ttggggtcga cgagagacga ctccctcata 6480

ctcggttacc tcgagcaata caatcaatcg aagctgcgcg aatctcggct tgtaagggtc 6540

ggaaaggaac ctcggagatg gccacgtcac atcaccaact tatcgatctc agccgacgtc 6600

gcagagaggg cgagcgaagc ggtgaaggag ggaaacaatc cctcgagagc atgatccgtc 6660

tgaatctgca gcgcaggaag ccgtcacacg cccgcctcga gcgcaggtcg ggtccagccg 6720

ggggacgaaa cgcgcgaggg ctgatttcgt gagcgaagga agccgcatcg acaagttcgc 6780

gtccctttgc cctctttccc atcacccgct ctcgctctac ccgctcagaa caacaccaga 6840

tcagtcacaa tgccggagct cacggcgacg tcggtcgaga agttcctcat cgaaaagttc 6900

gactcggtct cggacctcat gcaactctcg gagggagagg aatcgcgcgc gttctcgttc 6960

gacgtcggag gccgcggata cgtcctccgc gtcaactcgt gtgcggacgg attctacaag 7020

gatcggtacg tctaccgcca ttttgcgtcg gcggcgctcc cgatccccga agtcctcgac 7080

atcggagagt tctcggaatc cctcacgtac tgtatctcgc gccgggcgca aggagtcacg 7140

ctccaagatc tcccggagac ggaactcccg gcggtcctcc aaccggtcgc ggaagcgatg 7200

gacgcgatcg cggccgcgga cctctcgcaa acgtcgggat tcggaccgtt tggaccgcaa 7260

ggaatcggac aatacacgac gtggcgcgac ttcatctgtg cgatcgcgga tccccatgtc 7320

taccactggc aaacggtcat ggatgacacg gtctcggcgt cggtcgcgca agcgctcgac 7380

gagctcatgc tctgggcgga ggactgtccg gaggtccgcc acctcgtcca cgcggacttt 7440

ggatcgaaca acgtcctcac ggacaacgga cgcatcacgg cggtcatcga ctggtcggag 7500

gcgatgtttg gagactcgca atacgaggtc gcgaacatct tcttctggcg cccgtggctc 7560

gcgtgcatgg agcaacagac gcgctacttc gagcgccgcc acccggagct cgcgggatcg 7620

ccgcgcctcc gcgcgtacat gctccgcatc ggcctcgacc aactctacca gtcgctcgtc 7680

gacggaaact tcgacgatgc cgcgtgggcc caaggacgct gcgacgcgat tgtccgctcg 7740

ggagcgggaa ccgtgggacg cacgcaaatt gcgcggcgct cggcggccgt ctggacggat 7800

ggatgtgtcg aagtcctcgc ggattcggga aaccggcgcc cgtcgacgcg cccgcgggcg 7860

aaagaacacc accatcacca tcactaggat cgttcaaaca tttggcaata aagtttctta 7920

agattgaatc ctgttgccgg tcttgcgatg attatcatat aatttctgtt gaattacgtt 7980

aagcatgtaa taattaacat gtaatgcatg acgttattta tgagatgggt ttttatgatt 8040

agagtcccgc aattatacat ttaatacgcg atagaaaaca aaatatagcg cgcaaactag 8100

gataaattat cgcgcgcggt gtcatctatg ttactagatc gggcctggat cctctagagt 8160

cgacctgcag catgcaagct tggagcttga gcttggatca gattgtcgtt tcccgccttc 8220

agtttaaact atcagtgttt gacaggatat attggcgggt aaacctaaga gaaaagagcg 8280

tttattagaa taatcggata tttaaaaggg cgtgaaaagg tttatccgtt cgtccatttg 8340

tatgtgcatg ccaaccacag ggttcccctc gggatcaa 8378

Claims (8)

1. An ergothioneine producing strain is characterized in that engineering bacteria constructed by taking Rhodotorula toruloides 2.1389, which is preserved in China general microbiological culture Collection center, as a host comprise egt1 genes selected from the following groups in the genome: the gene NcEGT1 coding for the enzyme egt1 from Neurospora crassa, the gene CpEGT1 coding for the enzyme egt1 from Secale cereale L.and the gene RmEGT1 coding for the enzyme egt1 from Rhodotorula mucilaginosa, the egt1 gene are present in the form of gene expression cassettes, the gene expression cassette NcEGT1 is SEQ ID NO:1, the gene expression cassette CpEGT1 is SEQ ID NO:2, and the gene expression cassette RmEGT1 is SEQ ID NO: 3.

2. The ergothioneine producing strain of claim 1 wherein the egt1 gene is NcEGT 1.

3. The ergothioneine-producing strain as claimed in claim 1, wherein when engineering bacteria are constructed, NcEGT1 gene expression cassette, CpEGT1 gene expression cassette and RmEGT1 gene expression cassette are cloned on pUC57 plasmid respectively to obtain EGT1 gene expression plasmids which are named as Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t respectively.

4. The ergothioneine producing strain as recited in claim 3, wherein the EGT1 gene expression plasmid is constructed as an ergothioneine functional gene expression plasmid, said ergothioneine functional gene expression plasmid being constructed by a method comprising:

1) carrying out enzyme digestion on EGT1 gene expression plasmids Puc57-Pgpd-NcEGT1-ScCYC1t, Puc57-Pgpd-CpEGT1-ScCYC1t and Puc57-Pgpd-RmEGT1-ScCYC1t by using restriction enzyme XbaI/PmeI, respectively carrying out gel recovery on 3.7kb, 3.6kb and 4.9kb fragments to obtain an EGT1 gene expression fragment;

2) carrying out enzyme digestion on plasmid pZPK-PGPD-Hyg-Tnos with the nucleotide sequence of SEQ ID NO. 4 by using restriction enzyme XbaI/PmeI, and carrying out gel recovery on an 8.3kb fragment to obtain a plasmid skeleton;

3) connecting the EGT1 gene expression fragment obtained in the step 1) with the plasmid skeleton obtained in the step 2) to obtain an ergothioneine functional gene expression plasmid.

5. A method for constructing the ergothioneine-producing microorganism as claimed in claim 1, wherein the ergothioneine-functional gene expression plasmid as claimed in claim 4 is transformed into Rhodotorula toruloides 2.1389 to obtain a positive clone.

6. The method according to claim 5, wherein the ergothioneine functional gene expression plasmid according to claim 4 is used for Agrobacterium-mediated transfection of Rhodotorula toruloides to obtain positive transformants.

7. The method of claim 6, comprising the steps of:

A. transforming the ergothioneine functional gene expression plasmid as defined in claim 4 into Agrobacterium-infected competent cells to obtain Agrobacterium-engineered bacteria;

B. the agrobacterium engineering bacteria liquid and Rhodotorula toruloides 2.1389 bacteria liquid are mixed for resistance screening, and positive transformants are obtained through phenotype and PCR verification.

8. Use of the ergothioneine-producing bacteria as claimed in claim 1 or 2 in the fermentative production of ergothioneine.

Images