CN112626086B - Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae - Google Patents
Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae Download PDFInfo
- Publication number
- CN112626086B CN112626086B CN202110075452.6A CN202110075452A CN112626086B CN 112626086 B CN112626086 B CN 112626086B CN 202110075452 A CN202110075452 A CN 202110075452A CN 112626086 B CN112626086 B CN 112626086B
- Authority
- CN
- China
- Prior art keywords
- mtrevoluta
- gene
- alfalfa
- medicago truncatula
- medicago
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
Abstract
The invention discloses a medicago truncatula gene MtREVOLUTA and application of a dicotyledonous plant expression vector pEARLEYGATE100 containing the medicago truncatula gene MtREVOLUTA in improving salt tolerance of leguminous kindred forage grass alfalfa. The invention also discloses application of the medicago truncatula gene MtREVOLUTA in cultivating salt-tolerant medicago sativa. Experiments prove that the gene MtREVOLUTA of the invention is a regulatory gene responding to abiotic stress, can be expressed in large quantity in the alfalfa of the leguminous forage grasses of the kindred species, and obviously enhances the salt tolerance of the transgenic alfalfa. The survival rate of the transgenic plant after high salt treatment is higher than that of wild alfalfa SY 4D. The application of the medicago truncatula gene MtREVOLUTA in improving the salt tolerance of the medicago truncatula in the kindred forage grass of leguminosae is shown to have important significance and economic value.
Description
Technical Field
The invention relates to application of a medicago truncatula gene MtREVOLUTA, in particular to application of the medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago truncatula in kindred forage grass of leguminosae, and belongs to the technical field of biological gene engineering.
Background
The family Leguminosae belongs to dicotyledonous plants, about 650 genera, 18000 species, and the distribution range is extremely wide. Alfalfa belongs to leguminous plants, is an important perennial high-quality pasture in the world, has high protein content and good palatability, and is the most economic feed source no matter used as pasture, silage or hay, so the alfalfa is called the king of pasture.
The research on the salt-tolerant mechanism of the alfalfa can provide theoretical basis and technical support for genetic improvement and breeding of high-quality new alfalfa strains. However, alfalfa belongs to cross-pollinated plants and is a homotetraploid (2 n-4 x-32) which is highly heterozygous, so that the research on salt tolerance mechanism is very difficult. Recent studies have reported that: under the salt treatment conditions with different concentrations, the alfalfa can adapt to the salt stress with medium and low concentrations, and some varieties have strong salt tolerance and have the potential of being popularized in salt lands. Although alfalfa has some tolerance to salt stress, salinization is increasingly severe, which severely affects the yield and quality of alfalfa.
As a result of research for a decade by many scientists, Medicago truncatula (Tribulus terrestris) has become a model plant for the biological and genomic research of leguminous plants. The medicago truncatula is a diploid (2n ═ 16) plant, has the advantages of self-pollination, small genome, short life cycle and high genetic transformation efficiency, and is convenient for research. Therefore, the research on the salt tolerance mechanism of medicago sativa is helpful to disclose the salt tolerance mechanism of medicago sativa and the research process of the salt stress tolerance regulation mechanism of medicago sativa is accelerated through the research on the medicago truncatula.
Plants typically contain many mirnas, with miR166 derived from a multigene family with independent genes, loci. miR166 targets HD-Zip III family genes, including the gene REVOLUTA (REV), with high conservation. Previous studies by the applicant have demonstrated that: the MtREVOLUTA gene, a member of the Medicago truncatula HD-ZIP III gene family, is involved in regulating the number of lobules and the ratio of leaves and stems of leguminous plants. The gene is knocked out, a transgenic leguminous plant with the number of small leaves and the ratio of leaves to stems higher than that of a wild plant can be obtained, experiments show that the ratio of the number of small leaves of a knocked-out mutant strain plant to four or five is remarkably improved to reach 81.5%, and the ratio of leaves to stems is improved by about 11%. And the application of the REVOLUTA gene in regulating the number of lobules and the ratio of leaves and stems of leguminous plants (patent number CN201710672282.3) is reported by the results. The applicant studies have also demonstrated that: in the transgenic medicago truncatula plant over expressing the MtREVOUTA, the expression level of the MtREVOUTA has no obvious change, and the transgenic medicago truncatula plant with the MtREVOUTA of which the MtmiR166 targeted site is mutated can be obtained only by constructing the transgenic medicago truncatula plant with the MtREVOUTA, the expression level of which is obviously improved, wherein the plant has weak whole plant although the leaves of a single compound leaf are increased. Therefore, the expression level of MtREVOLUTA expressed in Medicago truncatula is strictly controlled by MtmiR166, and the expression level of MtREVOLUTA without mutation cannot be changed by conventional transgenic overexpression. The research shows that different from the prior discovery that the MtREVOLUTA is only responsible for regulating the development of leaves, the MtREVOLUTA is a Tribulus terrestris response salt stress regulating gene, and the MtREVOLUTA gene can present different expression levels in the legume forage alfalfa of the kindred species and is expressed in a large amount in documents or patents which are not reported.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide the application of the medicago truncatula gene MtREVOLUTA in improving the salt tolerance of the medicago sativa of the kindred forage grass of leguminosae.
The medicago truncatula gene MtREVOLUTA of the invention is applied to the improvement of the salt tolerance of the medicago truncatula in the kindred forage grass of leguminosae.
Wherein: the medicago truncatula gene MtREVOLUTA is a medicago truncatula response salt stress regulation and control gene, and the medicago truncatula gene MtREVOLUTA can improve the salt tolerance of medicago sativa by a large amount of expression in the kindred species leguminous forage alfalfa.
Wherein: the alfalfa is medium alfalfa No.1, medium alfalfa No. 3, agricultural and agricultural cyanine or alfalfa SY4D, and is further preferably alfalfa SY 4D.
The applicant carried out salt abiotic stress treatment of medicago truncatula and confirmed that the expression level of the gene mtravoluta was significantly increased with the increase of treatment time compared to the control, showing that the gene mtravoluta is involved in the salt stress response of plants, as shown in fig. 1.
The invention also provides application of a dicotyledonous plant expression vector pEARLEYGATE100 containing the medicago truncatula gene MtREVOLUTA in improving the salt tolerance of the medicago sativa of the kindred forage grass of leguminosae.
The invention discloses an application of a medicago truncatula gene MtREVOLUTA in cultivating salt-tolerant medicago sativa, which is characterized in that: the method for cultivating salt-tolerant alfalfa is to construct a dicotyledonous plant expression vector pEARLEYGATE100/MtREVOLUTA by using the medicago truncatula gene MtREVOLUTA and to transform the medicago sativa to obtain the transgenic medicago sativa containing the medicago truncatula gene MtREVOLUTA.
Experiments for expressing the medicago truncatula gene MtREVOUTA in medicago sativa prove that a dicotyledonous plant expression vector pEARLEYGATE 100/MtREVOUTA is constructed by using the medicago truncatula gene MtREVOUTA and the medicago sativa is transformed, and the fact that the expression of MtREVOUTA in the medicago sativa is remarkably changed is found, so that a large amount of expression can be realized, and the results are shown in figure 2.
The identified transgenic alfalfa containing the medicago truncatula gene MtREVOUTA and the wild type control alfalfa SY4D are subjected to stress treatment for 5 weeks under the condition of high salt, the effect of the gene MtREVOUTA in alfalfa stress resistance is identified, and the fact that the wild type alfalfa withers, yellows and wilts until death along with the prolonging of the treatment time is found, and the transgenic alfalfa still survives is shown in figure 3.
Statistics were performed on the survival rates of the treated mtravoluta transgenic alfalfa and the wild-type control alfalfa SY4D, and it was found that mtravoluta transgenic alfalfa was significantly improved compared to the wild-type control alfalfa SY4D, as shown in fig. 4.
In the invention, the applicant discloses and verifies that the medicago truncatula gene MtREVOUTA is a medicago truncatula response salt stress regulation gene, which is different from MtREVOUTA found in the past which is only responsible for regulating the development of leaves, and confirms that the transgenic medicago truncatula of the medicago truncatula gene MtREVOUTA can change the expression level of the MtREVOUTA gene so as to improve the salt tolerance of the medicago truncatula of leguminous kindred. Furthermore, the medicago truncatula gene MtREVOLUTA disclosed by the invention can be widely used for cultivating a new stress-resistant leguminous kindred crop variety and can provide a theoretical basis for deeply clarifying a plant stress-resistant mechanism.
The application of the medicago truncatula gene MtREVOLUTA disclosed by the invention in improving the salt tolerance of the medicago sativa of the leguminous kindred forage grass and the method for improving the salt tolerance of the medicago sativa of the leguminous kindred forage grass have the following advantages that: by utilizing the existing plant genetic engineering technology, the salt stress response gene medicago truncatula MtREVOLUTA is transgenically expressed in the medicago sativa for the first time, and comparative analysis proves that the medicago truncatula MtREVOLUTA can be massively expressed in the medicago sativa of leguminous forage grass of the kindred species and the salt tolerance of the transgenically-expressed medicago sativa of the MtREVOLUTA is obviously enhanced. Biological repeated statistical analysis shows that the survival rate of the transgenic plant after high-salt treatment is higher than that of wild alfalfa SY 4D. The application of the medicago truncatula gene MtREVOLUTA in improving the salt tolerance of the medicago truncatula in the kindred forage grass of leguminosae is shown to have important significance and economic value.
Drawings
FIG. 1: qRT-PCR detects that the response expression quantity of MtREVOLUTA to salt stress in Medicago truncatula transgenosis is up-regulated.
The 0h bar graph in the figure shows the amount of MtREVOUTA expression in leaves of one month-sized wild type Medicago truncatula R108 before 100mM NaCl treatment. The 12h bar graph in the figure shows the amount of MtREVOUTA expression in one month-sized leaves of wild-type Medicago truncatula R108 12h after 100mMNaCl treatment. The 24h bar graph in the figure shows the amount of MtREVOUTA expression in leaves of one month-sized wild-type Medicago truncatula R108 24h after 100mMNaCl treatment. Three biological replicates; p <0.05, 25 shoots per batch of plants.
FIG. 2: the RT-PCR detection of the MtREVOTA expression quantity in the leaves of the 35S: MtREV alfalfa transgenic plants of different strains has obvious difference, the expression quantity is high and is named as 35S: MtREV # 1, and the expression quantity is low and is named as 35S: MtREV # 2.
Wherein the upper exclusion diagram indicates the expression level of MtREVOUTA in leaves of wild-type alfalfa SY4D and 35S of different lines of MtREV alfalfa transgenic plants. The lower panel indicates the expression level of housekeeping gene MsActin in leaves of wild-type alfalfa SY4D and different lines of 35S-MtREV alfalfa transgenic plants.
FIG. 3: and the salt tolerance of the transgenic cutting plant of the MtREV #1 purple alfalfa is improved compared with that of a control wild alfalfa SY4D cutting plant after salt treatment for 35S in one month.
A, B, C, D, I, J, K, L, Q, R, S, T shown in the figure shows the growth of wild type alfalfa SY4D and 35S, MtREV # 1 alfalfa transgenic plants before treatment and 1, 2, 3, 4, 5 weeks after treatment initiation, respectively, of the control group without saline. E, F, G, H, M, N, O, P, U, V, W, X shown in the figure show the growth of wild type alfalfa SY4D and 35S: MtREV # 1 alfalfa transgenic plants in the treatment group with 1.5% NaCl saline applied before treatment and 1, 2, 3, 4, 5 weeks after treatment initiation, respectively.
FIG. 4 is a schematic view of: statistical analysis of t-test shows that the survival rate of a 35S: MtREV alfalfa transgenic plant 35S: MtREV #1 is remarkably improved compared with that of a wild type SY4D salt treatment.
Three biological replicates; p <0.05, 25 shoots per batch of plants.
Detailed Description
The present invention will be described in detail with reference to the following detailed drawings and examples. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are only for explaining the present invention and not for limiting the present invention in any form, and any simple modifications, equivalent changes and modifications made to the embodiments according to the technical spirit of the present invention are within the scope of the technical solution of the present invention.
In the examples described below, R108, Tribulus terrestris, was purchased from Noble Research Institute polypeptides; alfalfa SY4D is purchased from Noble Research Institute Mutant varieties. Coli DH5 α, Agrobacterium EHA105 from Shanghai Weidi Biotechnology; vector pENTR-TOPO, expression vector pEARLYGATE100 was purchased from Invitrogen. The nucleotide sequence of the medicago truncatula gene MtREVOLUTA is disclosed in patent CN201710672282.3, and the nucleotide sequence is shown in SEQ ID No. 1.
Other materials, reagents, etc. used, unless otherwise indicated, are commercially available from the open literature.
Example 1: expression analysis of MtREVOLUTA
(1) Cultivation of materials
Moderately polishing hard outer skin of R108 seed of medicago truncatula with sand paper to break dormancy of the seed, culturing at 4 ℃ on wet filter paper for about one week, transferring germinated seed to a seedling raising tray, and placing in an incubator for growth. The environmental conditions of the incubator are as follows: long day (16h/8h), 23 deg.C, 65% humidity, and illumination intensity 150mmol m-2s-1. Growing in a seedling tray for about two weeks (growing the first compound leaf and unfolding the leaf), transferring into a large pot, and placing in a greenhouse for growing. The normal growth conditions in the greenhouse are as follows: long day (16h/8h), 22-25 deg.C, 60-70% humidity, and 150mmol m illumination intensity-2s-1. The culture was incubated to one month size and salt treatment with 100mM NaCl was started. After different treatment times, extracting the RNA of the seedling leaves by a Trizol method.
(2) Extraction of RNA
Preparation work: no RNase gun tip, no RNase EP tube (2.0mL, bead added, 1.5mL), liquid nitrogen, 75% ethanol; instruments such as a table top, a centrifugal machine and the like which need to be used are disinfected by 70% alcohol;
preparing DEPC water: 1000mL of DEPC treated water was added, 1mL of DEPC was added, the volume was adjusted to 1000mL with ultrapure water, and the mixture was stirred overnight with a magnetic stirrer. Then sterilizing with high pressure steam at 123 deg.C for 40min (DEPC is toxic, but decomposed into carbon dioxide and alcohol after sterilization), avoiding pollution as much as possible, and refrigerating at 4 deg.C or room temperature for use.
Extracting total RNA of leaves by TrizoLRT, and mainly comprises the following steps:
1) a sample (less than or equal to 100mg) is put into a 2mL EP tube added with a steel ball, liquid nitrogen is immediately put into the EP tube, the sample is broken by a grinder, and the parameters of the grinder are as follows: 25-30HZ for 60 seconds;
2) adding 1mL of TrizoLRT, and performing vortex oscillation on a constant-temperature mixing machine at 2000rpm for 3 min;
3) adding 400 μ L DEPC water, and performing vortex oscillation with a constant temperature mixing machine at 2000rpm for 3 min; standing for 5min, centrifuging at 12000rpm at room temperature for 15 min;
4) taking the supernatant, transferring the supernatant into a 1.5mL EP tube (in duplicate, 600 uL/tube), adding isopropanol with the same volume, gently mixing the mixture evenly, standing the mixture at room temperature for 15min, centrifuging the mixture at room temperature at 12000rpm for 10min, and removing the supernatant;
5) adding 800 μ L75% ethanol to wash the precipitate, slightly bouncing the precipitate, centrifuging at 4000rpm for 3min at room temperature; and repeatedly washing the precipitate with 75% ethanol, pouring out the supernatant, performing instantaneous centrifugation, completely sucking the ethanol with a gun tip as much as possible, and then placing the precipitate on an ultra-clean workbench for 1-2 min until the edge is semitransparent and taking out.
6) Adding 50 μ L DEPC water, flicking, and performing metal bath at 60 deg.C for 10 min;
7) standing at room temperature for 2min, and measuring concentration on ice.
(3) Reverse transcription to obtain cDNA
A reverse transcription kit: 5 × All-In-One RT MasterMix (with AccuRT Genomic DNA Removal Kit)
1) Putting the extracted RNA and a freezing reagent in the reverse transcription kit on ice, instantly centrifuging after dissolving, collecting a sample at the bottom of a tube, and operating all the following steps on the ice;
2) 200 mu LPCR tubes without RNase were placed on a 96-well ice plate and generally three biological replicates were performed, one reaction total volume being 20. mu.L;
3) the reaction system 1 was added to the tube:
4) putting the reaction system 1 into a PCR instrument, incubating for 2min at 42 ℃, and cooling the tube on ice after the reaction is finished;
5) the tube was then charged with reaction system 2:
denaturing the template and primer mixture and stopping the reaction;
6) finally, the tube was charged with reaction system 3:
7) the above total system was carefully mixed, centrifuged instantaneously at the bottom of the tube, and placed in a PCR instrument, and the reaction procedure was as follows:
after the reaction is finished, the product is stored in a refrigerator at the temperature of-20 ℃.
(4) Real-time fluorescent quantitative PCR
BIO-RAD real-time fluorescence quantitative PCR instrument; SYBR green Mix;
the primer sequences are as follows:
MtREV-qF:GGAAAATGAGAGGCTGCAGAAG；MtREV-qR:TGCTGGCGCATAAATCCAT；MtUBQ-qF:CTGACAGCCCACTGAATTGTGA；MtUBQ-qR:TTTTGGCATTGCTGCAAGC。
the cDNA was diluted to 15 ng/. mu.L as template; forward and reverse primers were mixed in advance at 2.5. mu.M
ReaL-time PCR System (10. mu.L):
SYBR 5μL
primers 2μL
Real-time PCR program:
calculation of relative expression amount according to 2-△△CTThe method is carried out. Statistical analysis using t-test; three biological replicates; denotes P<0.05, and the results are shown in FIG. 1.
FIG. 1 shows: and qRT-PCR detects that the response expression quantity of MtREVOLUTA to salt stress in the medicago truncatula transgenosis is up-regulated. The 0h bar graph in the figure represents the amount of MtREVOUTA expression in leaves of one month-sized wild-type Medicago truncatula R108 before 100mM NaCl treatment. The 12h bar graph in the figure shows the amount of MtREVOUTA expression in one month-sized leaves of wild-type Medicago truncatula R108 12h after 100mMNaCl treatment. The 24h bar graph in the figure shows the amount of MtREVOUTA expression in leaves of one month-sized wild-type Medicago truncatula R108 24h after 100mMNaCl treatment. Three biological replicates; p <0.05, 25 shoots per batch of plants.
Example 2: construction of expression vector for dicotyledonous plant
The following specific primer sequences for amplification of mtravoluta were used:
MtREV-F:CACCATGGCTATGGCTGTTGCAC；
MtREV-qR:GGGGGTTTAAATCCAGCAATAGGTC。
1) and (3) PCR system:
2) PCR procedure:
95℃5min；25～30cycles 95℃ 30s,60℃30s,72℃30s；72℃5min。
3) recovery ligation conversion
After agarose gel electrophoresis of the PCR product, the gel block at the size position of the target fragment was cut into 1.5mL EP tubes. PCR product recovery was performed according to the general agarose gel DNA recovery kit (TIANGEN, DP209) instructions.
The recovered product was ligated to pEntry-T vector (Thermo Fisher Scientific, cat. 12536017), and this plasmid was transformed to give a large number of clones in E.coli DH 5. alpha. LR reaction was performed to connect the gene MtREVOUTA to the expression vector pEARLYGATE100, and the plasmid was extracted and transferred to Agrobacterium strain EHA 105.
Example 3: alfalfa transformation and transgenic plant screening
The culture medium required by the genetic transformation of the alfalfa is prepared according to the following formula.
1) Preparing a culture medium in advance for sterilization, and sterilizing secondary water, a culture dish, filter paper, a triangular flask and a 50mL centrifuge tube.
2) And (5) preparing agrobacterium tumefaciens. Two days before the genetic transformation experiment, the Agrobacterium monoclone or Agrobacterium stock successfully transformed as described in example 2 was picked, and the corresponding antibiotic was loaded with 2mL LB liquid medium and placed on a shaker at 200rpm and 28 ℃ overnight.
3) Expanding propagation of 100 μ L of shaken Agrobacterium liquid, placing in 30-50mL liquid culture medium (containing corresponding antibiotics), culturing overnight at 200rpm28 deg.C, and culturing with Agrobacterium liquid OD600About 0.8-1.0 nm.
4) Sterilizing the surface of the leaf of alfalfa SY 4D. Young and fully expanded healthy leaves were selected for genetic transformation experiments. The removed leaves were taken back to the laboratory on ice. If an ultrasonic method is used, taking a complete compound leaf; if a disc is to be cut, a single blade is taken.
5) And (6) sterilizing. The retrieved leaf was placed in a 50mL lidded centrifuge tube (not too many leaves, too much will result in incomplete sterilization). Adding 30% sodium hypochlorite solution and 1 ‰ Tween-20, inverting the centrifuge tube several times from top to bottom to ensure that each leaf is soaked, and placing in horizontal shaker, and shaking horizontally at low speed for 15min (changing new sodium hypochlorite solution for 7 min). The sodium hypochlorite solution is poured off, and the mixture is washed for 3 to 4 times by changing clear water. After cleaning, the leaves were placed on sterilized filter paper to remove excess water.
6) Inoculating the explant with bacterial liquid and co-culturing. Centrifuging the bacterial solution at 4000rpm for 10min, pouring off the supernatant, gently suspending the supernatant with SM4 liquid medium and diluting the bacterial solution to OD600nm 0.2。
7) Cutting the leaf disc: sterile leaves were placed in sterile petri dishes, the leaf edges were cut off with a sharp sterile blade, and a square leaf disk was cut. During the cutting process, care should be taken to prevent the leaves from drying too much.
8) Infection of agrobacterium: the excised leaf discs were placed in Agrobacterium SM4 liquid medium. The gentle shaking keeps the discs from overlapping each other.
9) Vacuumizing: the Agrobacterium SM4 solution placed in the leaf disc was evacuated for 10min at 0.5 Mbar. To avoid damage to the cells, the vacuum should be switched on and off slowly. And slowly shaking for 5-10 min.
10) And (4) sucking away the bacterial liquid in a clean bench, transferring infected blades to sterilized filter paper, sucking away redundant bacterial liquid around the blades, and avoiding the blades from being dried by wind in the bench. The leaves from the above procedure were transferred to SM4 solid medium (containing 1 mLcefo). The lower surface of the leaf disk was brought into contact with the medium as much as possible.
11) After 5-7 days, the leaf disks were transferred to SM4 solid medium (containing the vector-associated resistance antibiotics added 500mg/L cefo together with selection antibiotics such as Kan 50mg/L, PPT 3mg/L, hyg 10mg/L) and cultured in the plant incubator at 24 ℃ for 4-6 weeks in the dark.
12) When the callus was large enough (typically SM4 selection medium was left for 4-5 weeks), it was transferred to regeneration medium MSBK and cultured for 2 weeks.
13) Transfer to elongation medium MSS until plant growth, typically 6-8 weeks.
14) The plants were transferred to a culture flask in MSR medium. After the seedling has rooted, the robust plant is transplanted into soil.
15) And extracting the DNA of the medicago truncatula. 2 × CTAB (pH8.0) extract (1L) was prepared:
note that: firstly, fixing the volume to 1L, then adding CTAB powder, stirring and dissolving, then placing in a 65 ℃ oven to accelerate dissolution, and storing at room temperature.
16) And carrying out PCR amplification detection on the extracted genome DNA of the alfalfa by using a carrier primer GCACAATCCCACTATCCTTC and a gene reverse primer. RNA-inverted cDNAs of the above-mentioned positive transgenic plants and wild plants were extracted and subjected to RT-PCR detection using gene forward primer TACACTGCTGAACAGATTGAAG and gene reverse primer ACCAGGCTTCATCCCAGGCATC, and the results are shown in FIG. 2.
Internal reference MsActin-F: TTTGAGACTTTCAATGTGCCCGCC and MsACTIN-R: TAGCATGTGGGAGTGCATAACCCT are provided.
The results are shown in FIG. 2.
FIG. 2 shows: the RT-PCR detection of the MtREVOTA expression quantity in the leaves of the 35S: MtREV alfalfa transgenic plants of different strains has obvious difference, the expression quantity is high and is named as 35S: MtREV # 1, and the expression quantity is low and is named as 35S: MtREV # 2. Wherein the upper gel-out plot indicates the expression level of MtREVOLUTA in leaves of transgenic plants of wild-type alfalfa SY4D and different lines of 35S MtREV alfalfa. The lower panel indicates the expression level of housekeeping gene MsActin in leaves of wild-type alfalfa SY4D and different lines of 35S-MtREV alfalfa transgenic plants.
Example 4: 35S MtREV purple-transgenic cuttage seedling salt tolerance analysis
Cutting wild plants and transgenic plants 35S, namely MtREV, into purple flowers, selecting 25 seedlings with consistent cutting survival states, culturing for one month, treating the seedlings in small pots with high-salt 1.5% NaCl for 5 weeks, repeating the organisms for three times, and counting the survival rate.
The results are shown in FIGS. 3 and 4.
FIG. 3 shows: and the salt tolerance of the transgenic cutting plant of the MtREV # 1 purple alfalfa is improved compared with that of a control wild alfalfa SY4D cutting plant after salt treatment for 35S in one month. A, B, C, D, I, J, K, L, Q, R, S, T shown in the figure shows the growth of wild type alfalfa SY4D and 35S, MtREV # 1 alfalfa transgenic plants before treatment and 1, 2, 3, 4, 5 weeks after treatment initiation, respectively, of the control group without saline. E, F, G, H, M, N, O, P, U, V, W, X shown in the figure show the growth of wild type alfalfa SY4D and 35S: MtREV # 1 alfalfa transgenic plants in the treatment group with 1.5% NaCl saline applied before treatment and 1, 2, 3, 4, 5 weeks after treatment initiation, respectively.
FIG. 4 shows: statistical analysis of t-test shows that the survival rate of a 35S: MtREV alfalfa transgenic plant 35S: MtREV # 1 is remarkably improved compared with that of a wild type SY4D salt treatment. Three biological replicates; p <0.05, 25 shoots per batch of plants.
Sequence listing
<110> Shandong university
Application of <120> medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of leguminous kindred forage grass
<141> 2022-03-11
<160>1
<210> 1
<211> 4380
<212> DNA
<213> Artificial sequence
<221> nucleotide sequence of Medicago truncatula gene MtREVOLUTA
<222>（1）…（4380）
<400>1
atggctatgg ctgttgcaca acaacaaaga gataacagca ttgagagaca ccttgattcg 60
tctggcaaat atgtgaggta cactgctgaa cagattgaag ctttggaaaa ggtttatgtg 120
gaatgcccta agcctagttc attgagaagg caacagctga ttcgggagtg cccggttctg 180
gccaacattg agcctaagca gatcaaggtt tggtttcaga ataggaggta atggagattc 240
tgattcacct ttttttgttt gttttgaatt tgtgtcgtgt ggaagggttt ggctcttttt 300
ggttgtgtga tttgatttgt gtctttcttg ttttgcaggt gtagggagaa gcagagaaaa 360
gaggcttctc agcttcagag tgtgaacagg aaactttctg cgatgaataa gctgttgatg 420
gaggaaaatg agaggctgca gaagcaggtt tcacagctgg tgaatgagaa tggatttatg 480
cgccagcaac tacaccctgt aagccctatc attgttcatt ttcattcact actatacatt 540
ttttttttgt gaaatggtaa ttatcattgt ttggttgagg catgtagttg ttgtatgata 600
tgatatgatt tgggttattt tgaatgtaaa tttgtattgt tacttactgt catgtcattg 660
cagaccccag cagctccaaa tgctgacggt agtggcgttg attccgcggc tgctgctcct 720
atgaactcat tgagagatgc taatagccct gctgggtaat tttgaagttc ttgatttgag 780
tgctttttat tttattttaa ttatttcgct tgttgagctt tctttgattg atctttgcag 840
attcctatca attgcggagg agacattgac agagttcctt tcaaaggcta caggaactgc 900
tgtcgattgg gtccagatgc ctgggatgaa ggtagagaat catgtttcta gtggacaatt 960
ggtttttgct tttacaattt tgatactgtg atgattatga catggaggtt aatttccttc 1020
cactaatatc tcatactata tttactttca accattgttt gttagcctgg tccggattcg 1080
gttgggatat ttgccatttc tcaaggtggc aacggagtgg cagctcgagc ctgtggtctt 1140
gttagtttag aacctactaa ggtaattaaa aaggacatgt ggatggatat tttcagtaat 1200
ttcttttgat gttatttatg tagtttgtaa gctatctgaa ttttgaattg ctgaaaaatt 1260
tcaatagatt gtggagatat taaaagatcg cccaacttgg taccgtgatt gtcggagttc 1320
agaagttttc acaatgttcc cagctggaaa tggaggaaca attgaacttg tttacacaca 1380
ggtgaagaat caaatgtgaa taggatgctt tatttattat ttaatgagca ttttgcataa 1440
acgtttagtt tgctgcagac atatgctcca atgacactgg cttctgctcg cgacttctgg 1500
actctaagat acactacaaa tttggaaaac ggaagtgttg tggtgagtat atttgctgtc 1560
aaaagcgtta ctattgttgc atgggattat atatctagct gcatcgattt aatataattg 1620
cactttggaa ggtttgtgaa aggtcactgt ctggtactgg tgctggccct aatgctgcag 1680
ccgcctcaca gtttgagagg gctgaaatgc tccctagtgg ctatttgatt cgaccatgtg 1740
aaggtggagg atcgatcatc cacattgtag accacctaaa cctgcaggtt tgagttcttg 1800
accattagct agaataccta ctatattctt attttctttt catatacatt tttttttttg 1860
accaaaatcc agaattttct tttcatatac attaattaac atgattaaca ttttcttcta 1920
ggcatggagt gtgccagaag tgctgcggcc gatctatgaa tcgtcgcaaa tggtagctca 1980
gagactgaca attgcggtaa gcatagtatt attaattcac gatgtaggat tctattgcaa 2040
gctttggtgg actaatgtga tcaatattat ggcttttgtg caggcacttc gctatatcag 2100
gcaagtagct caagaaacaa gtggtgacgt ggtgtatagc atgggtcggc aacctgcagt 2160
tcttagaact tttagccaac ggttgagcag gtacgtcacg tgaaataaat ttatgcctca 2220
aaacctattt cagccttgct ttttacagaa cgatctgttg tgtttggtaa aaataaattt 2280
aaacatcatt cttgcagagg tttcaatgac gctgtcaatg gattcaatga taatggttgg 2340
tctgttctga actgtgatgg tgctgagggt gttactattt cagtaaattc aatcaagaat 2400
ttgagtggca cttctaatcc agcaagttcc ctttcactcc ttggaggaat tgtctgtgca 2460
aaagcttcta tgttactcca agtaagtgcg taaatccatt ggcatggcgc agtaatcggt 2520
ccttctataa tttaacattt agttcttcta atcgttacac ggaaagtttt cactttgttt 2580
tacttgcaga acaccactcc tgctgtttta gttcgctttc tgagggagca tcgctcggag 2640
tgggctgatt ttagtgttga tgccttttct gctgcatcac ttaaagctgg ctcctatggc 2700
tatcctggaa tgaggtctac aaagttcacc ggcaatcaag caatcatgcc tcttggacat 2760
acaattgaac atgaagaggt atgagagatt ttttgcttgc ttgaccttga ccatgtcttt 2820
ttaagatggt agattcatat ttgcatttgg ctaagatttg gtttatatac tttctatgat 2880
ttggtttata ctgatttctg ttgaaattcc agatgctaga aattatccgc cttgaaggtc 2940
ttgctcaaga tgattctttt gtttctaggg atgttcatct cttacaggtg cttcctctga 3000
cccttgttat ggtttgttta cctgcatgtt tatcggtttt ttgttgttgc ttaattctta 3060
tgatcaccat catcatcgtt tgaacagtta tgtactggaa ttgatgagaa tgctgtgggg 3120
gcttgttccg agctcatatt tgctccaatt gatgacatgt tcccagaaga tgctccctta 3180
gtgccttctg gtttccgcat tgtcctgttg aattctcaac cagttgagtc ccgtttcttg 3240
tatttgattt ttctctaatc ggtactgttc atatatgaag catagtaatc tagttgacat 3300
catattgtgt ttcagggtga tacaaagaac acaacaacag caaatcgaac cttggatttg 3360
acatctggtc ttgaagtaag cccggcaaca gctcatgcta acggagacgc atcgtgtcct 3420
aacaatcgat gtgtgttgac tgttgccttt cagtttcctt ttgagagcgg tctgcaggat 3480
aatgttgcag ccatggcacg tcaatatgtc cggcgtgtag tttctgccgt gcaggcggtt 3540
gcaacggcta tatctccatc cagtgttaac acttctggtg gagcaaagct ctcccctggc 3600
actccagaag cacttacact agctcaatgg atctgccaga gttataggta aagtctgcat 3660
gaatctctga tgttctcttt caaagtttct aacatgattc tctatttacc tctctttcta 3720
tatctcttgt ccgaaagcag tcatcatctg ggcgcgcaac tgctgagatc tgattctctt 3780
attggtgata tgctactgaa acatttgtgg catcatccag atgctatttt atgctgctct 3840
ttgaaggtat gtccatgatc tcattttatg gtacaattga atctggaagt gtataaataa 3900
tgcagtactt cgaagatttt aatgtaactt ctctatcctt gtttggtttt gcagcaagtg 3960
cccgtattca tctttgctaa ccaggctggc cttgacatgt tggaaacaac tctagtggct 4020
ctacaagata tcacactgga caaaatattt gatgagtctg cacgcaagaa tttgattgca 4080
tattttgcga agttaatgca gcaggtaatt tcctggagtt tggcatcatt agcttagctt 4140
ttttttatcg ttacaacctc aaatttgttt taaacaacac accatgctct taagtaaatg 4200
tctgaattgt tgcacggatt ttttttcgtt caggggtttg cttgtatgcc agctgggatc 4260
tgcatgtcaa caatggggcg acatgcttca tatgatcaag ccgtcgcgtg gaaagtgcat 4320
gctgaagaca acagtgttca ttgcttggct ttctcattca ttaattggtc atttatatga 4380
Claims (1)
1. Application of the medicago truncatula gene MtREVOLUTA in improving the NaCl treatment survival rate of medicago sativa SY4D tolerant by 1.5%, wherein the nucleotide sequence of the medicago truncatula gene MtREVOLUTA is shown as SEQ ID No. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110075452.6A CN112626086B (en) | 2021-01-20 | 2021-01-20 | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110075452.6A CN112626086B (en) | 2021-01-20 | 2021-01-20 | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112626086A CN112626086A (en) | 2021-04-09 |
| CN112626086B true CN112626086B (en) | 2022-05-06 |
Family
ID=75294865
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110075452.6A Active CN112626086B (en) | 2021-01-20 | 2021-01-20 | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112626086B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113564198A (en) * | 2021-07-20 | 2021-10-29 | 山东大学 | Application of RNAi (ribonucleic acid interference) on PALM1 gene to increase number of small leaves of leguminous forage |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101338316A (en) * | 2008-08-18 | 2009-01-07 | 山东省农业科学院蔬菜研究所 | Gene BrARGOS for controlling organ sizes of Chinese cabbage and use thereof |
| CN101495640A (en) * | 2006-05-30 | 2009-07-29 | 克罗普迪塞恩股份有限公司 | Plants having enhanced yield-related traits and a method formaking the same |
| CA2865677A1 (en) * | 2012-02-02 | 2013-08-08 | Conicet | Hahb11 provides improved plant yield and tolerance to abiotic stress |
| CN103421829A (en) * | 2013-08-22 | 2013-12-04 | 山东大学 | Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1 |
| CN105039354A (en) * | 2015-08-31 | 2015-11-11 | 哈尔滨师范大学 | Medicago sativa MsSOS3 gene and encoding protein and application thereof |
| CN107299104A (en) * | 2017-08-08 | 2017-10-27 | 山东大学 | Application of the REVOLUTA genes in regulation and control legume vanelets number and leaf-stem ratio |
| CN107787180A (en) * | 2013-09-11 | 2018-03-09 | 中国科学院植物研究所 | Genetically modified plants |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2006332574B2 (en) * | 2005-12-15 | 2012-07-26 | Targeted Growth, Inc. | Increased seed size and seed number through transgenic over expression of a growth and/or development related gene during early embryo development |
| BRPI1015903B1 (en) * | 2010-11-12 | 2019-11-05 | Empresa Brasileira De Pesquisa Agropecuaria Embrapa Cenargen | use of cahb12 coffee homeobox gene in the production of transgenic plants more tolerant to water deficit and salt stress |
| CN105367644B (en) * | 2015-12-23 | 2019-04-12 | 江苏省农业科学院 | Plant stress tolerance related transcription factor and its encoding gene and application |
| CN111423499B (en) * | 2020-03-19 | 2022-02-25 | 山东师范大学 | Thellungiella halophila transcription factor EsbZip60 for regulating and controlling plant antioxidant capacity and salt tolerance, and coding gene and application thereof |
-
2021
- 2021-01-20 CN CN202110075452.6A patent/CN112626086B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101495640A (en) * | 2006-05-30 | 2009-07-29 | 克罗普迪塞恩股份有限公司 | Plants having enhanced yield-related traits and a method formaking the same |
| CN101338316A (en) * | 2008-08-18 | 2009-01-07 | 山东省农业科学院蔬菜研究所 | Gene BrARGOS for controlling organ sizes of Chinese cabbage and use thereof |
| CA2865677A1 (en) * | 2012-02-02 | 2013-08-08 | Conicet | Hahb11 provides improved plant yield and tolerance to abiotic stress |
| CN103421829A (en) * | 2013-08-22 | 2013-12-04 | 山东大学 | Salt-tolerant gene TaAOC1 for wheat and application of salt-tolerant gene TaAOC1 |
| CN107787180A (en) * | 2013-09-11 | 2018-03-09 | 中国科学院植物研究所 | Genetically modified plants |
| CN105039354A (en) * | 2015-08-31 | 2015-11-11 | 哈尔滨师范大学 | Medicago sativa MsSOS3 gene and encoding protein and application thereof |
| CN107299104A (en) * | 2017-08-08 | 2017-10-27 | 山东大学 | Application of the REVOLUTA genes in regulation and control legume vanelets number and leaf-stem ratio |
Non-Patent Citations (4)
| Title |
|---|
| Functional plasticity of miR165/166 in plant development revealed by small tandem target mimic;Xiaoyun Jia et al.;《Plant Science》;20150103;第233卷;第11页摘要、右栏、第12页左栏、第13页左栏第3.1节、第16页右栏-第18页左栏第3.5节、第19页右栏-20页左栏第4.4节 * |
| Genome wide identification, characterization and expression analysis of HD-ZIP gene family in Cucumis sativus L. under biotic and various abiotic stresses;Rahat Sharif et al.;《International Journal of Biological Macromolecules》;20200503;第158卷;第502-520页 * |
| Knockdown of Rice MicroRNA166 Confers Drought Resistance by Causing Leaf Rolling and Altering Stem Xylem Development;Jinshan Zhang et al.;《Plant Physiology》;20180124;第176卷;第2082-2094页 * |
| 紫花苜蓿耐苏打盐碱相关基因的转录组学分析;李红等;《草地学报》;20190731;第27卷(第4期);第848-858页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112626086A (en) | 2021-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Fu et al. | Alfalfa (Medicago sativa L.) | |
| Baskaran et al. | Gene delivery using microinjection of agrobacterium to embryonic shoot apical meristem of elite indica rice cultivars | |
| CN108977445A (en) | Application of the arabidopsis microRNA400 in regulation cadmium-resistant vegetable | |
| CN112626086B (en) | Application of medicago truncatula gene MtREVOLUTA in improving salt tolerance of medicago sativa of kindred forage grass of leguminosae | |
| CN108486149B (en) | Application of cucumber CsWRKY50 gene in enhancing cucumber downy mildew resistance | |
| CN110396510B (en) | Drought-resistant protein, coding gene and application thereof | |
| CN110592115B (en) | Application of arthroncus sylvestris HMT1 gene | |
| CN109456969B (en) | Rice brown planthopper-harming inducible promoter and application thereof | |
| CN113024645B (en) | Application of wheat transcription factor WRKY70 gene in regulation and control of plant growth and development | |
| CN112898391B (en) | Application of cold-resistant gene PtrERF9 of trifoliate orange in genetic improvement of cold resistance of plants | |
| CN104774826B (en) | A kind of histone deacetylase and its encoding gene and application | |
| Kumar et al. | Tissue culture-and selection-independent Agrobacterium tumefaciens-mediated transformation of a recalcitrant grain legume, Cowpea (Vigna unguiculata L. Walp) | |
| CN110699377A (en) | Peanut transgenic method | |
| CN115851821B (en) | Application of BBX16 gene in improving plant salt tolerance | |
| Xu et al. | High-efficiency agrobacterium-mediated transformation of chrysanthemum via vacuum infiltration of internode | |
| Lotz et al. | Towards A Genetic Model Organism: An Efficient Method For Stable Genetic Transformation of Eschscholzia Californica (Ranunculales) | |
| CN115850412B (en) | Soybean GmSUI1 gene and application of encoding protein thereof in phytophthora root rot infection | |
| Sharma et al. | Agrobacterium-mediated transformation and regeneration of transformants of Brassica juncea | |
| CN103320468B (en) | UCH320 protein and application of coding gene thereof in adjusting and controlling plant growth and development | |
| CN113584055B (en) | Pepper PNPAL3 gene and application thereof in resisting blast of peppers | |
| CN111424040B (en) | Cymbidium CgWRKY21 gene and application thereof | |
| Otani et al. | Genetic transformation of sweet potato (Ipomoea batatas (L.) Lam.) by Agrobacterium tumefaciens | |
| CN113249393B (en) | Soybean GmPCBER4 gene, protein and application | |
| CN111304221B (en) | Cymbidium CgWRKY31 gene and application thereof | |
| CN114686492B (en) | Application of MsbHLH115 gene of alfalfa and recombinant vector containing MsbHLH115 gene |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |