CN112592968A - Molecular tag joint for high-throughput sequencing and synthesis method and application thereof - Google Patents
Molecular tag joint for high-throughput sequencing and synthesis method and application thereof Download PDFInfo
- Publication number
- CN112592968A CN112592968A CN202011571217.XA CN202011571217A CN112592968A CN 112592968 A CN112592968 A CN 112592968A CN 202011571217 A CN202011571217 A CN 202011571217A CN 112592968 A CN112592968 A CN 112592968A
- Authority
- CN
- China
- Prior art keywords
- sequence
- joint
- throughput sequencing
- molecular tag
- linker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Abstract
The invention discloses a molecular label joint for high-throughput sequencing and a synthesis method and application thereof, wherein a sequence 1 and a sequence 2 are heated in a hybridization working buffer solution to synthesize a joint A; heating the sequence 3 and the sequence 4 in a hybridization working buffer solution to synthesize a joint B; and mixing the joint A and the joint B to obtain the molecular tag joint for high-throughput sequencing. Aiming at the problems of complex synthesis, detection result accuracy needing to be improved and the like of the existing molecular tag of the Illumina sequencing platform, the invention discloses a novel molecular tag joint for high-throughput sequencing and a synthesis method and application thereof.
Description
Technical Field
The invention belongs to the biotechnology, and particularly relates to a molecular tag joint for high-throughput sequencing, a synthetic method and application thereof, which are used for an Illumina sequencing platform.
Background
Circulating tumor DNA (ctDNA) exists in peripheral blood of a tumor patient, is free DNA (cfDNA) released by tumor cells after necrosis and apoptosis, has short half-life in blood, and can reflect dynamic changes of tumors in real time. The number of tumor cells in a tumor patient is far lower than that of normal cells, the content of cfDNA in plasma is very low, ctDNA only accounts for 0.1% -5% of cfDNA, and the content difference of ctDNA in plasma of the tumor patients with different disease courses is large in different cancer species, so that compared with tissue detection, the detection of ctDNA needs higher sensitivity and specificity.
Currently, the second generation sequencing technology (NGS) for ctDNA liquid biopsy detects a plurality of different variant forms of a plurality of genes simultaneously, and is the most widely used gene detection technology. However, because the NGS experiment process is complicated, some amplification and sequencing errors, called background noise, are inevitably introduced during the library construction, target region capture and sequencing process, and ctDNA detection is often low in mutation frequency and greatly interfered by the background noise, and low-frequency mutations from the ctDNA sample are often submerged in the background noise to cause false negative or false positive results, which limits the sensitivity and specificity of ctDNA detection.
The Molecular barcode is also called a Molecular marker (UMI) and is based on the principle that a specific marker sequence is added to each original DNA fragment, and sequencing is performed together after library construction and PCR amplification. DNA templates from different sources can be distinguished according to different tag sequences, and false positive mutation caused by random errors in the PCR amplification and sequencing processes and true mutation carried by a patient can be distinguished, so that the detection sensitivity and specificity are improved. The existing molecular label has high synthesis cost, complex process, easy error generation and unstable detection result accuracy.
Disclosure of Invention
Aiming at the problems of complex synthesis, detection result accuracy needing to be improved and the like of the existing molecular tag of the Illumina sequencing platform, the invention discloses a novel molecular tag joint for high-throughput sequencing and a synthesis method and application thereof, and the molecular tag joint has the advantages of low cost, simple and convenient annealing operation, poor base balance and high production success rate.
The invention adopts the following technical scheme:
a molecular tag joint for high-throughput sequencing consists of a joint A and a joint B; the joint A is synthesized by a sequence 1 and a sequence 2; linker B was synthesized from seq id No. 3 and seq id No. 4.
A gene high-throughput sequencing method comprises the following steps:
(1) synthesizing a linker A from the sequence 1 and the sequence 2; synthesizing a linker B from the sequence 3 and the sequence 4; mixing the joint A and the joint B to obtain a molecular label joint;
(2) fragmenting nucleic acid, repairing tail end, adding A, and connecting with the molecular tag to obtain a joint connection product;
(3) and sequencing the final amplification product after PCR amplification of the joint connection product to complete gene high-throughput sequencing.
In the invention, the sequence 1 and the sequence 2 are heated in a hybridization working buffer solution to synthesize a linker A; heating the sequence 3 and the sequence 4 in a hybridization working buffer solution to synthesize the linker B. Hybridization buffer included KCl, Tris-HCl, Triton X-100 and water. Heating at 55-58 ℃ for 25-35 minutes, then heating at 35-40 ℃ for 13-16 hours, preferably heating at 56 ℃ for 30 minutes, and then heating at 37 ℃ for 15 hours; further, the temperature is reduced to 4 ℃ after heating and is kept.
In the invention, the sequence 1 is AATGATACGGCGACCACCGAGATCTACAC [ i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNT; the sequence 2 is NNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [ i7] ATCTCGTATGCCGTCTTCTGCTTG; the sequence 3 is AATGATACGGCGACCACCGAGATCTACAC [ i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNVT; the sequence 4 is BNNNNNAGATCGGAAGACACGTCTGAACTCCAGTCAC [ i7] ATCTCGTATGCCGTCTTCTGCTTG.
In the invention, N is selected from A, T, C, G, V is selected from A, C, G, and B is selected from T, G, C. Specifically, N is selected from A, T, C, G, the feeding proportion of A, T, C, G bases at the N position is 25% respectively when the sequences are synthesized, and the synthesized sequences are random mixtures; v is selected from A, C, G, the feeding proportion of A, C, G basic groups at the N position is 1/3 respectively when the sequence is synthesized, and the synthesized sequence is a random mixture; b is selected from T, G, C, the feeding proportion of T, C, G bases at the B position is 1/3 respectively when the sequence is synthesized, and the synthesized sequence is a random mixture.
Preferably, in sequence 1, the 2 nd nucleotide at the 3 terminal is a locked nucleic acid; in the sequence 2, the 1 st nucleotide at the 5 end is locked nucleic acid; in the sequence 3, the 2 nd nucleotide at the 3 end is locked nucleic acid; in the sequence 4, the 1 st nucleotide at the 5 end is a locked nucleic acid. The use of locked nucleic acids ensures that base pairing is strong and aligned annealing is performed at the ends, avoiding the problem of weak binding due to individual base mismatches at random N-pairing.
The invention adopts the joint A and the joint B to form the molecular label joint for high-throughput sequencing, realizes the effect of base balance at specific fixed positions, avoids base imbalance of some fixed positions and improves sequencing accuracy.
In the present invention, [ i5] and [ i7] are index sequences consisting of the base at position 8, such as: AATGACGTT, ATTGAGGT and the like are determined single sequences, are conventional technologies and do not influence the realization of the technical effect of the invention.
In the invention, the conventional technology of fragmenting nucleic acid, repairing tail end and adding A is adopted for a sample, and the sample is a gene for high-throughput sequencing; reacting the sample added with the A with a molecular label joint in the presence of a connecting buffer solution and DNA ligase to obtain a joint connecting product; the reaction is carried out at 20 ℃ for 15 minutes and then kept at 4 ℃, preferably, after the reaction is finished, the reaction product is purified by magnetic beads and eluted by water to obtain supernatant which is a joint connection product.
In the present invention, a 50. mu.L system was used for PCR amplification, and the reaction procedure was heating at 95 ℃ for 3 minutes, then cycling at 98 ℃ for 20 seconds +60 ℃ for 15 seconds +72 ℃ for 15 seconds for 4 times, followed by heating at 72 ℃ for 1 minute, and finally holding at 4 ℃.
In the present invention, the reaction is completed when the temperature is lowered to 4 ℃ and maintained, which is a conventional method in the art. Sequencing of the final amplification product is prior art. The specific formula of the PCR system is selected according to a sample to be detected, and for example, a multiplex primer, an amplification reagent, an i7 primer, an i5 primer, product purification and the like are all selected conventionally.
The invention discloses a new four groups of base sequences, wherein a connector A is synthesized from a sequence 1 and a sequence 2, a connector B is synthesized from a sequence 3 and a sequence 4, and a molecular label connector for high-throughput sequencing is composed of the connector A and the connector B; on the basis of low cost, the annealing operation is simple and convenient, and the base balance is good, so that the detection result accuracy is very high when the method is used for high-throughput sequencing.
Drawings
FIG. 1 shows the distribution of 4N combinations of UMI linkers according to the invention;
FIG. 2 is a 4N combinatorial distribution of non-locked nucleic acid UMI linkers;
FIG. 3 is the detection result of the molecular tag linker for high throughput sequencing according to the present invention;
FIG. 4 shows the detection results of the molecular tag linker for high throughput sequencing according to the present invention.
Detailed Description
In the invention, the synthesis of the sequence 1, the sequence 2, the sequence 3 and the sequence 4 adopts the prior art, the sequence 1 and the sequence 2 are annealed to synthesize the linker A, the sequence 3 and the sequence 4 are annealed to synthesize the linker B, and then the linker A and the linker B are mixed to obtain the molecular tag linker for high-throughput sequencing. The synthesis of the specific sequences in the prior art obtains dry powder, namely four groups of dry powder, corresponding to the sequence 1, the sequence 2, the sequence 3 and the sequence 4, wherein each group of dry powder comprises a plurality of sequences, and each sequence of the invention only needs to be fed once for synthesis, thereby avoiding the problem that the prior art needs to feed materials for many times.
Except for the sequence 1 to the sequence 4, the other reagents (raw materials) involved in the invention are all commercial products, and the specific operation method and the test method are all conventional methods in the field.
Example one
1. Sequence Synthesis
First group of joints
Sequence 1:
5-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNT
sequence 2:
----3-GTTCGTCTTCTGCCGTATGCTCTA[i7]CACTGACCTCAAGTCTGCACACGAGAAGGCTAGANNNNN
second group of joints
And (3) sequence:
5-AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNVT
and (3) sequence 4:
----3-GTTCGTCTTCTGCCGTATGCTCTA[i7]CACTGACCTCAAGTCTGCACACGAGAAGGCTAGANNNNNB
n (ATCG): during synthesis, the feeding proportion of the ATCG base at the N position is respectively 25%, and the synthesized product is a random mixture;
v (ACG): the feeding proportion of ACG base at the V position is 33 percent respectively during synthesis, and the synthesized product is a random mixture;
b (TGC): during synthesis, the feeding proportion of TCG base at the B position is 33 percent respectively, and the synthesized product is a random mixture;
[i5] and [ i7] is an index sequence consisting of 8-base, which is ACATCAGC, GCTTGTGA, respectively;
in the sequence 1, the 2 nd nucleotide at the 3 end is locked nucleic acid; in the sequence 2, the 1 st nucleotide at the 5 end is locked nucleic acid; in the sequence 3, the 2 nd nucleotide at the 3 end is locked nucleic acid; in the sequence 4, the 1 st nucleotide at the 5 end is a locked nucleic acid.
The synthesis method of the above sequence of the present invention is a conventional method.
2. UMI joint annealing
The dry powders synthesized in the sequences 1, 2, 3 and 4 are respectively melted by pure water into stock solutions with the concentration of 100uM in 4 tubes.
Configuring annealing buffer
Take the double-labeled linker with annealing number 40ul 15uM as an example:
2.1, diluting the concentration of the hybridization buffer solution by using pure water to be 1X hybridization working buffer solution;
2.2 numbering the first set (100 uM sequence 1, 100uM sequence 2) of linkers to anneal, the second set (100 uM sequence 3, 100uM sequence 4) of linkers;
and 2.3, taking out 2 PCR tubes, marking the numbers of corresponding annealing joints by tube caps, adding corresponding components according to the following table, uniformly mixing by vortex, centrifuging, and sealing the centrifugal tube caps.
2.4, place PCR tube in PCR, set hot lid temperature to 40 ℃, set program as follows:
cooling to 4 ℃ for storage at 56 ℃/30min +37 ℃/15 h; the joint structure formed after annealing is shown below:
during sequence synthesis, the marked position is synthesized by adopting locked nucleic acid; the invention creatively provides random N pairing, and the combination of the random N pairing and the locked nucleic acid avoids the infirm combination caused by the mismatching of individual bases, thereby ensuring the firmness and the alignment annealing at the tail end and improving the detection preparation.
2.5 the annealed 1 st and 2 nd pipe joints were mixed in equal amounts to obtain 80ul of 15uM joints, called UMI joints, which were used in the following experiments.
In the UMI joint, 4N combinations are distributed as shown in figure 1; for comparison, the locked nucleic acids in the sequences 1 to 4 were replaced with conventional nucleic acids, and the rest were not changed, and 4N combinations of the resulting F-UMI linkers (non-locked nucleic acid UMI linkers) were shown in FIG. 2. The results of routine sequencing are as follows:
application examples
And (3) taking 8 mutation types of EGFR mutation genes as detection samples, setting 2 negative control samples, verifying the detection effect of the UMI joint disclosed by the invention, and comparing the effect with that of a comparison joint.
Preparation of the experiment:
preparation before routine experiments: and (3) taking out Serapure Beads 30min before the experiment, shaking and centrifuging, vertically placing, and shaking and centrifuging before actual use.
Experimental procedure
4.1 Rapid DNA fragmentation/end-filling-in-plus A
A investment of 100ng for constructing a library
A-1, putting each reagent on ice, melting, reversing, mixing uniformly, centrifuging, and preparing the following reaction in a sterilized PCR tube:
and A-2, covering an eight-connecting tube cover, reversing, mixing uniformly, and centrifuging for a short time.
A-3, placed in a PCR machine (Langgy A100/T30) and operated according to the following table, with the program name of the PCR machine < TG1 >.
And A-4, immediately carrying out a joint connection reaction.
Joint connection
4.2.1 thawing the 5 × Ligase buffer, reversing and mixing, and placing on ice for later use.
4.2.2 the components in the following table were added to the reaction tube after the end of the reaction in the above step.
4.2.3 mix by turning over the eight-piece tube cap and centrifuging briefly.
4.2.4 into a PCR machine (Langgy A100/T30) operating according to the following table, the program name of the PCR machine < TG2 >.
4.2.5 purification was performed immediately.
Sample purification operation steps:
1) the PCR tube was centrifuged briefly. Adding 130 mul of uniformly mixed Serapure magnetic beads (1:1.3) into each 100 mul of reaction solution, fully and uniformly mixing, and standing for 2 min at room temperature;
2) placing the PCR tube on a magnetic frame, standing for 5 min, and removing the supernatant;
3) adding 200 mul of 75% ethanol into each tube on a magnetic frame, and removing supernatant;
4) repeating the step 3) once, discarding the supernatant as much as possible, and standing at room temperature until the residual ethanol is completely volatilized;
5) adding 23ul of eluent (10 mM Tris-HCl, pH 8.0-pH 8.5) for elution, fully mixing, standing at room temperature for 5 min, placing a magnetic frame for standing for 2 min, and taking 23ul of supernatant to be stored in a new PCR to be used as a purified Adapter Ligation product.
Library amplification (using KAPA reagents)
4.3.1 prepare the amplification reaction according to the following table:
4.3.2 mix well and centrifuge briefly.
4.3.3 the reaction program in the following Table, program name < KAPAKZ > of PCR apparatus (BioRad T100) was carried out.
4.3.4 after the reaction is finished, the Qubit HS is quantified, the electrophoresis is carried out, the bands are concentrated between 200-400bp, and the first step of initial denaturation is omitted during recycling and the bands directly enter the recycling.
Purification after amplification
A purification step:
1) the PCR tube was centrifuged briefly. Adding 55 mul of uniformly mixed Serapure magnetic beads (1:1.1) into every 50 mul of reaction solution, fully and uniformly mixing, and standing for 2 min at room temperature;
2) placing the PCR tube on a magnetic frame, standing for 5 min, and removing the supernatant;
3) adding 200 mul of 75% ethanol into each tube on a magnetic frame, standing for half a minute, and removing supernatant;
4) repeating the step 3 once, discarding the supernatant as much as possible, and standing at room temperature for 5 min until the residual ethanol is completely volatilized;
5) adding 27ul of ultrapure water for elution, fully and uniformly mixing, standing at room temperature for 5 min, then placing a magnetic frame for standing for 2 min, storing the supernatant into a new PCR for probe capture, and performing QPCR (quantitative polymerase chain reaction) on tissues, whole blood and a leucocyte layer.
5. Sequencing computer
All the libraries after sample purification are mixed and are subjected to machine sequencing (illumina Nextseq 500), the UMI joint connection effect of the invention is shown in attached figures 1 and 2, and the pictures are used as reference to illustrate the actual operation result of the detection of the invention, and the specific mutation frequency is shown in the table below.
And (3) taking 8 mutation types of EGFR mutation genes as detection samples, setting 2 negative control samples, verifying the detection effect of the UMI joint disclosed by the invention, and comparing the effect with that of a comparison joint. The samples were as follows:
the detection results of the UMI joint and the common joint are as follows:
the above-mentioned conventional linker was prepared from the sequences 1-1 and 2-1 in the following table according to the procedure of example-first 2 nd step UMI linker annealing.
[i5] And [ i7] is an index sequence consisting of 8-base, which is ACATCAGC, GCTTGTGA, respectively.
When the detection result of the F-UMI linker (non-locked nucleic acid UMI linker) is examined by taking 23699-KTD024 as a sample, the mutation frequency is 1.06%, and the deviation is slightly larger.
The invention discloses a joint with locked nucleic acid for the first time, four groups of sequences can be obtained by feeding once, and the UMI joint is obtained by conventional annealing.
Sequence listing
<110> Suzhou Kono medical laboratory Co., Ltd
Molecular tag joint for high-throughput sequencing and synthesis method and application thereof
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 76
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
aatgatacgg cgaccaccga gatctacaca catcagcaca ctctttccct acacgacgct 60
cttccgatct nnnnnt 76
<210> 2
<211> 71
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
nnnnnagatc ggaagagcac acgtctgaac tccagtcacg cttgtgaatc tcgtatgccg 60
tcttctgctt g 71
<210> 3
<211> 77
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aatgatacgg cgaccaccga gatctacaca catcagcaca ctctttccct acacgacgct 60
cttccgatct nnnnnvt 77
<210> 4
<211> 72
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
bnnnnnagat cggaagagca cacgtctgaa ctccagtcac gcttgtgaat ctcgtatgcc 60
gtcttctgct tg 72
<210> 5
<211> 70
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aatgatacgg cgaccaccga gatctacaca catcagcaca ctctttccct acacgacgct 60
cttccgatct 70
<210> 6
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
gatcggaaga gcacacgtct gaactccagt cacgcttgtg aatctcgtat gccgtcttct 60
gcttg 65
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
aatgatacgg cgaccaccga gat 23
<210> 8
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
caagcagaag acggcatacg agat 24
Claims (10)
1. A molecular tag joint for high-throughput sequencing consists of a joint A and a joint B, and is characterized in that the joint A is synthesized by a sequence 1 and a sequence 2; the joint B is synthesized by a sequence 3 and a sequence 4; the sequence 1 is AATGATACGGCGACCACCGAGATCTACAC [ i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNT; the sequence 2 is NNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC [ i7] ATCTCGTATGCCGTCTTCTGCTTG; the sequence 3 is AATGATACGGCGACCACCGAGATCTACAC [ i5] ACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNVT; the sequence 4 is BNNNNNAGATCGGAAGACACGTCTGAACTCCAGTCAC [ i7] ATCTCGTATGCCGTCTTCTGCTTG.
2. The molecular tag linker for high throughput sequencing according to claim 1, wherein N is selected from A, T, C, G, V is selected from A, C, G, and B is selected from T, G, C.
3. The molecular tag joint for high throughput sequencing according to claim 1, wherein in the sequence 1, the 2 nd nucleotide at the 3 rd end is a locked nucleic acid; in the sequence 2, the 1 st nucleotide at the 5 end is locked nucleic acid; in the sequence 3, the 2 nd nucleotide at the 3 end is locked nucleic acid; in the sequence 4, the 1 st nucleotide at the 5 end is a locked nucleic acid.
4. The method for preparing the molecular tag joint for high throughput sequencing according to claim 1, which is characterized by comprising the following steps of heating sequence 1 and sequence 2 in a hybridization working buffer solution to synthesize a joint A; heating the sequence 3 and the sequence 4 in a hybridization working buffer solution to synthesize a joint B; and mixing the joint A and the joint B to obtain the molecular tag joint for high-throughput sequencing.
5. The method for preparing molecular tag linkers for high throughput sequencing of claim 4, wherein the hybridization buffer comprises KCl, Tris-HCl, Triton X-100, and water.
6. The method for preparing the molecular tag joint for high throughput sequencing according to claim 4, wherein the heating is performed for 25-35 minutes at 55-58 ℃ and 13-16 hours at 35-40 ℃.
7. The use of the molecular tag linker for high-throughput sequencing according to claim 1 in high-throughput sequencing of genes.
8. The use of claim 7, wherein the gene is a lung cancer gene.
9. A method for high-throughput sequencing of genes, comprising the steps of:
(1) synthesizing a linker A from the sequence 1 and the sequence 2; synthesizing a linker B from the sequence 3 and the sequence 4; mixing the joint A and the joint B to obtain a molecular label joint;
(2) fragmenting nucleic acid, repairing tail end, adding A, and connecting with the molecular tag to obtain a joint connection product;
(3) and sequencing the final amplification product after PCR amplification of the joint connection product to complete gene high-throughput sequencing.
10. The use of the molecular tag linker for high throughput sequencing as claimed in claim 1 in the preparation of a gene high throughput sequencing linker reagent.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011571217.XA CN112592968B (en) | 2020-12-27 | 2020-12-27 | Molecular tag joint for high-throughput sequencing and synthesis method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011571217.XA CN112592968B (en) | 2020-12-27 | 2020-12-27 | Molecular tag joint for high-throughput sequencing and synthesis method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112592968A true CN112592968A (en) | 2021-04-02 |
| CN112592968B CN112592968B (en) | 2022-07-26 |
Family
ID=75202823
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011571217.XA Active CN112592968B (en) | 2020-12-27 | 2020-12-27 | Molecular tag joint for high-throughput sequencing and synthesis method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112592968B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106911A (en) * | 2023-08-14 | 2023-11-24 | 首都医科大学附属北京天坛医院 | Gene set for detecting schwannoma and multiplex PCR-high flux sequencing detection kit thereof |
Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150203887A1 (en) * | 2012-08-23 | 2015-07-23 | Tufts University | Homopolymer mediated nucleic acid amplification |
| CN106086162A (en) * | 2015-11-09 | 2016-11-09 | 厦门艾德生物医药科技股份有限公司 | A kind of double label joint sequences for detecting Tumor mutations and detection method |
| US20170121765A1 (en) * | 2015-10-28 | 2017-05-04 | Republic of Korea (Nat'l Forensic Service Dir., Ministry of Public Admin. and Security) | Primer set for preparation of ngs library and method and kit for making ngs library using the same |
| CN107636166A (en) * | 2015-02-13 | 2018-01-26 | 班纳吉·阿吉特·帕特尔 | The method of highly-parallel accurate measurement nucleic acid |
| CN108148900A (en) * | 2018-01-24 | 2018-06-12 | 深圳因合生物科技有限公司 | Sequencing approach, kit and its application of sequencing mistake are reduced based on molecular label and the sequencing of two generations |
| CN108603220A (en) * | 2015-12-08 | 2018-09-28 | 海菲生物公司 | The analysis method of unicellular transcript profile |
| US20190203283A1 (en) * | 2016-09-13 | 2019-07-04 | Inivata Limited | Methods for labelling nucleic acids |
| CN109971827A (en) * | 2019-03-25 | 2019-07-05 | 纳昂达(南京)生物科技有限公司 | The banking process of plasma dna and build library kit |
| US20200299680A1 (en) * | 2016-04-15 | 2020-09-24 | Menarini Silicon Biosystems S.P.A. | Method and kit for the generation of dna libraries for massively parallel sequencing |
| JP2020533952A (en) * | 2018-06-04 | 2020-11-26 | イルミナ インコーポレイテッド | High-throughput single-cell transcriptome library and how to make and use it |
-
2020
- 2020-12-27 CN CN202011571217.XA patent/CN112592968B/en active Active
Patent Citations (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150203887A1 (en) * | 2012-08-23 | 2015-07-23 | Tufts University | Homopolymer mediated nucleic acid amplification |
| CN107636166A (en) * | 2015-02-13 | 2018-01-26 | 班纳吉·阿吉特·帕特尔 | The method of highly-parallel accurate measurement nucleic acid |
| US20170121765A1 (en) * | 2015-10-28 | 2017-05-04 | Republic of Korea (Nat'l Forensic Service Dir., Ministry of Public Admin. and Security) | Primer set for preparation of ngs library and method and kit for making ngs library using the same |
| CN106086162A (en) * | 2015-11-09 | 2016-11-09 | 厦门艾德生物医药科技股份有限公司 | A kind of double label joint sequences for detecting Tumor mutations and detection method |
| CN108603220A (en) * | 2015-12-08 | 2018-09-28 | 海菲生物公司 | The analysis method of unicellular transcript profile |
| US20200299680A1 (en) * | 2016-04-15 | 2020-09-24 | Menarini Silicon Biosystems S.P.A. | Method and kit for the generation of dna libraries for massively parallel sequencing |
| US20190203283A1 (en) * | 2016-09-13 | 2019-07-04 | Inivata Limited | Methods for labelling nucleic acids |
| CN108148900A (en) * | 2018-01-24 | 2018-06-12 | 深圳因合生物科技有限公司 | Sequencing approach, kit and its application of sequencing mistake are reduced based on molecular label and the sequencing of two generations |
| JP2020533952A (en) * | 2018-06-04 | 2020-11-26 | イルミナ インコーポレイテッド | High-throughput single-cell transcriptome library and how to make and use it |
| CN109971827A (en) * | 2019-03-25 | 2019-07-05 | 纳昂达(南京)生物科技有限公司 | The banking process of plasma dna and build library kit |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117106911A (en) * | 2023-08-14 | 2023-11-24 | 首都医科大学附属北京天坛医院 | Gene set for detecting schwannoma and multiplex PCR-high flux sequencing detection kit thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112592968B (en) | 2022-07-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111575380B (en) | Probe library for multigene detection, hybridization kit and multigene detection method | |
| CN110643680B (en) | Joint suitable for ultra-trace DNA sequencing and application thereof | |
| CN111088365B (en) | Primer and kit for detecting thyroid cancer RET gene mutation and fusion | |
| CN106498082B (en) | Method for constructing ovarian cancer susceptibility gene variation library | |
| US20200216874A1 (en) | Pcr primer pair and application thereof | |
| JP2020512405A (en) | How to quickly build an amplicon library in one step | |
| CN108330546B (en) | A kind of library constructing method and reagent of simplification | |
| CN111690748B (en) | Probe set for detecting microsatellite instability by using high-throughput sequencing, kit and microsatellite instability detection method | |
| CN112266948A (en) | High-throughput targeting library building method and application | |
| CN109337956B (en) | Design method and kit for enriching multi-gene stem-loop probe based on NGS technology | |
| CN112592968B (en) | Molecular tag joint for high-throughput sequencing and synthesis method and application thereof | |
| WO2018113799A1 (en) | Method and test kit for constructing simplified genomic library | |
| CN111690741A (en) | Breast cancer polygene screening probe and application thereof | |
| CN113736878A (en) | Gene panel for detecting nervous system tumor, kit and application thereof | |
| CN112760371A (en) | Primer, kit and analysis method for detecting MUC1 gene mutation | |
| CN111748637A (en) | SNP molecular marker combination, multiplex composite amplification primer set, kit and method for genetic relationship analysis and identification | |
| CN111235242B (en) | Probe library, reagent, kit and application for detecting NTRK gene family fusion gene | |
| CN114196740A (en) | Digital amplification detection method, detection product and detection kit for simultaneously identifying multiple gene types | |
| CN112266963B (en) | Detection kit for combined detection of chronic granulocytic leukemia | |
| CN114736951A (en) | High-throughput sequencing library construction method for small-molecule RNA | |
| CN114277114A (en) | Method for adding unique identifier in amplicon sequencing and application | |
| CN114277146A (en) | Probe combination, kit and application for diagnosing peroneal muscular atrophy | |
| CN113493848A (en) | Mycobacterium tuberculosis drug-resistant type identification method based on nanopore sequencer | |
| WO2020135650A1 (en) | Method for constructing a gene sequencing library | |
| Lyander et al. | NGS method for parallel processing of high quality, damaged or fragmented input material using target enrichment |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |