CN111235242B

CN111235242B - Probe library, reagent, kit and application for detecting NTRK gene family fusion gene

Info

Publication number: CN111235242B
Application number: CN202010352390.4A
Authority: CN
Inventors: 王凯; 陈惠�; 张姣玲; 袁少华; 王维锋
Original assignee: Origimed Technology Shanghai Co ltd
Current assignee: Origimed Technology Shanghai Co ltd
Priority date: 2020-04-28
Filing date: 2020-04-28
Publication date: 2020-08-14
Anticipated expiration: 2040-04-28
Also published as: CN111235242A

Abstract

The invention provides a probe library for detecting NTRK gene family fusion genes, a detection reagent comprising the probe library, application of the detection reagent in preparation of a kit for detecting the NTRK gene family fusion genes, a corresponding kit and a detection method, wherein the probe library comprises: a first probe group and a second probe group, wherein the detection of the fusion gene of the NTRK gene family is carried out based on the combination of a DNA layer and an RNA layer; the first probe group is used for DNA level detection and capture, the second probe group is used for RNA level detection and capture, and the first probe group comprises any one or more probes with the nucleotide series shown in SEQ ID NO.1-SEQ ID NO. 170; the second probe group comprises any one or more probes in the nucleotide series of SEQ ID NO.21-EQ ID NO. 170.

Description

Probe library, reagent, kit and application for detecting NTRK gene family fusion gene

Technical Field

The invention belongs to the field of biology, and particularly relates to a probe library for detecting NTRK gene family fusion genes, a detection reagent comprising the probe library, application of the detection reagent in preparation of a kit for detecting the NTRK gene family fusion genes, a corresponding kit and a detection method.

Background

NTRK is a gene encoding a neurotrophic tyrosine receptor kinase, and three genes of NTRK1, NTRK2, and NTRK3 (NTRK 1/2/3) are a family of genes, and play an important role in maintaining survival and normal function of the nervous system. The fusion of NTRK and other genes has been found to be associated with the development of a variety of tumors. Although the incidence of NTRK fusion is less than 5% in common tumors, in some rare tumors such as salivary gland tumors, infantile fibroids, the NTRK fusion rate can reach over 90%. In 11 months in 2018, the FDA in the united states has approved the use of larotinib (larotrectitinib) for treating adult and child locally advanced or metastatic solid tumor patients carrying NTRK fusion genes, in 1 month in 2019, the third edition of NCCN is beginning to be more than one of the new NTRK gene family fusion genes as target genes for the treatment of non-small cell lung cancer, and at present, a plurality of new drugs targeting the NTRK gene family fusion genes are in clinical experiments. The drugs show obvious clinical benefit in various tumors, so that the rapid and accurate detection of NTRK gene family fusion is of great importance for the research and development of drugs taking the NTRK gene family fusion gene as a target and the evaluation of self-medication selection of tumor patients.

At present, the detection techniques commonly used for fusion genes at home and abroad include Fluorescence In Situ Hybridization (FISH) technique, Immunohistochemistry (IHC), fluorescence PCR method, and NGS (high throughput sequencing) method.

FISH is considered a gold standard for detection of gene fusions. The kit has the advantages of high stability, high sensitivity, good specificity, short experimental period and the like, but can only detect one target at a time, needs special tissue and multi-target part detection, has 3 genes for NTRK, needs to detect fusion of multiple positions, needs to detect multiple FISH probes, has no commercialized probe at present, has obvious False Positive (FP) or False Negative (FN), can only detect from a DNA level, and has high detection cost; compared with the current molecular detection method, IHC is more economical and faster, but IHC can only be detected from a protein level, certain subjectivity always exists in result interpretation, and judgment of weak positive results needs to be further verified by technologies such as FISH; the fluorescence PCR technology has the advantages of simple and easy operation, short detection time, high sensitivity, good specificity, clear and visual result judgment and wide application range, but only a few fusion genes of specific NTRK fusion partner can be detected, and the detection can be only carried out from the RNA layer. In addition, since FISH and IHC cannot know detailed gene sequences, the identification of genes (partner) participating in fusion cannot be achieved, and specific fusion breakpoints and sequence information cannot be definitely known; fluorescent PCR can only be used for detecting according to known fusion design probes and primers, but can not detect unknown fusion.

The high-throughput sequencing technology can sequence millions of short sequences in parallel, and has been widely applied to the detection of tumor mutation, however, the current NGS method only judges the DNA sequencing, which easily causes the missing detection on the RNA level.

Disclosure of Invention

The invention provides a probe library for detecting NTRK gene family fusion genes, a detection reagent comprising the probe library, application of the detection reagent in preparation of a kit for detecting the NTRK gene family fusion genes, a corresponding kit and a detection method.

In order to achieve the purpose, the invention adopts the following technical scheme:

an object of the present invention is to provide a probe library for detecting fusion genes of the NTRK gene family, comprising: a first probe group and a second probe group, wherein the detection of the fusion gene of the NTRK gene family is carried out based on the combination of a DNA layer and an RNA layer; the first probe group is used for DNA level detection and capture, the second probe group is used for RNA level detection and capture, and the first probe group comprises any one or more probes with the nucleotide series shown in SEQ ID NO.1-SEQ ID number 170; the second probe group comprises any one or more probes in the nucleotide series as shown in SEQ ID NO.21 EQ ID number 170.

The probe library provided by the invention is also characterized in that the first probe group comprises all the probes with the nucleotide series shown in SEQ ID NO.1-SEQ ID number 1702.

The probe pool provided by the invention also has the characteristic that the second probe group comprises all the probes with the nucleotide series shown in SEQ ID NO.21-SEQ ID number 170.

The probe library provided by the present invention is also characterized in that the fusion gene that can be detected includes: any one of the genes included in the NTRK gene family is fused to any one of AFAP1, AGBL4, ARHGEF2, BCAN, BCR, BTBD1, CD74, CHTOP, EML4, ETV6, IRF2BP 6, LMNA, MPRIP, MYO5 6, NACC 6, NFASC, P2RY 6, PAN 6, PLEKHA6, PPL, QKI, RBPMS, SCYL 6, sq3672, SSBP 6, STRN, TFG, TP 6, TPM 6, TPR 6, TRAF 6, TRIM6, VCL, ZNF710, ntl 6, IRF2BP 6, ak3672, PRDX 6, SLC25a 72, RRNAD 6, MEF 26, WDR 6, setma 6, and tnikma genes.

Still another object of the present invention is to provide a detection reagent for detecting fusion gene of NTRK gene family, comprising: such as the probe library described above.

The detection reagent provided by the present invention is also characterized by further comprising: reagents required by RNA nucleic acid reverse transcription treatment, reagents required by the construction process of gDNA library and cDNA library construction, reagents required by gDNA capture library and cDNA capture library except probe library, DNA negative quality control substances, DNA positive quality control substances, RNA negative quality control substances and RNA positive quality control substances.

Still another object of the present invention is to provide a use of a detection reagent for preparing a kit for detecting a fusion gene of NTRK gene family, characterized in that: the detection reagent is the detection reagent.

The invention also provides an application, which is characterized in that: wherein, the detection of the NTRK gene family fusion gene comprises the following steps: step 1, obtaining a library: respectively constructing and performing library amplification treatment on DNA nucleic acid extracted from a sample to be detected and RNA nucleic acid extracted from the sample to be detected through reverse transcription treatment to obtain a corresponding gDNA library and a corresponding cDNA library; step 2, obtaining a capture library: respectively acquiring corresponding capture products by adopting the hybrid capture of a first probe group in a probe library and a gDNA library and the hybrid capture of a second probe group in the probe library and a cDNA library, respectively performing capture amplification treatment, and then purifying to respectively acquire a corresponding gDNA capture library and a cDNA capture library; step 3, sequencing on the computer: sequencing the gDNA capture library and the cDNA capture library by a high-throughput sequencing method to respectively obtain corresponding gDNA sequencing data and cDNA sequencing data; step 4, fusion analysis: performing letter generation analysis by adopting gDNA sequencing data to obtain fusion information of a DNA layer, performing letter generation analysis by adopting cDNA sequencing data to obtain fusion information of an RNA layer, and combining the fusion gene of the DNA layer and the fusion gene of the RNA layer to perform reliability judgment to obtain a positive fusion result.

The invention also provides an application, which is characterized in that: wherein, in step 1, the total amount of the DNA nucleic acid extracted from the sample to be detected satisfies the following requirements: greater than or equal to 50ng and less than or equal to 500 ng; the total amount of RNA nucleic acid extracted from a sample to be detected meets the following requirements: greater than or equal to 100 ng.

The invention also provides an application, which is characterized in that: wherein, in the step 1, when the extracted RNA nucleic acid is subjected to reverse transcription treatment, cDNA is synthesized and purified to obtain purified cDNA nucleic acid; and respectively carrying out nucleic acid fragmentation treatment on the extracted DNA nucleic acid and the purified cDNA nucleic acid to respectively obtain nucleic acid fragments for constructing a gDNA library and a cDNA library.

The invention also provides an application, which is characterized in that: wherein, the construction processes of the gDNA library and the cDNA library are as follows: performing linker connection after the terminal repair and the addition of A, and performing primary purification again to obtain a corresponding purified linker connection product, wherein the reaction system and the reaction procedure of the terminal repair and the addition of A are shown in tables 11 and 12 respectively; the reaction system and reaction procedure for linker attachment are shown in tables 13 and 14, respectively.

The invention also provides an application, which is characterized in that: wherein, the purified adaptor ligation products for forming gDNA library and cDNA library respectively are subjected to library amplification treatment and purification treatment after amplification to obtain gDNA library and cDNA library respectively, and the reaction system of library amplification treatment is shown in Table 15; (1) pre-operation is carried out for 3 minutes at 98 ℃; (2) denaturation at 98 ℃ for 20 seconds; (3) annealing at 60 ℃ for 15 seconds; (4) annealing at 72 ℃ for 30 seconds; (5) keeping the temperature at 72 ℃ for 5 minutes; wherein said steps (2) - (4) are repeated for 5-13 cycles.

The invention also provides an application, which is characterized in that: wherein, when the total amount of DNA nucleic acid extracted from the sample to be detected is 50ng, steps (2) - (4) are repeated for at least 7 cycles, and when the total amount of DNA nucleic acid extracted from the sample to be detected is 500ng, steps (2) - (4) are repeated for at least 3 cycles; repeating the steps (2) - (4) for at least 7 cycles when the total amount of RNA nucleic acid extracted from the sample to be detected is 50ng, and repeating the steps (2) - (4) for at least 5 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 500 ng; when the total amount of cDNA obtained by reverse transcription of RNA nucleic acid extracted from a sample to be tested is 5ng, the steps (2) to (4) are repeated for at least 12 cycles.

The application provided by the invention is characterized in that: in the step 2, in the capture amplification treatment, a library capture amplification mixed solution is prepared according to table 23, 30 μ L of the library capture amplification mixed solution is transferred to a 0.2ml PCR tube filled with the capture product, the mixture is vortexed, mixed and microcentrifuged, and then the mixture is placed into a PCR instrument for capture amplification reaction, and the reaction program of the capture amplification treatment comprises: (1) pre-operating at 98 ℃ for 45 seconds; (2) denaturation at 98 ℃ for 15 seconds; (3) annealing at 60 ℃ for 30 seconds; (4) annealing for 1 minute at 72 ℃; (5) and (3) maintaining the temperature at 72 ℃ for 1 minute, wherein said steps (2) - (4) are repeated for 11-13 cycles for a capture amplification treatment corresponding to a gDNA library, and said steps (2) - (4) are repeated for 12-14 cycles for a capture amplification treatment corresponding to a cDNA library.

The invention also provides a kit for detecting the NTRK gene family fusion gene, which is characterized by comprising: and (b) a detection reagent, wherein the detection reagent is the detection reagent.

The kit provided by the invention is characterized in that: wherein, the detection reagent further comprises: reagents required by RNA nucleic acid reverse transcription treatment, reagents required by the construction process of gDNA library and cDNA library construction, reagents required by gDNA capture library and cDNA capture library except probe library, DNA negative quality control substances, DNA positive quality control substances, RNA negative quality control substances and RNA positive quality control substances.

The kit provided by the invention is characterized in that: wherein, when the kit is used, the total amount of the required DNA nucleic acid meets the following requirements: 50ng or more and 500ng or less, and the total amount of the required RNA nucleic acid is required to satisfy: greater than or equal to 100 ng.

The kit provided by the invention is characterized in that: wherein, the DNA negative quality control substance is DNA of a constructed wild type cell line, the DNA positive quality control substance is DNA of a constructed ETV6-NTRK3 fusion cell line, the RNA negative quality control substance is RNA of a constructed wild type cell line, and the RNA positive quality control substance is RNA of a constructed ETV6-NTRK3 fusion cell line.

The invention also provides a detection method for non-diagnostic treatment of fusion genes of the NTRK gene family, which is characterized in that: and detecting the fusion gene based on a specific probe library, wherein the fusion gene is detected based on a DNA layer and an RNA layer, and the probe library is the probe library.

The detection method provided by the invention is characterized by comprising the following steps of: step 1, obtaining a library: respectively constructing and performing library amplification treatment on DNA nucleic acid extracted from a sample to be detected and RNA nucleic acid extracted from the sample to be detected through reverse transcription treatment to obtain a corresponding gDNA library and a corresponding cDNA library; step 2, obtaining a capture library: respectively acquiring corresponding capture products by adopting the hybrid capture of a first probe group in a probe library and a gDNA library and the hybrid capture of a second probe group in the probe library and a cDNA library, respectively performing capture amplification treatment, and then purifying to respectively acquire a corresponding gDNA capture library and a cDNA capture library; step 3, sequencing on the computer: sequencing the gDNA capture library and the cDNA capture library by a high-throughput sequencing method to respectively obtain corresponding gDNA sequencing data and cDNA sequencing data; step 4, fusion analysis: performing letter generation analysis by adopting gDNA sequencing data to obtain fusion information of a DNA layer, performing letter generation analysis by adopting cDNA sequencing data to obtain fusion information of an RNA layer, and combining the fusion gene of the DNA layer and the fusion gene of the RNA layer to perform reliability judgment to obtain a positive fusion result.

The detection method provided by the invention is characterized in that: wherein, in step 1, the total amount of the DNA nucleic acid extracted from the sample to be detected satisfies the following requirements: greater than or equal to 50ng and less than or equal to 500 ng; the total amount of RNA nucleic acid extracted from a sample to be detected meets the following requirements: greater than or equal to 100 ng.

The detection method provided by the invention is characterized in that: wherein, in the step 1, when the extracted RNA nucleic acid is subjected to reverse transcription treatment, cDNA is synthesized and purified to obtain purified cDNA nucleic acid; and respectively carrying out nucleic acid fragmentation treatment on the extracted DNA nucleic acid and the purified cDNA nucleic acid to respectively obtain nucleic acid fragments for constructing a gDNA library and a cDNA library.

The detection method provided by the invention is characterized in that: wherein, the construction processes of the gDNA library and the cDNA library are as follows: performing linker connection after the terminal repair and the addition of A, and performing primary purification again to obtain a corresponding purified linker connection product, wherein the reaction system and the reaction procedure of the terminal repair and the addition of A are shown in tables 11 and 12 respectively; the reaction system and reaction procedure for linker attachment are shown in tables 13 and 14, respectively.

The detection method provided by the invention is characterized in that: wherein, the purified adaptor ligation products for forming gDNA library and cDNA library respectively are subjected to library amplification treatment and purification treatment after amplification to obtain gDNA library and cDNA library respectively, and the reaction system of library amplification treatment is shown in Table 15; the reaction procedure for the library amplification treatment included: (1) pre-operation is carried out for 3 minutes at 98 ℃; (2) denaturation at 98 ℃ for 20 seconds; (3) annealing at 60 ℃ for 15 seconds; (4) annealing at 72 ℃ for 30 seconds; (5) keeping the temperature at 72 ℃ for 5 minutes; wherein said steps (2) - (4) are repeated for 5-13 cycles.

The detection method provided by the invention is characterized in that: wherein said steps (2) - (4) are repeated for at least 7 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 50ng, and said steps (2) - (4) are repeated for at least 3 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 500 ng; when the total amount of cDNA obtained by reverse transcription of RNA nucleic acid extracted from a sample to be tested is 5ng, the steps (2) to (4) are repeated for at least 12 cycles.

The detection method provided by the invention is characterized in that: in the step 2, in the capture amplification treatment, a library capture amplification mixed solution is prepared according to table 23, 30 μ L of the library capture amplification mixed solution is transferred to a 0.2ml PCR tube filled with the capture product, the mixture is mixed by vortex, subjected to microcentrifugation and then placed into a PCR instrument for capture amplification reaction, and the reaction procedure of the capture amplification treatment comprises: (1) pre-operating at 98 ℃ for 45 seconds; (2) denaturation at 98 ℃ for 15 seconds; (3) annealing at 60 ℃ for 30 seconds; (4) annealing for 1 minute at 72 ℃; (5) and (3) maintaining the temperature at 72 ℃ for 1 minute, wherein said steps (2) - (4) are repeated for 11-13 cycles for a capture amplification treatment corresponding to a gDNA library, and said steps (2) - (4) are repeated for 12-14 cycles for a capture amplification treatment corresponding to a cDNA library.

The probe library comprises a first probe group and a second probe group, the first probe group is used for DNA level detection and capture, the second probe group is used for RNA level detection and capture, and the probe library is verified to have good detection specificity and high sensitivity on the NTRK gene family fusion gene, so that the NTRK gene family fusion gene can be detected based on the combination of the DNA level and the RNA level, the complementation of the detection information of the DNA level and the RNA level is realized, the problems that the probe cannot be completely covered due to too large NTRK gene family intron area, the DNA level missing detection is caused, and the problems that a sample is unstable, the RNA sample is easy to degrade and the like are solved, Poor quality or RNA level omission due to low expression level; in addition, the probe catches on the NTRK family gene, so that another gene (Partner) which is connected with the NTRK family and participates in fusion can be pulled down together, the Partner gene can be known through comparison with a human genome, and a specific fusion site can be positioned, so that not only can known fusion be determined, but also unknown Partner and a corresponding fusion site of NTRK fusion or an unknown fusion site of known Partner can be found out, and thus, another gene which participates in fusion and a corresponding fusion site of the fusion gene can be analyzed, so that the realization of a new fusion gene can be facilitated, and the application in drug development can be facilitated; fusion breakpoint and sequence information can be known definitely, so that DNA level rearrangement and RNA level fusion information can be obtained, and fusion formed by rearrangement generated by NTRK DNA level structure variation and alternative splicing of RNA level can be detected; and because the DNA process and the RNA are detected before and after the machine is started, the detection of one process is not needed, a positive result is not detected, and the other branch is started, so that the time can be saved, and more time can be won for patients.

Drawings

FIG. 1 is a support log display of a TPR exon 21-NTRK1 exon 9 fusion gene involved in example 7;

FIG. 2 shows the results of IHC assay with TPR exon 21-NTRK1 exon 9 fusion gene in example 7;

FIG. 3 shows the results of one-generation sequencing of fusion gene of TPR exon 21-NTRK1 exon 9 involved in example 7;

FIG. 4 is a schematic diagram of the fusion of the TPR exon 21-NTRK1 exon 9 fusion gene involved in example 7.

Detailed Description

The following specifically describes embodiments of the present invention.

The known fusions referred to herein refer to: another gene known to be specifically involved in fusion and fusion genes of the NTRK gene family of the corresponding fusion site;

the unknown fusions referred to herein include two aspects:

(1) the unknown fusion site of Partner is known: the gene refers to another gene participating in fusion for a certain NTRK gene family fusion gene, belongs to a fusion partner already recognized in the NTRK gene family fusion gene, but does not know a corresponding fusion site;

(2) unknown Partner and corresponding fusion site for NTRK fusion: it means that another gene involved in fusion among the fusion genes of the NTRK gene family is not disclosed, let alone the corresponding fusion site.

The methods used in the examples are conventional methods unless otherwise specified; the materials, reagents and the like used are commercially available unless otherwise specified.

Example 1

The following examples are intended to specifically describe the probe, the detection reagent, the application, the kit, the corresponding detection method, and the like according to the present invention.

In the embodiment, a specific probe library capturing and reversible end termination sequencing technology is adopted to extract and purify deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) in a formalin-fixed paraffin-embedded solid tumor tissue (FFPE) sample, then a DNA and cDNA sample sequencing library is constructed, a target region of the library is captured and enriched by using the specific probe library, and the captured library is subjected to high-throughput sequencing, so that the one-time detection of multiple fusion forms of DNA and RNA double-layer surfaces of NTRK gene family fusion genes is realized.

The probe library of this example was prepared by designing a fusion partner gene, such as AFAP1, AGBL4, ARHGEF2, BCAN, BCR, BTBD1, CD74, CHTOP, EML4, ETV6, IRF2BP2, LMNA, MPRIP, MYO5A, NACC2, NFASC, P2RY8, PAN3, PLEKHA6, PPL, QKI, RBPMS, SCYL3, SQSTM1, SSBP2, STRN, TFG, TP53, TPM3, TPM4, TPR, TRAF2, TRIM24, TRIM63, VCL, ZNF710, using all exon families, extracting corresponding exon sequences, extracting the intron sequences, designing a corresponding intron sequence, designing a high-specificity probe, and screening a whole genome fragment with a high specificity, using a whole genome fragment of the probe, and a high-specificity, and using a whole genome fragment of the probe library^-20And screening the probes less than 20 times compared to other regions to ensure the comprehensiveness and specificity of the probes, thereby screening the probe library. Wherein, Evalaue shows the possibility that other sequences have similarity higher than that of the target sequence under random conditions, so that the lower the score of the sequence is, the higher the reliability of the sequence alignment result is, and the stricter threshold value evalaue smaller than e is used in the design of the probe^-20(ii) a In addition, since the probe sequence is only 120bp and is a short sequence, other regions can be aligned for multiple times when the whole genome is aligned, and in order to ensure the alignment specificity, the smaller the number of times of alignment to other regions is, the better the number of times of alignment to other regions is selected to be smaller than 20 (a stricter threshold value for the NGS probe).

The probe design uses strict threshold screening, and can still ensure the high specificity of the probe, which also indicates that the design effect of the probe library related to the embodiment is better.

Specifically, the probe library related to the present embodiment includes a first probe group and a second probe group, wherein the first probe group and the second probe group are respectively used for DNA level detection and capture, and the first probe group includes any one or more probes shown in SEQ ID No.1-SEQ ID number 170 in the nucleotide series; the second probe group comprises any one or more probes in the nucleotide series of SEQ ID No.21-SEQ ID number 170. Preferably, the first probe group includes all probes having the nucleotide series shown in SEQ ID No.1-SEQ ID number 170. The second probe group includes all probes having a nucleotide sequence shown in SEQ ID NO.21-SEQ ID NO. 170.

The probe library provided in this example can be used to detect both known and unknown fusion genes, for example: any of the genes included in the NTRK gene family is fused to any of AFAP1, AGBL4, ARHGEF2, BCAN, BCR, BTBD1, CD74, top, EML4, ETV6, IRF2BP 6, LMNA, MPRIP, MYO5 6, NACC 6, NFASC, P2RY 6, PAN 6, PLEKHA6, PPL, QKI, rbamopms, SCYL 6, sqbp 6, SSBP 6, STRN, TFG, TP 6, TPM 6, TPR, TRAF 6, TRIM6, tmamol, ZNF710, zntl 6, IRF2BP 6, AKAP 6, pr3672, dx 25a 6, RRNAD 6, MEF 26, vcwdr 6, setk 6, and tfma genes.

According to the probe, the embodiment also provides a detection method for non-diagnostic treatment of the fusion gene of the NTRK gene family, the fusion gene of the NTRK gene family is detected from a DNA level and an RNA level based on the probe library, so that the detection rate and the detection accuracy of the fusion gene of the NTRK gene family can be improved, and accurate and useful references are provided for research and development of related medicines taking the fusion gene of the NTRK gene family as targeted treatment and evaluation of self-medication selection of tumor patients.

Specifically, the detection method of the present embodiment relates to the detection reagents shown in table 1.

The specific main components of the names of the components shown in Table 1 are shown in Table 2.

Wild type means that no fusion of the NTRK family genes occurred.

In the above detection method, the FFPE sample is used for detection, and the collection of samples from different sources can be performed as follows:

white slices:

1. the white sheet has a thickness of 4-5 μm and a surface area greater than 1cm². The surgical tissue is cut into 15 pieces continuously, and the biopsy tissue is cut into 25 pieces continuously.

The baking time is controlled within 10-15 minutes, and each slice needs to be marked with a pathological number (no direct examination of the rolled slices).

2. The bone tumor tissue to be examined needs to examine the wax block/section of the tumor part without bone as much as possible. Bone tumor tissue wax blocks/sections were not examined for decalcification.

3. Multiple tumor wax masses are usually preserved for one operation. Selecting wax block/slice with high tumor content and no necrotic tissue for inspection.

Fresh tissue:

1. size of the surgical tissue: not less than 0.5x0.5x0.5 cm³And is less than or equal to 2x2x2 cm³。

2. When the material is taken, the area with more tumor tissues is selected, and necrotic and ulcer tissues are avoided.

3. The bone tumor tissue should be examined as far as possible to examine the tumor part without bone. Bone tumor tissue treated with decalcification was not examined.

4. The tissue was placed in the surgical tissue sample tube in the test pack as soon as possible (within 10 minutes) after the tissue was isolated.

Biopsy tissue:

1. the diameter of the puncture biopsy tumor sample is more than or equal to 1mm, the length is more than or equal to 10mm, and the number of the puncture biopsy tumor samples is 2 or more.

2. The size of the maize in other biopsy tumor tissues is 2 grains or more.

3. If the necrotic component is more in the biopsy tumor tissue, the biopsy is needed again.

4. The tissue was placed in the puncture tissue sample tube in the test pack as soon as possible (within 10 minutes) after the tissue was isolated.

The detection method specifically comprises the following steps:

step 1, obtaining a library: the corresponding gDNA library and cDNA library are obtained after respectively constructing and performing library amplification treatment through reverse transcription treatment of DNA nucleic acid extracted from a sample to be detected and RNA nucleic acid extracted from the sample to be detected. The method comprises the following steps:

1. nucleic acid extraction FFPE sample nucleic acid extraction is carried out by using a matched DNA/RNA extraction kit according to an instruction. The gDNA concentration of the extracted gDNA sample is measured by using a Qubit-region-integration-time-domain-sequence-integration (Qubit-integration-time-domain-integration) dsDNA HS Assay Kit and a matched instrument thereof, and the total gDNA amount is more than or equal to 50 ng; the RNA concentration of the extracted RNA sample is measured by using a Qubit-box RNA HS Assay Kit and a matched instrument thereof, and the total amount of RNA is more than or equal to 100 ng. If the next operation is not carried out immediately, gDNA should be stored at-25 ℃ to-15 ℃ and RNA at-95 ℃ to-65 ℃.

2. Reverse transcription treatment of RNA

2.1 Synthesis of cDNA

2.1.1 the components shown in Table 3 were removed, thawed at room temperature, shaken and mixed, and the reaction system was prepared in a 0.2mL PCR tube according to Table 3.

Samples to be tested shown as m in table 3: if the total amount of the RNA sample is more than or equal to 1000ng, taking 1000ng of the RNA sample;

if the total amount of RNA is less than 1000ng and is more than or equal to 100ng, all RNA samples are taken. The total volume is no more than 13.25. mu.L.

Quality control items shown by n in table 3: 5 mu L of each RNA negative quality control product and RNA positive quality control product is taken.

2.1.2 gently blow, mix well and microcentrifuge, collect the liquid to the bottom of the tube, and react according to the procedure in Table 4.

2.1.3 after the reaction, 0.2mL PCR tubes were immediately removed and incubated on ice for 5 min.

2.1.4 microcentrifuge 0.2mL PCR tube to collect the liquid to the bottom of the tube, add the reaction system as in Table 5.

2.1.5 gently blow and mix well, and after microcentrifugation, collect the liquid to the bottom of the tube, and react according to the procedure in Table 6.

After 2.1.6 microcentrifuges in 0.2mL PCR tubes, the liquid was collected at the bottom of the tube and added to the reaction system prepared in Table 7.

2.1.7 gently blow and mix well, and after microcentrifugation, collect the liquid to the bottom of the tube, and react according to the procedure in Table 8.

2.2 magnetic bead purification

Purification using Agencour AMPure XP Beads is recommended.

2.2.1 beads were equilibrated at room temperature for 30min and vortexed thoroughly, 144. mu.L was taken to a new 1.5 mL centrifuge tube.

2.2.2 transfer the product of the duplex synthesis to a 1.5 mL centrifuge tube in step 2.2.1, vortex to mix well and incubate for 5min at room temperature.

2.2.3 put 1.5 mL centrifuge tube in magnetic rack, let stand until the solution is completely clear, discard the supernatant (avoid attracting magnetic beads).

2.2.4 Add 200. mu.L of freshly prepared 80% ethanol and incubate for 30 sec at room temperature. The supernatant was discarded.

2.2.5 repeat step 2.2.4.

2.2.6 placing 1.5 mL centrifuge tube in magnetic frame, standing for 1min, discarding residual solution, opening cover and drying at room temperature until ethanol is completely volatilized. During the period, the surface of the magnetic beads is observed to be non-reflective (excessive drying is not needed so as to prevent the magnetic beads from cracking and influencing the purification effect).

2.2.7 Add 34. mu.L of nucleic-Free Water, vortex and mix, incubate for 2min at room temperature, place on magnetic rack after microcentrifugation, transfer 32. mu.L of supernatant to a new labeled 1.5 mL centrifuge tube after the solution is completely clarified.

2.3 determination of cDNA concentration

The cDNA concentration was determined using the nucleic acid quantification Kit, the Qubit-region dsDNA HS Assay Kit and the Kit.

Thus, a purified cDNA nucleic acid was obtained.

3. Fragmentation of nucleic acids

The goal of nucleic acid fragmentation is to obtain nucleic acid molecule fragments of about 300bp in size, suggesting the use of ultrasonic fragmentation, suggesting a Covaris LE220-plus fragmentation platform.

3.1 gDNA fragmentation

3.1.1 taking 5 mu L of each DNA negative quality control material and DNA positive quality control material in the kit to synchronously detect with a sample to be detected. If the total gDNA amount is more than or equal to 500ng, taking a gDNA sample of 500 ng; if the total gDNA amount is less than 500ng and is not more than 50ng, all gDNA samples are taken. When the volume of the gDNA solution was less than 50. mu.L, it was made up to 50. mu.L with TE Buffer.

3.1.2 vortex and mix gDNA sample to be interrupted evenly, then microcentrifuge and transfer to microTUBE.

3.1.3 fragmentation was performed under the conditions shown in Table 9.

3.1.4 fragmentation procedure was completed, microTUBE tubes were microcentrifuged and all transferred to labeled new 0.2ml PCR tubes.

3.2 fragmentation of cDNA

3.2.1 make up the cDNA to 50. mu.L using TE Buffer.

3.2.2 vortex the cDNA to be disrupted (i.e., the purified cDNA), mix well, microcentrifuge, and transfer to microTUBE.

3.2.3 fragmentation was performed according to the conditions shown in Table 10.

3.2.4 fragmentation procedure at the end, microTUBE tubes were microcentrifuged and all transferred to labeled new 0.2ml PCR tubes.

Thus, nucleic acid fragments for the construction of the gDNA library and cDNA library, respectively, were obtained.

4. Library construction Process

4.1 end repair plus A

4.1.1 the end-repair mixture was thawed and mixed by inversion and the reaction system was prepared as in Table 11 in 0.2mL PCR tubes at steps 3.1.4 and 3.2.4.

4.1.2 lightly blow and mix evenly, do not shake and mix evenly, collect the liquid to the tube bottom after the microcentrifugation. The reaction was carried out according to the procedure shown in Table 12.

4.2 Joint connection

4.2.1 thawing the ligase buffer, mixing the solution by inversion, and placing the solution on ice for standby.

4.2.2 in a 0.2mL PCR tube obtained by adding step A to the end-repairing reaction system, a reaction system was prepared according to Table 13.

In table 13, the linker described in a is recommended to use IDT UDI Adapter Kit. When the amount of cDNA added is 10ng or less, the linker is diluted 20 times (with nucleic-Free Water) and used.

4.2.3 gently blow and mix, do not shake and mix, collect the liquid to the tube bottom after the microcentrifugation. The reaction was carried out according to the procedure shown in Table 14.

4.3 purification of the product

Purification using Agencour AMPure XP Beads is recommended. (pass standard after purification).

4.3.1 the beads were equilibrated at room temperature for 30min and vortexed thoroughly, 80. mu.L was taken to a new 1.5 mL centrifuge tube.

4.3.2 transfer 100. mu.L of the ligation product to a 1.5 mL centrifuge tube in step 4.3.1, vortex to mix well and incubate for 5min at room temperature.

4.3.3 Place 1.5 mL centrifuge tube in magnetic rack, let stand until the solution is completely clear, discard the supernatant (avoid attracting magnetic beads).

4.3.4 mu.L of freshly prepared 80% ethanol was added, incubated at room temperature for 30 sec, and the supernatant was discarded.

4.3.5 repeat step 4.3.4.

4.3.6 placing 1.5 mL centrifuge tube in magnetic frame, standing for 1min, discarding residual solution, opening cover and drying at room temperature until ethanol is completely volatilized. During the period, the surface of the magnetic beads is observed to be non-reflective (excessive drying is not needed so as to prevent the magnetic beads from cracking and influencing the purification effect).

4.3.7 mu.L of nucleic-Free Water was added, vortexed, incubated at room temperature for 2min, microcentrifuged and placed on a magnetic rack, and 20. mu.L of supernatant was transferred to a new labeled 0.2mL PCR tube after the solution was completely clarified.

The above library was performed on the nucleic acid fragments constructed from the gDNA library and cDNA library, respectively

And (3) a construction process, wherein purified adaptor ligation products for forming the gDNA library and the cDNA library are obtained respectively.

4.4 library amplification treatment

4.4.1 thawing the library construction amplification primer and the library construction amplification buffer solution, and then reversing and mixing evenly.

4.4.2 the reaction was prepared in a 0.2mL PCR tube for the product purification step as per Table 15.

4.4.3 gently blow and beat, mix without shaking, and after microcentrifugation, collect the liquid to the bottom of the tube. Amplification was performed according to the procedure of Table 16.

The reaction procedure for the library amplification process in table 16, with the hot lid portion removed, is specifically described as including:

(1) denaturation at 98 ℃ for 3 min;

(2) denaturation at 98 ℃ for 20 seconds;

(3) annealing at 60 ℃ for 15 seconds;

(4) annealing at 72 ℃ for 30 seconds;

(5) annealing for 5 minutes at 72 ℃;

wherein said steps (2) - (4) are repeated for 5-13 cycles.

In Table 16, the number of cycles shown in b is the number of repeated cycles of steps (2) to (4), and the appropriate number of cycles is selected according to the sample input amount and the purified adaptor ligation product to obtain sufficient library for enrichment, which is specifically recommended as follows:

recommending: the input of 50ng gDNA is at least 7 PCR cycles, and the input of the sample can be reduced by 1 PCR cycle for each 1-fold increase. At least 3 PCR cycles at a loading of 500ng gDNA, i.e., when the total amount of DNA nucleic acid extracted from the sample to be tested is 50ng, steps (2) - (4) are repeated for at least 7 cycles, and when the total amount of DNA nucleic acid extracted from the sample to be tested is 500ng, steps (2) - (4) are repeated for at least 5 cycles;

recommending: 5ng of cDNA is input for at least 12 PCR cycles, namely, the steps (2) to (4) are repeated for at least 12 cycles, and the input amount of the sample can be reduced by 1 PCR cycle every time the input amount of the sample is increased by 1 time; for each 1-fold reduction in sample input, 1 PCR cycle can be increased.

4.5 post-amplification purification treatment

Purification using Agencour AMPure XP Beads is recommended.

4.5.1 the beads were equilibrated at room temperature for 30min and vortexed thoroughly, 50. mu.L was taken to a new 1.5 mL centrifuge tube.

4.5.2 transfer 50. mu.L of PCR product to a 1.5 mL centrifuge tube in step 4.5.1, vortex and mix well and incubate for 5min at room temperature.

4.5.3 put 1.5 mL centrifuge tube in magnetic rack, let stand until the solution is completely clear, and discard the supernatant. Avoiding the attraction to the magnetic beads.

4.5.4 mu.L of freshly prepared 80% ethanol was added, incubated at room temperature for 30 sec, and the supernatant was discarded.

4.5.5 repeat step 4.5.4.

4.5.6 placing the 1.5 mL centrifuge tube of step 4.5.5 after microcentrifugation on a magnetic frame, standing for 1min, discarding the residual solution, opening the cover and drying at room temperature until the ethanol is completely volatilized. During the period, the surface of the magnetic beads is observed to be non-reflective (excessive drying is not needed so as to prevent the magnetic beads from cracking and influencing the purification effect).

4.5.7 adding 32 μ L of nucleic-Free Water, mixing by vortexing, incubating at room temperature for 2min, placing in a magnetic rack after microcentrifugation, transferring 30 μ L of supernatant to a new labeled 1.5 mL centrifuge tube after the solution is completely clarified.

Thus, purified adaptor-ligated products for forming a gDNA library and a cDNA library, respectively, are subjected to the above-described library amplification treatment, and subjected to the above-described post-amplification purification treatment, thereby obtaining a gDNA library and a cDNA library, respectively.

Note: if the gDNA library and cDNA library are not immediately subjected to the next test, they should be stored at-25 ℃ to-15 ℃.

4.6 library quality control

4.6.1 the concentrations of gDNA library and cDNA library were determined using the nucleic acid quantification Kit Qubit-size-variable dsDNA HS Assay Kit and its associated instrument, respectively, the total amount of gDNA library and cDNA library should be greater than or equal to 500 ng. Otherwise, the library sample is not in accordance with the requirement, and the library is to be rebuilt.

4.6.2 the lengths of the gDNA library and cDNA library fragments were determined using the DNA High Sensitivity Reagent Kit and its associated instrument, respectively. Both gDNA and cDNA libraries should correspond to: the main peak is within the range of 200-700 bp, and no obvious small fragment and large fragment mixed peak exists. Otherwise, the library sample is not in accordance with the requirement, and the library is to be rebuilt.

Step 2, obtaining a capture library: and respectively acquiring corresponding capture products by adopting the hybridization capture of a first probe group in the probe library and the gDNA library and the hybridization capture of a second probe group in the probe library and the cDNA library, respectively performing capture amplification treatment, and purifying to respectively acquire a corresponding gDNA capture library and a corresponding cDNA capture library. The method comprises the following steps:

1. library mix drain

1.1 mix multiple libraries into one pool in a new 1.5 mL centrifuge tube. DNA and cDNA libraries prohibit intermixing.

It is recommended to mix 4 DNA or cDNA libraries with similar amplification efficiency (500 ng per library is recommended) into one pool (total amount of 1000-2000 ng per pool). It is recommended that the DNA positive quality control substance and the DNA negative quality control substance library are mixed into pool, and the RNA positive quality control substance and the RNA negative quality control substance library are mixed into pool.

1.2 blocking buffer was prepared in a new 1.5 mL centrifuge tube as per Table 17.

1.3 after mixing, 6. mu.L of blocking buffer was added to each pool.

1.4 after fully whirling and uniformly mixing, carrying out microcentrifugation to collect liquid at the bottom of the tube, opening the tube, sealing 4-5 layers by using a sealing membrane, and pricking 5 small holes on the membrane by using a 10uL filter element-containing pipette suction head without DNase and RNase.

1.5 placing the centrifuge tube in a vacuum concentrator for pumping, and after 10 min, confirming whether the solution is pumped out every 5 min.

2. Library re-solubilization, denaturation and hybrid Capture

2.1 in a new 1.5 mL centrifuge tube, prepare hybridization reaction solution according to Table 18, vortex, mix well and centrifuge for use.

In table 18, the gDNA library shown in c uses the first probe group; the cDNA library uses a second probe population.

2.2 slightly removing the film on the drained library centrifuge tube, adding 17 mu L of hybridization reaction liquid, fully whirling and uniformly mixing, then carrying out microcentrifugation to collect the solution to the bottom of the hole, and standing at room temperature in a dark place for 10 min to redissolve.

2.3 vortexing again, microcentrifuging, transferring the entire 17. mu.L of fluid to a pre-prepared and labeled 0.2mL PCR tube, and collecting the fluid to the bottom of the tube after microcentrifugation. Hybridization was carried out according to the procedure of Table 19.

3, Buffer preparation & streptavidin M270 magnetic bead cleaning

It is recommended that Dynabeads of Thermo Fisher Scientific M270 Streptavidin (Streptavidin M270 magnetic beads) be used for capture.

3.1 open the thermostatic metal bath, the temperature is set at 67 ℃.

3.2 taking out the streptavidin M270 magnetic beads, and balancing for 30min at room temperature.

3.3 taking out the mother liquor in the table, thawing at room temperature, shaking and mixing uniformly, and preparing the working cleaning buffer solution according to the table 20.

In Table 20, the solution was carefully examined before preparing the washing buffer 1 indicated by d, and if there were milky white particles, the washing buffer 1 was heated above a 67 ℃ metal bath until the solution was clear and transparent.

3.4 placing W1-2 and W4 on a metal bath with a constant temperature of 67 ℃ for standby.

3.5 in a new 1.5 mL centrifuge tube, prepare the magnetic bead resuspension buffer as in Table 21.

3.6 vortex streptavidin M270 magnetic beads to mix for about 1 min. Take 10. mu.L/pool into a new 1.5 mL centrifuge tube.

3.7 adding 20. mu.L/pool of uniformly mixed MagW, gently blowing and uniformly mixing for 10 times, placing on a magnetic frame, standing for 1min until the solution is completely clarified, and discarding the supernatant to ensure that the magnetic beads are not absorbed.

3.8 repeat 5.3.7 times.

3.9 Add 17 u L/pool magnetic bead resuspension buffer to resuspend the magnetic beads, micro-centrifuge and collect the resuspension to the bottom of the tube. Transfer to a new labeled 0.2mL PCR tube. Place on the PCR machine of the reaction program of Table 22 and preheat for about 2 min.

4. Capturing and washing

4.1 prepare a 3-fold pool number of new 1.5 mL centrifuge tubes and preheat them in a 67 ℃ metal bath.

4.2 transfer all preheated 17. mu.L of magnetic beads to a 0.2mL PCR tube for hybridization, vortex, mix, microcentrifuge, and place in the PCR apparatus of 5.3.9 reaction program.

4.3 incubate for 45 min, during which the beads are resuspended every 12 min.

4.4 after the incubation, 100. mu.L of preheated W1-2 was put into the sample tube and blown to mix well 10 times to avoid generating excessive bubbles. All were transferred to a 1.5 mL centrifuge tube preheated in step 5.4.1.

4.5 vortex and mix evenly for 5 sec, put 1.5 mL centrifuge tube on magnetic frame after microcentrifugation, stand until the solution is completely clear, discard the supernatant.

4.6 Add 150. mu.L of preheated W4 to the sample tube, vortex for 5 sec to avoid excessive bubbling, and transfer the entire mixture to a new preheated 1.5 mL centrifuge tube.

4.7 placing on a 67 ℃ metal bath for incubation for 5 minutes, vortexing and mixing uniformly for 5 sec, placing a 1.5 mL centrifuge tube on a magnetic frame after microcentrifugation, standing until the solution is completely clear, and discarding the supernatant.

4.8 repeat steps 4.6 to 4.7 once.

4.9 Place 150. mu. L W1-1 into a 1.5 mL centrifuge tube and vortex to mix.

4.10 incubation at room temperature for 2min, during which 30 sec of standing and 30 sec of shaking cycle operation.

4.11 after microcentrifugation, place 1.5 mL centrifuge tube on magnetic rack, let stand for 1min until the solution is completely clear, and discard the supernatant.

4.12 Place 150. mu. L W2 into a 1.5 mL centrifuge tube and vortex to mix.

4.13 incubation at room temperature for 2min, during which 30 sec of standing and 30 sec of shaking cycle operation.

4.14 after microcentrifugation, place 1.5 mL centrifuge tube on magnetic rack, let stand for 1min until the solution is completely clear, and discard the supernatant.

4.15 Place 150. mu. L W3 into a 1.5 mL centrifuge tube and vortex to mix.

4.16 incubation at room temperature for 2min, during which 30 sec of standing and 30 sec of shaking cycle operation.

4.17 after microcentrifugation, place 1.5 mL centrifuge tube on magnetic rack, let stand for 1min until the solution is completely clear, and discard the supernatant.

4.18 centrifugation, discard all W3 residue.

4.19 Take 20. mu.L of nucleic-Free Water to the sample tube, pipette 10 times of resuspension beads into a well, and transfer all the resuspension to a new labeled 0.2mL PCR tube.

Thus, corresponding capture products are obtained for the gDNA and cDNA libraries, respectively.

5. Amplification of captured products

5.1 in a new 1.5 mL centrifuge tube, the library capture amplification mix was prepared as in Table 23.

5.2 transfer 30. mu.L of library Capture amplification mixture to a 4.19 0.2mL PCR tube, vortex, mix, microcentrifuge, and place in a PCR instrument for amplification according to the procedure in Table 24.

^*

The reaction program in table 24, capturing the amplification process, removing the hot lid portion, is specifically described as including:

(1) pre-operating at 98 ℃ for 45 seconds;

(2) denaturation at 98 ℃ for 15 seconds;

(3) annealing at 60 ℃ for 30 seconds;

(4) annealing for 1 minute at 72 ℃;

(5) at 72 ℃ for 1 minute.

Wherein said steps (2) - (4) are repeated for 11-13 cycles for a capture amplification treatment corresponding to a gDNA library and said steps (2) - (4) are repeated for 12-14 cycles for a capture amplification treatment corresponding to a cDNA library.

In table 24, the corresponding cycle indicated by e is the number of repeated cycles of steps (2) to (4): the appropriate number of cycles is chosen based on the initial amount of capture to obtain enough library to enrich, as follows:

recommending: the initial amount of capture of 2000ng gDNA library was 11 PCR cycles, and the initial amount of capture of the library was reduced, which allowed the number of PCR cycles to be increased appropriately.

Recommending: initial amount of 2000ng cDNA library capture was 12 PCR cycles, and the initial amount of library capture was decreased, which increased the number of PCR cycles appropriately.

6. Post amplification purification treatment

Purification using Agencour AMPure XP Beads is recommended.

6.1 the beads were equilibrated at room temperature for 30min and vortexed thoroughly, and 75. mu.L was taken to a new 1.5 mL centrifuge tube.

6.2 transfer all library capture amplification products to the 1.5 mL centrifuge tube of step 5.6.1, vortex and mix well, incubate for 5min at room temperature.

6.3 put 1.5 mL centrifuge tube in magnetic rack, let stand until the solution is clear, discard the supernatant. Care was taken to avoid attraction to the beads.

6.4 Add 200. mu.L of freshly prepared 80% ethanol, incubate for 30 sec at room temperature, discard the supernatant.

6.5 repeat step 6.4 once.

6.6 placing the 1.5 mL centrifuge tube in a magnetic frame for standing for 1min, discarding the residual solution, opening the cover and drying at room temperature until the ethanol is completely volatilized. During the period, the surface of the magnetic beads is observed to be non-reflective (excessive drying is not needed so as to prevent the magnetic beads from cracking and influencing the purification effect).

6.7 Add 22 u L nucleic-Free Water, vortex mixing, room temperature incubation for 2min, after micro centrifugation placed in magnetic frame, after the solution is completely clear transfer 20 u L supernatant to new labeled 1.5 mL centrifuge tube.

7. Quality control of captured libraries

7.1 the concentration of the captured library is determined by using a nucleic acid quantitative Kit Qubit dsDNA HS Assay Kit and a matched instrument thereof, and the total amount of the library is more than or equal to 5 ng. Otherwise, the quality control is unqualified, the capture is needed again and the quality inspection is carried out, and if the total amount of the captured library is unqualified again, the inspection is stopped.

7.2 the length of the captured library fragment was determined using the DNA High Sensitivity Reagent Kit and its associated instrument. The main peak is within the range of 200-700 bp, and no obvious small fragment and large fragment mixed peak exists. Otherwise, the quality control is unqualified, the acquisition and the quality inspection are required again, and if the quality control is unqualified again, the inspection is stopped.

Thus, a gDNA capture library and a cDNA capture library were obtained, respectively.

Step 3, sequencing on the computer: separately capturing libraries of gDNA by high throughput sequencing methods

And sequencing the cDNA capture library to respectively obtain corresponding gDNA sequencing data and cDNA sequencing data.

Step 4, fusion analysis: DNA was obtained by using gDNA sequencing data for biological analysis

The fusion information of the layers is obtained by performing a letter generation analysis using cDNA sequencing data to obtain fusion information of RNA layers, and the fusion gene of the DNA layer and the fusion gene of the RNA layer are combined to perform a reliability determination to obtain a positive fusion result, for example, in this embodiment, the reliability determination is as follows:

when the detection results of the fusion genes respectively detected on the DNA layer and the RNA layer are consistent, the obtained fusion gene pair is a positive fusion result;

and when the fusion gene results detected by the DNA layer and the RNA layer are not consistent, judging whether the fusion genes detected by the DNA layer or the RNA layer are known fusion genes of the public database respectively, judging the fusion genes to be known fusion genes as a positive fusion result, and if the judgment results are not known fusion genes, using the fusion genes detected by the RNA layer as the positive fusion result.

In the detection process:

(1) when the extracted RNA nucleic acid is subjected to reverse transcription, cDNA is synthesized

Then purifying to obtain purified cDNA nucleic acid, then performing nucleic acid fragmentation treatment to respectively obtain nucleic acid fragments for constructing a cDNA library, namely firstly transcribing, then purifying and then fragmenting nucleic acid, so that compared with the method of firstly purifying RNA, fragmenting RNA and then reversely transcribing RNA, the stability of an RNA sample can be ensured, because: a. mRNA is single-stranded, unstable; b. a large amount of RNase exists in the air, and RNA is easily degraded; synthesizing double-chain cDNA, purifying and fragmenting to make the intermediate product more stable and not easy to degrade, and the template for transferring has more diversity;

(2) during library construction, after the end repair is performed and A is added, the joint connection is performed, and the end repair and A are purified again and are added together, and the purification is performed once, so that the manual operation time and steps and the time of the whole process are reduced; and one-time purification reduces the loss of template diversity caused by the increase of purification times;

(3) in the whole process, the input amount (sample adding amount) can influence the success rate of detection, the obtained libraries can be guaranteed to be in the amount within the proper range within the sample adding amount standard (50-1000 ng) set in a laboratory, and the inventor recommends that the recommended required amount of each library is 500ng so as to guarantee certain detection success rate and detection consistency. Thus, it is necessary to determine an appropriate sample amount range, and thus: for DNA nucleic acids extracted from a sample to be tested, at least 50ng, preferably at most 500ng, of total amount of nucleic acid extracted is used; similarly, in the case of RNA, the total amount of nucleic acid extracted is at least 100ng, and at most 1000ng is recommended, and since RNA is used after reverse transcription into cDNA, on the premise that RNA satisfies the above range, at least 5ng of cDNA is required in the subsequent reaction. On the other hand, in the case of a constant sample addition amount, the most direct influence on the library yield is the number of PCR amplification cycles of (2) to (4) above in the library amplification treatment: too high PCR cycle number can result in amplification and increased preference in the library process, and too low PCR cycle number can result in insufficient library yield and can not meet the requirements of subsequent quality control and on-capture sequencing. In this embodiment, the number of cycles of the library amplification treatment (steps (2) - (4)) is small (50 ng of DNA nucleic acid may be as few as 7 times, 500ng of DNA nucleic acid may be as few as 3 times, while 5ng of reverse-transcribed cDNA of RNA nucleic acid may be as few as 12 times, 30ng of reverse-transcribed cDNA of RNA nucleic acid may be as few as 8 times, 50ng or more, referring to the amount of gDNA used), so that it can be avoided that due to the large number of cycles, duplicate (duplicate reads are generated in the case of duplicate reads analysis at the end of production, and only unique reads are retained), thereby avoiding that the amount of data distributed in the target region is small in the case of the same amount of sequencing data, and thus improving the accuracy of the detection result. Similarly, the number of cycles (2) to (4) in the capture amplification in this example also ensures a smaller number.

The embodiment also provides an application of a detection reagent in preparing a kit for detecting the fusion gene of the NTRK gene family, wherein the detection reagent comprises the probe library, preferably, in the application, the detection reagent is the detection reagent in the detection method, and the detection method is adopted in the method for detecting the fusion gene of the NTRK gene family.

Accordingly, the present embodiment also provides a kit for detecting fusion genes of the NTRK gene family, the kit comprising the above detection reagents, that is, the above probe library. In the use of the kit, the total amount of DNA nucleic acid required is 50ng or more, and the total amount of RNA nucleic acid required is 100ng or more.

Example 2

This example is an optimization experiment to illustrate the number of cycles of library amplification treatment.

The input amount (sample adding amount) can influence the success rate of detection, and the detection success rate and the detection consistency are reduced to different degrees when the concentration is higher or lower than the concentration range within the sample adding amount standard (50-1000 ng) set in a laboratory. Therefore, in the library construction process, a suitable loading range needs to be determined, so that: for the DNA nucleic acid extracted from the sample to be detected, in example 1, at least 50-500ng of the total amount of the extracted nucleic acid is taken, wherein 50ng is the minimum dosage, namely the minimum gDNA input amount which can be detected in the example; similarly, for RNA, the total amount of extracted nucleic acid is at least 100ng, i.e., the minimum amount of RNA that can be detected in this example.

Under the condition of a certain sample adding amount, the link which most directly influences the library yield is the PCR amplification cycle number; too high PCR cycle number can result in amplification and increased preference in the library process, and too low PCR cycle number can result in insufficient library yield and can not meet the requirements of subsequent quality control and on-capture sequencing. Therefore, it is necessary to determine the range of PCR amplification cycle numbers at different sample amounts.

Optimization of library amplification treatment corresponding to gDNA nucleic acid samples

The number of samples selected for different inputs and the number of repetitions of the optimization test are shown in Table 25.

According to Table 25, 4 FFPE samples were selected for each input amount, and different cycles (PCR cycles) were performed for (2) to (4) in the library amplification treatment.

1) The yields were evaluated as follows:

a) yield (fluorescent dye method)

The concentration of the sample DNA library was determined using the Qubit dsDNA HS Assay Kit. The total yield of the library was calculated by multiplying the measured concentration by the volume of the eluent. The optimal number of PCR cycles was determined by library throughput for different numbers of PCR amplification cycles (the fewer PCR cycles, the less amplification bias generated during library enrichment, given the conditions for library capture).

b) Library fragment size and distribution

The quality control of the library was performed using LabChip GX Touch. The size of the library fragments is in the expected range, no obvious small fragment and large fragment hybrid peaks exist, and the closer the distribution of the library fragments is to the normal distribution, the better the distribution is.

2) Based on the evaluation results, the test results are shown in Table 26.

As can be seen from Table 26, the library yield results of different PCR amplification cycles, 250 sample addition, the library yield of the sample is close to 500ng under 3 PCRcycles, and according to the PCR principle, the yield is increased by 2 times every cycle, so at least 4 cycles can be used as the lowest amplification cycle under 250ng sample addition; under the condition of 500ng of sample loading, the library yield of the sample is higher than 500ng under 3 PCRcycles, and the redundancy is enough and can be used as the lowest amplification cycle number under the condition of 500ng of sample loading; however, the library yield of one sample is less than 500ng under 6 PCR cycles with 50ng loading, and the requirement of subsequent library capture cannot be met, so that if the library yield of 500ng is to be met, the lowest cycle number should be 7 under 50ng loading.

Optimization of library amplification treatment for RNA nucleic acid samples

Because the yield of the cDNA reverse transcription of the RNA is influenced by the quality of the RNA sample, the yield of the cDNA of different RNA samples is different under the condition of a certain input amount of the RNA in the reverse transcription link, and the cDNA yield is generally within the range of 10ng-100ng according to the existing experimental data. For cDNA yields of 50ng or more, the cycle numbers refer to cycle numbers of gDNA.

According to Table 27, 1 FFPE sample was selected for each input amount, and different cycles (PCR cycles) were performed for (2) to (4) in the library amplification treatment.

1) Evaluation parameters

a) Yield (fluorescent dye method)

The concentration of the sample cDNA library was determined using the Qubit dsDNA HS Assay Kit. The total yield of the library was calculated by multiplying the measured concentration by the volume of the eluent. The experimental parameters of the library framework kit for cDNA library construction are preliminarily tested through the output of libraries with different sample input quantities. To meet the requirements of subsequent quality control and library capture, it is recommended that the library yield be at least 500ng or greater.

b) Library fragment size and distribution (capillary electrophoresis)

The quality control of the library was performed using LabChip GX Touch. The size of the library fragment is in an expected range (based on the sample fragmentation result), no obvious small fragment and large fragment mixed peak exists, and the closer the distribution of the library fragment is to the normal distribution, the better the distribution is.

2) Results of the experiment

Sample input amount preliminary testing library yield results:

table 28 shows that at all three sample additions and corresponding PCR cycles, the library yields were 500ng or greater and the library labchip was qualified (5 ng sample addition of library with adaptor residue); the yield of the library was low at 30ng loading, but the redundancy was sufficient for use.

Example 3

In this example, the probe library provided in example 1 and the corresponding kit are used, and the detection method provided in example 1 is used to detect different samples, so as to verify the specificity of the probe library provided in example 1, and the detection results are shown in table 29.

In table 29:

(1) the sequence numbers 1 to 3 are samples known to be not fusion of other NTRK family fusion genes, and according to the results, the detection results show that the NTRK is negative by adopting the probe and the method in the embodiment 1, namely the NTRK family fusion genes are not detected, thereby showing that the probe library in the embodiment 1 can not capture the fusion genes of the non-NTRK family;

(2) the sample with the sequence number 4 is bacteria without NTRK family fusion genes, and the detection result shows that the non-human source has no interference, which indicates that the probe library of the embodiment 1 has no cross reaction with the non-human source nucleic acid;

(3) the samples numbered 5-8 were measured by the presence of common interfering substances: necrotic tissues (equal volume), paraffin (1% V/V) and ethanol (1% V/V), and common interfering substances in the detection result do not interfere with the detection result;

(4) the detection results of sequence numbers 9-11 further illustrate that the above probe library can capture fusion genes of the NTRK family.

As can be seen, this example demonstrates that the probe library provided in example 1 has better specificity for fusion genes of NTRK family: can eliminate the interference of common interference substances, has no cross reaction with non-human nucleic acid, and can specifically distinguish fusion genes of NTRK family from fusion genes of non-NTRK family. The detection reagent comprising the probe library in example 1, as well as the kit and the corresponding detection method, also have the above-mentioned specificity.

Example 4

In this example, the accuracy of the detection result was verified by using the probe library and the corresponding kit provided in example 1, and the detection method of example 1 and the conventional FISH/IHC detection method, and the detection results are shown in Table 30.

As can be seen from Table 30, the results of the detection using the kit and the detection method of example 1 can be verified and can be reliably used in practical applications, and the kit and the detection method of example 1 can detect more detailed fusion information (including fusion genes and fusion sites), and can therefore be analyzed more accurately in practical applications.

Example 5

This example uses the probe library and corresponding kit provided in example 1, uses the detection method of example 1, and uses first-generation sequencing for DNA-level detection and IHC for protein-level detection to verify the accuracy of the probe library and corresponding kit and detection method provided in example 1 from DNA-level and RNA-level, and the results are shown in tables 31 and 32, respectively.

As can be seen from table 31, for the samples with known fusion information, the kit of example 1 and the first-generation sequencing as the sequencing gold standard can detect the corresponding fusion information (breakpoint and partner information) at the DNA level, and thus it can be seen that the kit of example 1 and the corresponding detection method can detect the fusion information of the NTRK gene family at the DNA level with relatively high accuracy.

In table 32, for a sample with known fusion information, IHC detects fusion of protein TRKA encoded by NTRK1 gene, the detection result of the kit and the detection method of example 1 is consistent with IHC, and the detection at protein level indicates detection at RNA level, but the kit and the detection method of example 1 can detect specific fusion gene and site more accurately, so that the kit and the corresponding detection method of example 1 can detect specific fusion information of NTRK gene family more accurately at RNA level.

From the above, the kit and the corresponding detection method in the embodiment 1 can accurately detect the specific fusion information of the NTRK gene family at the DNA level and the RNA level, so that the detection of the two levels can be combined, the omission of the DNA level or the RNA level can be greatly avoided, and the mutual detection and correction can be performed, thereby improving the accuracy of the final detection result.

Example 6

This example is intended to illustrate that the probe library of example 1, and the corresponding detection reagents, kits and methods, show that not only known fusion genes of the NTRK family but also unknown fusion genes of the NTRK family can be detected, and that the results can be verified by IHC and first-generation sequencing, and the detection results are shown in table 33.

The sample columns in the table are aligned with the IHC method for detection consistency (using Anti-Pan TrkAntibody kit of Abcam), and samples with inconsistent examination reagent and comparison method results are sequenced by Sanger sequencing: of the 20 samples, 9 samples confirmed that the test of example 1 was consistent with the IHC test result; of the 11 inconsistent cases, 3 were not subjected to Sanger sequencing due to the sample size, and the remaining 8 were subjected to Sanger sequencing, which was consistent with the detection results of example 1. It is also demonstrated that the probe library provided in example 1 of example 1, and the corresponding detection reagent, kit and detection method, can indeed detect not only known fusion genes of the NTRK family but also unknown fusion genes of the NTRK family.

Example 7

The sensitivity of the probe library provided in example 1 and the corresponding detection reagent, kit and detection method is verified in two aspects by using the probe library provided in example 1 and the corresponding detection reagent, kit and detection method and using the detection method of example 1:

for the total amount of nucleic acid extracted from a test sample: the results of the measurements using 50ng of DNA and 100ng of RNA for human samples and for artificially constructed cell lines are shown in Table 34.

Table 34 shows that the kit and the corresponding detection method provided in example 1 can detect fusion mutation of a gene with a frequency as low as 5% in 50ng gDNA sample and fusion copies as low as 500 in 100ng RNA, and repeat detection for 20 times, and the positive detection rate is not less than 95%.

(II) for the support logarithm of sequencing from one fusion gene:

the number of support logarithms, namely the number of paired reads which can support one gene as a fusion gene and are obtained after the sequencing on computer analysis, is small, which means that the content of corresponding fragments in a sample to be detected is small, thereby also indicating that the probability of being capable of being grabbed and obtaining an amplification product before the sequencing on computer is smaller.

As shown in fig. 1-4, specifically illustrated by a case of a TPR exon 21-NTRK1 exon 9 fusion, which was recognized by NGS with 3 unique paired reads supported (fig. 1), the assay results were analyzed as follows:

although the pan-TRK IHC test was negative (FIG. 2), the subsequent PCR test followed by Sanger sequencing was positive (FIG. 3), consistent with the fusion scheme of the TPR exon 21-NTRK1 exon 9 fusion gene shown in FIG. 4. (it should be noted that, the first generation sequencing is used as the gold standard of sequencing, which can only be verified, but unknown; and the first generation sequencing is limited in sequence length and in sequence range of detection, so that it is necessary to cut into several pieces, and several first generation sequencing is required, which causes the sequencing scheme to be troublesome and the cost to be high);

different NTRK fusion detection techniques also showed that NGS is consistent with PCR up to 100% at the DNA level (8/8), whereas the clinically common pan-TRK IHC antibody does not recognize NTRK fusions as accurately as NGS or PCR. In addition, pan-TRK IHC may have a tendency to detect certain TRK proteins, i.e., it can only detect certain proteins as well, such as TRKA (one of the different proteins that become after fusion of the NTRK family genes), rather than TRKC (one of the different proteins that become after fusion of the NTRK family genes). The pan-TRK IHC method shows significant instability of protein expression, while the fusion of different NGS and PCR technologies at the DNA level is more consistent; in addition, although the fluorescence PCR has high sensitivity, good specificity, clear and intuitive result judgment and wide application range, only a few specific fusion genes can be detected.

Based on the above results, the probe library, the corresponding detection reagent, the kit and the detection method of example 1, performing NTRK fusion detection at DNA level is a highly sensitive and more reliable detection method.

Examples effects and effects

The probe library for detecting NTRK gene family fusion genes, the detection reagent comprising the same, the application of the detection reagent in preparing the kit for detecting NTRK gene family fusion genes, the corresponding kit and the detection method provided in embodiment 1, because the probe library comprises a first probe group and a second probe group, the first probe group is used for DNA level detection and capture, the second probe group is used for RNA level detection and capture, and the probe library is verified to have good specificity and high sensitivity for detecting the NTRK gene family fusion genes, the NTRK gene family fusion genes can be detected based on the combination of DNA level and RNA level, the complementation of DNA level and RNA level detection information is realized, the problems that the probe cannot be fully covered due to too large NTRK gene family intron region, DNA level omission is caused, and the problems that the sample is unstable and the like due to easy degradation of the RNA sample are solved, Poor quality or RNA level omission due to low expression level; and the probe catches on the NTRK family gene, another gene (Partner) which is connected with the NTRK family and participates in fusion can be pulled down together, and the Partner gene can be known through comparison with the human genome, so that the Partner fusion of the known and unknown NTRK can be determined; fusion breakpoints and sequence information can be definitely known, so that DNA layer rearrangement and RNA layer fusion information can be obtained, and NTRKDNA layer rearrangement and RNA layer variable shearing are detected to form fusion; in addition, because the DNA flow and the RNA are detected simultaneously, after one flow is not needed to be detected, a positive result is not detected, and the other branch is started, so that the time can be saved, and more time can be won for a patient;

furthermore, the probe pair, the detection reagent, the kit and the corresponding detection method provided in embodiment 1 are verified to be capable of eliminating the interference of common interfering substances, have no cross reaction with non-human nucleic acids, and can specifically distinguish fusion genes of NTRK family from fusion genes of non-NTRK family, so that the detection result can be obtained more accurately in application;

furthermore, the probe pairs, the detection reagents, the kit and the corresponding detection method provided in embodiment 1 can detect specific fusion information of the NTRK gene family more accurately at the DNA level and the RNA level by verification, so that the detection of the two levels can be combined, the omission of the DNA level or the RNA level is greatly avoided, and mutual detection and correction can be performed, thereby improving the accuracy of the final detection result;

still further, the probe pairs, detection reagents, kits and corresponding detection methods provided in example 1 have a sensitivity that: gene fusion mutations can be detected with a frequency as low as 5% in 50ng gDNA samples, as low as 500 fusion copies in 100ng RNA, and as few as 3 pairs for the final confidence support. Therefore, the total amount requirements of DNA and RNA in the sample to be detected can be respectively reduced to 50ng and 100ng, the total amount requirements of the DNA and the RNA in the sample to be detected are greatly reduced, and finally, the number of pairs of letter support pairs can be as small as 3, so that the practical application is facilitated.

Sequence listing

<110> to the medical science and technology (Shanghai) Co., Ltd

<120> probe library, reagent and kit for detecting NTRK gene family fusion gene and application

<160>174

<170>SIPOSequenceListing 1.0

<210>1

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

ccccgaggac cccatccctg gtgcgagggc catcctgaac cctgccccca ctcctgggct 60

cctcctgggt tacagccaac ttcctgctat agccctgacc ccagaaattg gagtgcctgg 120

<210>2

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

aggacgaaac accttttggg gtgagatagg aagtagaagc ttgtgcagac tttgggaccg 60

ggaggctggg tagaggctca tctgcatgtc atttctggtc agagcaggga gatcactacc 120

<210>3

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

aaacaagttt gggatcaacc gtgagtcggg gctgcagagg gctgtctgtc tgtctgttct 60

cctggctttg tttcctactg gctcttcctg actctgtctc tggggggctg tgcacatggg 120

<210>4

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ccaagacagt ccccgctaca accccagccc tcccaagact ggggctaccg tctgaccctg 60

caagccccct caggtgttca ccacatcaag cgccgggaca tcgtgctcaa gtgggagctg 120

<210>5

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

agatgctggt ggctgtcaag gtgagaccct gccccggggg gtactgctgg cctgggtccc 60

acccccagga gctccatcac atcaggacag agtgggggga gatgcagagg gctgacatgg 120

<210>6

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

actcctcggc tcagtcgcct gtgagtgtgg ccagtgctgg gcagtgggag ttggggagga 60

cacccagact tgggctgcta atgggcttgg ctgtccccgg ggaatgattg cgaggagggc 120

<210>7

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

ggcctctcct tacaggaact gtgagtgggg gcgcttccag gggcaagagc accaagtgtg 60

tgtgtgcctg tgtgcacttg ggtctgttgg atgacattgg gtcactgtgt ctgtgtgaca 120

<210>8

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

catgcccaat gccagctgtg gtaggtgccg ggtgagggag gtggtgtaag ggggctgggg 60

aagagaccta cctgcctgag ggagagggca ctgagcaagc actgaaaagg cctggggaat 120

<210>9

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

agcagtcagc cacggtgatg gtgagaagac cttcgctggc agcccccaag aggtccaggc 60

agagcacagg ggacaaagat ggggaaagag agacacactg tggaggaaag agacaacgaa 120

<210>10

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tgttcaggtc aacgtctcct gtgagtctca gtggcagctc cggcacccac cccctactca 60

tctcttcttc cctcaaaaga ggatgtaggg tggggggctg gaagaaaggg tgggatgtgt 120

<210>11

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gacctcaacc gcttcctccg gtaccagcac ctggcctcag cgctggcccc ggcccctggc 60

tctgggcccc gtcttccctt ccctatagac atccctgctt gtctttcaaa ccaaggggag 120

<210>12

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

ctggcctgga attgacgatg gtgagtaact gacacttttg tatgtgggga gaagataaag 60

tctatcattc acctgttgac aaaatcatgt atacaataag ccatccccca acctagtggc 120

<210>13

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

cttacaaatc tttgctctgt tttgcctttt aggtgcaaac ccaaattatc ctgatgtaat 60

ttatgaaggt agctatcgtg ttttctactt tgtatttctt tttcaaaatg tttgtgtatc 120

<210>14

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

ctccaagttt ggcatgaaag gtaagaaggg ttgtgtttat ttagcttctt atgtggatca 60

tttttggctt atgactaatg ctaattacca ctaaagaagg aagtggctag atttatgatg 120

<210>15

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tcagctcaag ccagacacat gtaagtacag ctgtttgtac ttattgtccc atttgctgca 60

tagctgtatc aaccagagtg tttatcagag cccctgatag ggatgactgg cggggaacag 120

<210>16

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

agggtgggat ccttcagggc ctaggaacaa tgcaggacac aggtgtttaa caactacagg 60

gcagggggct gtcttttcta ctcctggaaa gaaactggcc ccacacacca ctgggttacc 120

<210>17

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>17

cctcttaatg tgctgcacat ctgtaggatg gggacaaaga ggagggcagc aaatcagtcc 60

tcgtttggtg acacagggag acagaagagt acagaggtct agcgtggaga acttggttct 120

<210>18

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>18

actgatgaca gccacgggac ctgcacacac caagagagac gcaggacctg gtgacgtcac 60

atccggccag tttccagccc tgtccacaga caacccccaa ctactgttcc catcacaaac 120

<210>19

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>19

cttacccttc attccaaatt tggaccgtcg accatatttg ttgatcatga cgaagagaac 60

caccaacagg acacaggcaa aagcagcaag tccaactgct atggatacct gtgaggaacc 120

<210>20

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>20

gataaagtta tccgtgctct ctgcaaaaaa aggacaaaga gataattaac aaatttaata 60

aaaaccagaa cagacacact acttggtcct aatagctatg atctctccca ttcaccatga 120

<210>21

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>21

gcctgagctt ccagagggcc taggagcagt aagggagtga gtgggcaact cggcgcatga 60

aggaggtact cctcattttc gttctctctc tctgtgcccc agcccgttgg cagacccgga 120

<210>22

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>22

cttaagggag tctctctact tttcaggccg ccctcatctg cctggcaccc tctgtacccc 60

cgatcttgac ggtgaagtcc tgggacacca tgcagttgcg ggctgctaga tctcggtgca 120

<210>23

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>23

ctagatctcg gtgcacaaac ttgttggcag caaggtaggc catgccgtct gcaatctcac 60

cagccatttg gatcatttcc cccaatgctg gctgtgggag cccagggttg ttctagagcc 120

<210>24

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>24

cgggggaggc ctggcagctg cagctgggag cgcacagacg gctgccccgc ctgagcgagg 60

cgggcgccgc cgcgatgctg cgaggcggac ggcgcgggca gcttggctgg cacagctggg 120

<210>25

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>25

gctggcacag ctgggctgcg gggccgggca gcctgctggc ttggctgata ctggcatctg 60

cgggcgccgc accctgcccc gatgcctgct gcccccacgg ctcctcggga ctgcgatgca 120

<210>26

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>26

tgtattgtga gggagtaagt gggtgggcat gggaactcaa gtgtgggcct gagccctgtg 60

actcccatcc gctctcccca cagctacatc gagaaccagc agcatctgca gcatctggag 120

<210>27

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>27

ctgcagcatc tggagctccg tgatctgagg ggcctggggg agctgagaaa cctgtgaggg 60

aaacggggac tgtgggtgtg gagctcagca tgggcctggg ggagaccaga aggtcaggga 120

<210>28

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>28

actgggaggc tgggatgggc agggagggcc aggggcccag agtagctgag acctggggac 60

tgatcctcct gcacccctcc ccagcaccat cgtgaagagt ggtctccgtt tcgtggcgcc 120

<210>29

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>29

ccgtttcgtg gcgccagatg ccttccattt cactcctcgg ctcagtcgcc tgtgagtgtg 60

gccagtgctg ggcagtggga gttggggagg acacccagac ttgggctgct aatgggcttg 120

<210>30

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>30

ttcttggctc ctcccctccc tcattctggt cagagtgagg tcgggtcact caaggggtct 60

gtcttgctgt gtctccacgc ccgcaggaat ctctccttca acgctctgga gtctctctcc 120

<210>31

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>31

ctggagtctc tctcctggaa aactgtgcag ggcctctcct tacaggaact gtgagtgggg 60

gcgcttccag gggcaagagc accaagtgtg tgtgtgcctg tgtgcacttg ggtctgttgg 120

<210>32

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>32

cctttcacct gtagacggtc ctccctgctg cctaactgct ccctcttatc ccctgtgatc 60

cctcaggccc tttccttgac tctgttggtg tcccccatgc cccccagggt cctgtcgggg 120

<210>33

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>33

agggtcctgt cggggaaccc tctgcactgt tcttgtgccc tgcgctggct acagcgctgg 60

gaggaggagg gactgggcgg agtgcctgaa cagaagctgc agtgtcatgg gcaagggccc 120

<210>34

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>34

ggctccaggt cattgaggag ggtgggggaa ggagcagccc cgcagtagag ttctggggcc 60

actcccagct ctaacacccc ttggccctcg ggcgtcctgg gtggccaggt gtgcccacgc 120

<210>35

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>35

caggtgtgcc cacgctgaag gtccaggtgc ccaatgcctc ggtggatgtg ggggacgacg 60

tgctgctgcg gtgccaggtg gaggggcggg gcctggagca ggccggctgg atcctcacag 120

<210>36

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>36

agccccaagc tggctaaagc tccttcttat tcccccctct ctttcctgat ctagaaatct 60

gggggtctgc catccctggg gctgaccctg gccaatgtca ccagtgacct caacaggaag 120

<210>37

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>37

gacctcaaca ggaagaacgt gacgtgctgg gcagagaacg atgtgggccg ggcagaggtc 60

tctgttcagg tcaacgtctc ctgtgagtct cagtggcagc tccggcaccc accccctact 120

<210>38

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>38

gtgtgtgcca ggctccctcc agctgcgccc tgacctcctg ctgttgctct ttctggccca 60

cagtcccggc cagtgtgcag ctgcacacgg cggtggagat gcaccactgg tgcatcccct 120

<210>39

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>39

actggtgcat ccccttctct gtggatgggc agccggcacc gtctctgcgc tggctcttca 60

atggctccgt gctcaatgag accagcttca tcttcactga gttcctggag ccggcagcca 120

<210>40

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>40

ggactcactg ctttcctcct ccctctgact gctttctctc ctccctctga ctgctttctc 60

tcctccctcc tgctgcagtc tccttctcgc cggtgggtga gtagcccaag gtggagggca 120

<210>41

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>41

tactggaggc tacagtgtgt gtcaaggctc acccctcctg ccctgtgtcc ctacagacac 60

taacagcaca tctggagacc cggtggagaa gaaggacgaa acaccttttg gggtgagata 120

<210>42

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>42

ttttggggtg agataggaag tagaagcttg tgcagacttt gggaccggga ggctgggtag 60

aggctcatct gcatgtcatt tctggtcaga gcagggagat cactaccatc tggcctgagc 120

<210>43

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>43

aaaaaatggc ttactacagg aggctctgag agtacaggag gagcccctgg atctaactac 60

ccctgtcccc caccaggtct cggtggctgt gggcctggcc gtctttgcct gcctcttcct 120

<210>44

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>44

tgcctgcctc ttcctttcta cgctgctcct tgtgctcaac aaatgtggac ggagaaacaa 60

gtttgggatc aaccgtgagt cggggctgca gagggctgtc tgtctgtctg ttctcctggc 120

<210>45

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>45

caaggtgtgg gcaaacccct ccatgcggct gtgtctcctc tctaggcccg gctgtgctgg 60

ctccagagga tgggctggcc atgtccctgc atttcatgac attgggtggc agctccctgt 120

<210>46

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>46

gtggcagctc cctgtccccc accgagggca aaggctctgg gctccaaggc cacatcatcg 60

agaacccaca atacttcagt gatgcctgtg aggggctatg ctgggtcaag ggcagggacg 120

<210>47

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>47

gccttgtgca gcacacagcc ctgccaagac agtccccgct acaaccccag ccctcccaag 60

actggggcta ccgtctgacc ctgcaagccc cctcaggtgt tcaccacatc aagcgccggg 120

<210>48

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>48

acatcaagcg ccgggacatc gtgctcaagt gggagctggg ggagggcgcc tttgggaagg 60

tcttccttgc tgagtgccac aacctcctgc ctgagcagga caagatgctg gtggctgtca 120

<210>49

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>49

gggctgacat ggctggatac cggggtgggc gggctgccct gggtgaacag cagtgagggc 60

tcggccccca actcagtcct gtccctgccg cttccatcca ggcactgaag gaggcgtccg 120

<210>50

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>50

tgaaggaggc gtccgagagt gctcggcagg acttccagcg tgaggctgag ctgctcacca 60

tgctgcagca ccagcacatc gtgcgcttct tcggcgtctg caccgagggc cgccccctgc 120

<210>51

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>51

ccctctcctt ttcttgttca cagatcccat ggacctgatg ccaagctgct ggctggtggg 60

gaggatgtgg ctccaggccc cctgggtctg gggcagctgc tggccgtggc tagccaggtc 120

<210>52

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>52

gtggctagcc aggtcgctgc ggggatggtg tacctggcgg gtctgcattt tgtgcaccgg 60

gacctggcca cacgcaactg tctagtgggc cagggactgg tggtcaagat tggtgatttt 120

<210>53

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>53

agcttgtgta tttattttta atgatggggc tggggtaggc tgtgccttga cgggctgtcc 60

caggcgcccc tggaattgat gcagtgtccg cccgtggcag gtgggaggcc gcaccatgct 120

<210>54

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>54

aggccgcacc atgctgccca ttcgctggat gccgcccgag agcatcctgt accgtaagtt 60

caccaccgag agcgacgtgt ggagcttcgg cgtggtgctc tgggagatct tcacctacgg 120

<210>55

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>55

ctttctcctc tgtctctccg gtggccccag gcaatcgact gcatcacgca gggacgtgag 60

ttggagcggc cacgtgcctg cccaccagag gtctacgcca tcatgcgggg ctgctggcag 120

<210>56

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>56

cggggctgct ggcagcggga gccccagcaa cgccacagca tcaaggatgt gcacgcccgg 60

ctgcaagccc tggcccaggc acctcctgtc tacctggatg tcctgggcta gggggccggc 120

<210>57

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>57

ggatggaagg agttgtgagg tggaagggag atgtgaggca gggagagagg aggcaacaga 60

gtatgaattc atgaccacca gccaccacta gccaagaatg tccaggtaga ttggggtggc 120

<210>58

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>58

gtagattggg gtggccttcc ccaaagcatg gaggattttg tagatctcct tgatgttcaa 60

ccgctgctgt ggttccctct gccagcaccc cagcatgaca tcgtacacct ctttggggca 120

<210>59

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>59

aaatcccacc taatgtcttg ttcagtaggt ccaagttctg ggctgagata gctcttatga 60

gccctccccc aatcaagatt cctacgcacc ccctttttac ctccgtgttt gagagttgga 120

<210>60

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>60

tgtttgagag ttggaaccat ggctgctttc cataggtgaa gatctcccag aggatcaccc 60

cgaagctcca tacatcactc tctgtagtga acttccggta catgatgctt tcaggaggca 120

<210>61

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>61

tgtataaata ttggaattta atatatgaaa caatggctta gtaattaaag tgttgggaca 60

atgaactatt cattaaaaaa aatacgctta gatacctacc tcacaccata tacaaaaatc 120

<210>62

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>62

ccatatacaa aaatcatttc cagatggatt aaagagctaa acataaaaaa caaaacaata 60

ataatattag aagaaaactt agaaaagtat tctttatcct cagaaaagga aggccttcct 120

<210>63

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>63

cagaattttc ttatggggca tcttccccgt cttttttccc cagtatcagt cctcatgcct 60

gcacaacctt caatgagaga agaaaacaac tggatttcta aactgcagag agaagagact 120

<210>64

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>64

catgtaagca aggcgctagc tctgtggctg agtcctgcag ctgggaaagt cactttaccc 60

tgtaataatc cgtgctgtag acatctctgg acatgccgaa gtccccaatc ttcactagca 120

<210>65

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>65

caatcttcac tagcagattc gctccaaccaggcagttcct ggtggccagg tctcggtgca 60

caaagtgctg ggaggccagg tacaccatac ccgaggcgat ctgactggca atgtggagca 120

<210>66

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>66

tttagagggg gtagtataat ttctggctcc agggaaaacc ccaagggttc ggtgggactg 60

gggtcaggtg caggggaaga caatccttgc ttacctgagg aacttattca ggtctccatg 120

<210>67

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>67

attcaggtct ccatgcttca tgtattcaaa gaccatgatg agggggtccc catcgccgca 60

cactccatag aacttgacaa tgtgctcatg ctgcaggttg gtgagcagct cggcctccct 120

<210>68

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>68

ccctgggccc tcagccagcc ctcctcctgg tgccggcatg cctctggggt ttaccttcac 60

agccacaagc atcttgtcct tggtcgggct gaggttgtag cactcggcca ggaagacctt 120

<210>69

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>69

ggccaggaag acctttccaa aggctccctc acccagttct cgcttcagca cgatgtctct 60

cctcttaatg tgctgcacat ctgtaggatg gggacaaaga ggagggcagc aaatcagtcc 120

<210>70

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>70

gatccaaaga gaacaatgcc tagagcttcc aacctctcag agggcccagc ctaccaaggt 60

gacatcaaaa caaggaggct taaaaggagt ttttaaaagc catgacgtcc tttgctgaaa 120

<210>71

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>71

cgtcctttgc tgaaataaac attgacatcc tcaacataga tgccatggtt aagaggcttg 60

gaatgtccgg gaaggcttat tggattcaac ataatttctc tgaaacctat aaaaaacaaa 120

<210>72

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>72

ccacgaaata tatggaggct tgatgagtct taaggtctta agaaccaaaa ttggttaggg 60

gagggatctt tactgcatac aaagacgtca aaggaggtaa ctcaccatgt gaccttgggt 120

<210>73

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>73

tcccatgatt gtctatgttt gaaaagaccc ctggcagaag aggcagacat gggggaatta 60

atggtcagta ttaaacccca agtgcaaaaa acatgggaaa gtatttttct taagtgcaca 120

<210>74

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>74

agaaggttcc agaaccccag gtacatggtc tatcaccaac caccctcccc tccccaggag 60

ggagagcatt ccatcccagt acttacacgt gtccggcttg tggcagttgt gtccctgacg 120

<210>75

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>75

gttgtgtccc tgacggaagt actgggggtt ctcaatgaca gggatgcgag tcatgccaat 60

gaccacagtg tcgggcccgg catccagtga cgagggcgtg gtgatgccgt ggttgatgtg 120

<210>76

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>76

agcaatggga gattaaaaca gtatcttttg atcaaaagca gtaatgtttc cccccatgac 60

gcccttgaaa atgaaactcc caccttaccc ttcattccaa atttggaccg tcgaccatat 120

<210>77

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>77

gaccgtcgac catatttgtt gatcatgacg aagagaacca ccaacaggac acaggcaaaa 60

gcagcaagtc caactgctat ggatacctgt gaggaaccag aaacagagag tcagcaacaa 120

<210>78

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>78

tcaacacact cctcttgacc aagaagtgac tcaccccaaa agtgtcttct tctggtttgt 60

gggtcacagt gataggaggt gtgggactca cttcgtcaac tgaaaaccaa acacaaaaag 120

<210>79

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>79

agctgccatg ggccagggat gatgtggaat aggagagagg gctatttgaa ttcaatagtt 60

accgatagta tcagaataaa tcagtttcaa agcaacaggt aaagcagact tacacaagat 120

<210>80

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>80

tgatgctgct tctcctctca agctaccatg ccccatctcc caagcttgta gaaagaatcc 60

atacacctcc gatccagcta cgctgccctc acctggaaag ggctccttga ggaagtggcc 120

<210>81

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>81

cttgaggaag tggccattga tggtctggtt ggctgtgccc agtgggtttt tggcaatgag 60

ggtatagttg ccattgttgt agtgggtggg cttgttgaag agcaggcagc cctcggaaat 120

<210>82

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>82

gatcagctca ctgctctagc tcacccctga caacaccttg gcccctctcc agcctcctat 60

gccagttgcc cctcacacac agccatcccc cacaataaca tgcacttaca gtagacagtg 120

<210>83

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>83

ttacagtaga cagtgagggc aacactggca ttgctcatgc ccaccacgtt ctctgcaatg 60

cacgtcaggg tgaagccatt gtcctcactc gtcacattca ccagcgtcaa gttgatggca 120

<210>84

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>84

ctatgtgttt tttcctatag taacaagacc gcaaattttc cctcttcttc aagactacag 60

tgtgatcact ccctagcctc ctgatggggc tgaagcccag gatgcctacc tggtgagtgt 120

<210>85

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>85

ctacctggtg agtgttgatg gactgcagcc cagtgactat ccagtccaca tcaggaaggg 60

gtgatccaga gccattgcaa gtgataacag cgttgtcacc ctctcgtacg gtcaggttga 120

<210>86

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>86

gaaaggaagg ctctggcatc ccaaggtaac gtccagcacc atctctggtg tctgagggat 60

gcctccctgg agccagctgg gccaggcggc cactcactca ccacactgac tgatgttcat 120

<210>87

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>87

ctgactgatg ttcatgcgga agagaggaag ctgggagcca tcagcgttga tgcagtagag 60

gttctggctg ttgagcttgg cctccccctg ctcctgccag agctgcatcc agcggatgtc 120

<210>88

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>88

tcaggtggtt ccactgcttg acactcctcc ccatccaccc attaccagca cttcagtacc 60

tggacagtct tcaaaaccaa acttacaatt cccgaagact cagcgtctgg aagagctgcc 120

<210>89

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>89

tctggaagag ctgccacgag agtgtggtga gccggttact tgacaggttt ctgcaagatt 60

gacaaataaa gggaaatttt aaaacaagtc tggcacaaat aatgctctag gtagtaagct 120

<210>90

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>90

ggtctccggt ttcactgccc caagagtacc tgccatgtgc ccccaatccc tgcagcccag 60

ctctactcac atataacgca aatgggggtt cttggcaaag gctctgggct gaatgctccg 120

<210>91

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>91

gggctgaatg ctccgaagtc ctgagttctt gatggtccta gacagagaga aaaagaggat 60

cagcagagct caagtggcag agggatatct gctctgggct gaggctggca gggggtgagg 120

<210>92

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>92

tgggggagaa agcacggatg gcagtcttgc tgtgcccctc acgccacccc agaaggcaga 60

ccaggtggca tccacccctt ccacagggaa aggcctctct gtggccgggt gtactcacag 120

<210>93

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>93

cgggtgtact cacagctttt gaagtccggt gtagagctcc atgtccacgg cgttgagcgt 60

gtgaagactg cgccagttct ctatgtgtct gcaggggagg aggaaaggta acggtcagcc 120

<210>94

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>94

gaggcaggct ggggagcggc cgcctgactt acatggaagt gatattcctt gagatgtccg 60

tgatgttgat actggcgttc ccattgctgt tccctgaatc ctgcccttcc aggaggggga 120

<210>95

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>95

gcccttccag gagggggaag aggttcccat cgtccggccg ccggcaattg atctcagtct 60

tgctgcagac acaatttgca gggcaagcca gcacggagcc cacatagtcc agccagacgc 120

<210>96

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>96

ctccccgcac gggtggggga aagcggccgg tgcagcgcgg ggacaggcac tcgggctggc 60

actggctgct agggatgtcg tcctggataa ggtggcatgg acccgccatg gcgcggctct 120

<210>97

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>97

ccatggcgcg gctctggggc ttctgctggc tggttgtggg cttctggagg gccgctttcg 60

cctgtcccac gtcctgcaaa tgcagtgcct ctcggatctg gtgcagcgac ccttctcctg 120

<210>98

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>98

agtggtgtgg agggagcacc ttggacacct gggtgaggtg gatgggagtt cttcatggtg 60

ctgctgccta cattctgagt cactgcgatt cactctctgc tttgttacag tttcatcgca 120

<210>99

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>99

tacagtttca tcgcaaacca gaaaaggtta gaaatcatca acgaagatga tgttgaagct 60

tatgtgggac tgagaaatct gtgagtactc aggaccaggg cacattatct cagagaattt 120

<210>100

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>100

tatctcagag aattttcctg ttgtctgctc tggtcaggca ggcattcact ggttcgttct 60

aatgtgcatg aaattatgtg ttttcacagg acaattgtgg attctggatt aaaatttgtg 120

<210>101

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>101

ggattaaaat ttgtggctca taaagcattt ctgaaaaaca gcaacctgca gcacatgtaa 60

gtagagattg attcttttgc ttcccaggac ccattttatt caatatttcc cccctctgtt 120

<210>102

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>102

ttttgaaaaa caaatctcta tttgaatact gtgttcctaa aatgtaacat tttaaattca 60

tgtttaatgt ttttgattcc tttcagcaat tttacccgaa acaaactgac gagtttgtct 120

<210>103

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>103

ctgacgagtt tgtctaggaa acatttccgt caccttgact tgtctgaact gtaagtaatg 60

attttgtgtg gcatttgggg aaatgttttc aaaggaaggg gtaattaagt atttttcttt 120

<210>104

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>104

tgctggctag aaagaattca taatgttgta gtattttaca agcactaatg tagctaaaat 60

ggaaaaagga acttgatctg ttgtcatttt tgttccctgt aggatcctgg tgggcaatcc 120

<210>105

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>105

cctggtgggc aatccattta catgctcctg tgacattatg tggatcaaga ctctccaaga 60

ggctaaatcc agtccagaca ctcaggattt gtactgcctg aatgaaagca gcaagaatat 120

<210>106

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>106

tactgcattt aactatttgc atatgcctct gtttactttt cttgttccat aggtttgcca 60

tctgcaaatc tggccgcacc taacctcact gtggaggaag gaaagtctat cacattatcc 120

<210>107

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>107

tctatcacat tatcctgtag tgtggcaggt gatccggttc ctaatatgta ttgggatgtt 60

ggtaacctgg tttccaaaca tatggtaagg cttgtgtttg gctgtgtctt aatagagaga 120

<210>108

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>108

cactttggga tcaatcctaa tcaaggttat ttttgtctgt taattcattt gtagaatgaa 60

acaagccaca cacagggctc cttaaggata actaacattt catccgatga cagtgggaag 120

<210>109

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>109

gatgacagtg ggaagcagat ctcttgtgtg gcggaaaatc ttgtaggaga agatcaagat 60

tctgtcaacc tcactgtgca ttgtacgtaa tcagactggc atgtgttttt aatagcaaat 120

<210>110

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>110

aaaattccct atcaatgaca cagacatctc gagatgggga gaattctgag ctttctgatg 60

ctattaactc tctctttttc aatttagttg caccaactat cacatttctc gaatctccaa 120

<210>111

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>111

ttctcgaatc tccaacctca gaccaccact ggtgcattcc attcactgtg aaaggcaacc 60

ccaaaccagc gcttcagtgg ttctataacg gggcaatatt gaatgagtcc aaatacatct 120

<210>112

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>112

tattttagtt gacataggtt agtaattttt tgactccaaa atgcatactt acaaatcttt 60

gctctgtttt gccttttagg tgcaaaccca aattatcctg atgtaattta tgaaggtagc 120

<210>113

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>113

atttatgaag gtagctatcg tgttttctac tttgtatttc tttttcaaaa tgtttgtgta 60

tcatgaagta aatcaactga aagaagactc ttctaagctc agttaaattt acactttaag 120

<210>114

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>114

tgacaacttc atgttcttcc tcattccccc tttgcccact taagattatg gaactgcagc 60

gaatgacatc ggggacacca cgaacagaag taatgaaatc ccttccacag acgtcactga 120

<210>115

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>115

cacagacgtc actgataaaa ccggtcggga acatctctcg gtgagtggaa taaataggtg 60

tctgaattgg ttctgagcat tttggatgcc tccatgttag aggaatgtag ctgcttcaat 120

<210>116

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>116

catcatcacc atatgattat agggaactaa ttagcaaggt tataaccacc ctcccttcct 60

ttctctaggt ctatgctgtg gtggtgattg cgtctgtggt gggattttgc cttttggtaa 120

<210>117

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>117

tttgcctttt ggtaatgctg tttctgctta agttggcaag acactccaag tttggcatga 60

aaggtaagaa gggttgtgtt tatttagctt cttatgtgga tcatttttgg cttatgacta 120

<210>118

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>118

ttttaggttt tgttttgttt cataagatcc cactggatgg gtagctgaaa taaaggaaaa 60

gacagagaaa ggggctgtgg tgcttgttgg ttgatgctgc catgtaagct ggactcctgg 120

<210>119

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>119

tatttttgtc ggggggagtt tgttgcatta tttgaccaag gacagtgttg accacctccg 60

gtttctactt ctctttcgaa gtttatttta tgttttgttg tggttttcag atttctcatg 120

<210>120

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>120

ttcagatttc tcatggtttg gatttgggaa agtaaaatca agacaaggtg ttggtaagta 60

gttaactcac tccttctttg gataagtaat gagtctatgt ttttattcgg atgaaaatgc 120

<210>121

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>121

tacagctcaa taaagccatt gattacagga gaatatatat atttttccat ctccaggccc 60

agcctccgtt atcagcaatg atgatgactc tgccagccca ctccatcaca tctccaatgg 120

<210>122

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>122

tcacatctcc aatgggagta acactccatc ttcttcggaa ggtggcccag atgctgtcat 60

tattggaatg accaagatcc ctgtcattga aaatccccag tactttggca tcaccaacag 120

<210>123

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>123

tcatttacaa agtccagaga tggtttgcag gattgtagag caatctgaac agggctgaat 60

tcctcccgag cactttccaa tagcaagtct gtctacttta ttgcagggcc cagaggttcc 120

<210>124

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>124

gggcccagag gttcccccaa gaccgcctga taataatttg gtatttggag gctcctgtgt 60

cactgcagga actaaaggag gctaaatcca tgcctgatgg aggagaagag ttctatggtt 120

<210>125

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>125

gccttcacct ccacatgctt caattccaat ttccattctg tctttgtttt gcagttgttc 60

agcacatcaa gcgacataac attgttctga aaagggagct aggcgaagga gcctttggaa 120

<210>126

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>126

aaggagcctt tggaaaagtg ttcctagctg aatgctataa cctctgtcct gagcaggaca 60

agatcttggt ggcagtgaag gtaagagaac attccagaat gtctcattaa ccatgatcac 120

<210>127

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>127

catcttttgc ctaacaaatg agatggatgt ctttcctatc tcagtatcat agggcccact 60

gaagtaatcc ttctctttta acacccatcc ccagaccctg aaggatgcca gtgacaatgc 120

<210>128

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>128

tgccagtgac aatgcacgca aggacttcca ccgtgaggcc gagctcctga ccaacctcca 60

gcatgagcac atcgtcaagt tctatggcgt ctgcgtggag ggcgaccccc tcatcatggt 120

<210>129

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>129

caaagggccc ctggagtgaa aatgctgagg cccccagctt cattctccat gtccttcccc 60

agggcacacg gccctgatgc cgtgctgatg gctgagggca acccgcccac ggaactgacg 120

<210>130

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>130

cccacggaac tgacgcagtc gcagatgctg catatagccc agcagatcgc cgcgggcatg 60

gtctacctgg cgtcccagca cttcgtgcac cgcgatttgg ccaccaggaa ctgcctggtc 120

<210>131

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>131

aaagtgcaaa taaggaaagc aaacagtgtc ccccagcagc tcccttccac acctggtttc 60

ggggtgactg atgcctccct gttgatccct ttctccccag gtcggtggcc acacaatgct 120

<210>132

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>132

tggccacaca atgctgccca ttcgctggat gcctccagag agcatcatgt acaggaaatt 60

cacgacggaa agcgacgtct ggagcctggg ggtcgtgttg tgggagattt tcacctatgg 120

<210>133

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>133

ctctcttctg ctgttttttt gcactgacatttcttcgatg tgcattgctt ttcctcctgt 60

ctcatcctat ctttgatctc catccaggtg atagagtgta tcactcaggg ccgagtcctg 120

<210>134

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>134

cagggccgag tcctgcagcg accccgcacg tgcccccagg aggtgtatga gctgatgctg 60

gggtgctggc agcgagagcc ccacatgagg aagaacatca agggcatcca taccctcctt 120

<210>135

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>135

cggaatgcaa gacatccgat ggtatactta ctcgaacccg tccttttcac aacagccgcg 60

ggatccgctt tctttggctg actgctcaga gtcttccctt ttcctgtgac cccattagac 120

<210>136

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>136

aagcaaaggc agaagggcca cgcctactca ccagggctgg ttatcgtcag gaggtcaagc 60

tttcgttgtt gctgcaaaag aaaacacact gtgagggcac tgatttgagc cagagccaaa 120

<210>137

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>137

cctctggtcc atgtctccgc cagggtctca cctcgtggac tgtggggcgg agacagacgg 60

ctgctacctt cctcctcgct gccagtgtca gggtcactgc tgtcttgcag ccgctcttcg 120

<210>138

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>138

aggctcagtt cctaactgtc ttcctttgca gtgtcctgtg ggccgccacc ggagctgccc 60

ctggctcaag tgttcggccg cccacggctg cgctatgagg tggacactgt gcttcgctac 120

<210>139

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>139

agggcctcag tttcccaaaa ggcacaggga cggggggagg gtggcggctc gatgggggag 60

ccgcctccag ggggcccccc cgccctgtgc ccacggcgcg gcccctttaa gaggcccgcc 120

<210>140

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>140

caaatagatt ttggtgaatt tataccctta cctgctgcaa attcctcaat tgtcatcagt 60

gggaaccgga ttaaggaaag tgcttttcct agaacttttt gtttattccc aaaagtcaca 120

<210>141

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>141

gtgaccagat gcccctctgc aaggccctta cctgggccca gatcctgctt ggtcacaccc 60

agcccagaag acgggtcctc cagttccagt gactctgcaa aggagcagca agtccgtttg 120

<210>142

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>142

ctgcatatac attgtatgcc tcctctctaa ggtcaaaacc tgctccgagg tggacgagcc 60

gtagctcccc gaatgggctt aagaagaggt ggtgttcgag gtcgtggagg tcctgggaga 120

<210>143

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>143

tgggaggaga gaccgggagg ccggccgggc tgcgtcccgg gtccccgcgc cgcgccgcga 60

cctgcagacc ccgccgccgc gctcgggccc gtctcccacg cccccgccgc cccgcgcgcc 120

<210>144

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>144

aaaatattcc atattttatt ttattttata gatgatagta tttctgctgc aagtacttct 60

gatgttcaag atcgcctgtc agctcttgag tcacgagttc agcaacaaga agatgaaatc 120

<210>145

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>145

ctagaccccc tcacttcaca gccgccccta cctgctttag acccgttggc cccgttggcc 60

tcgaaaccca acaacctgcc tgcagtcagg gccggctcct tcttaaactt gctctcgaag 120

<210>146

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>146

tcttaaatct actctcccct ctcttcttta gcaataccaa gaaggagggt gacctgatag 60

ctgctcaggc tcggctgaag gacctggagg ctctgctgaa ctccaaggag gccgcactga 120

<210>147

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>147

gacaggctat gtccatcctc ctgccccaca gctcgttgcc agaggaaaaa aacaagagca 60

gctgctcttt tgagacctgc ccgaggccta ctgagaagca agaggcagag ctgggggagc 120

<210>148

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>148

gcctctccag cctgtctgtc cctctgccca gcccatgaat gccacctcgg cctttggccc 60

caacctgcgc tacattgtca agtggaggcg gagagagact cgagaggcct ggaacaacgt 120

<210>149

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>149

cccctcctcc ctcccctctc ccctccccct tctccccggg cggctccggc tcccgcagcg 60

ggacagaccc acccgcccag gcttttatcc ggcaccggca gcgtcttcct ttcctccccc 120

<210>150

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>150

agccctgcag aaatcagaga cagaaacaca tttgccctgt gcacttcaaa gctcatgttt 60

ttttttaatg ttttattttt attttttaca gagatgagtt ctcactgtgt tgcctaggtt 120

<210>151

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>151

tgaagtagaa tttcttacta agatcagtta cctgtctgag gagattcaga gcaaactcca 60

gattctgcag cctctgtctg ttgatggcat aaacttcagt gaacttggcg gcaagtgctg 120

<210>152

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>152

acttctttct aaatttcttt gcttactgta gcagcccttg ccttttctct tgcagcaaca 60

gcccaggctg ctccaaggat cattactggg cctgcgccgg ttctcccacc agctgccctg 120

<210>153

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>153

tatctttatc ttatctttgt aaaaatcaaa gcttctggtc catcggagga tccgagtgtg 60

aatttcctga agaacgttgg ggagagtgtg gcagctgccc ttagccctct gggtgagtgc 120

<210>154

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>154

caagtttttg tttattcctc tatttttaca gatactgtgg atggtaggga agaaaagtct 60

gcttctgatt cttctggaaa acagtctact caggttatgg cagcaagtat gtctgctttt 120

<210>155

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>155

cctgctgacc ccagtagcct gcactggcgt tcacccctca gacacacagg tggcagcaaa 60

gttttattgt aaaataagag atcgatataa aaatgggata taaaaaggga gaaggagggg 120

<210>156

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>156

ttccatttag ggaagaaata aagagacaga gaaggagtga gagcatttta ttgcctgact 60

aaatcacaga acacagagtt tcctaggaat tgcatgaggt cagaaagaca aatgcagctg 120

<210>157

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>157

ctttctccaa ataagtcccg aaaaggggca ctttccagca gctgtggcca gcggtgccga 60

cgtcaggccc tcccccagcg gtgctgacgt cggcggtccg gccgggtgac ctcatcgccc 120

<210>158

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>158

acaattatat tggtctactt attttattta cctttaccag ttctctgtga agactgagaa 60

gcaacttgga cttccatatt actgaggtgc tgtttcaatg tggcaatttc tttttgagca 120

<210>159

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>159

taagagggaa ggtggtcttg gcacccggca ggtgcagcag ctggagagga gcattggcct 60

caaggacctg gcgatggctg acttggagca gaaggtcttg gagatggagg catccaccta 120

<210>160

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>160

aatgccctga aataatttct tttcttgtaa gattgactgt tcaagtacta ttatgctgga 60

caatattgtg aggaaagata ctaatataga tcatggccag ccaagaccac cctcaaacag 120

<210>161

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>161

gaaaaaaagg ctgaatgaaa ccccggctcc tttgaagaac aggaagagag cattgtgcat 60

ttattaaaac aacatataac acaaactcag ttaccacccc gtatgtctgg gataggcact 120

<210>162

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>162

aaactaaatt ccatttctgt tttcctaaca gggctggtgg acgaagccat tgataccaaa 60

tctctgttgg atgcttcaga agaagcaatt aaaaaagacc tggacaagtg caaggtagct 120

<210>163

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>163

ccggagggag ggcggcagga gcaggcggcg ggcgcgcgtg gaggcgggcg gcgggcgcac 60

agcagcagcc cgggcggtgg gcagccagga gcccccggcc cggcccggcc cggcccgccg 120

<210>164

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>164

aattattttg taacagggaa agttgctcta cctgggcagt agttaaagca ttgcacatag 60

aacaaatggc ttctgcatca tcatctgttt tctttttcac ttgcaaaagt tgagcagcct 120

<210>165

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>165

aacacttaaa cttccattaa aattagctta ccagaatcat agcttggagg cttcatatct 60

ccctgattca attctgtccc gtatttcaac ttgtggtatt tggctctaac aaagaaatga 120

<210>166

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>166

tgtgccctcc agcactcctg ccccgaccta cctgtcaaag aaggtggcca ggagcctccg 60

cagcaagacc ttatgcttca cccctgcaca caggtggcag ttcatcagct ggccgcgtgt 120

<210>167

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>167

aatgcccatg tggctagttt gattacaata cctgctggac taggcatgat gggtgttcct 60

ggtggccctc cacctcctgg aggaccctaa ataattatac aaaatttcag taaaaataag 120

<210>168

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>168

tcatctatgt gatgcatgaa aacagactca ccggcttctg aggtgtgatc cccgcgctgg 60

aaagctctaa ctctgcgagc cccaaggcac ccctcccccc agctcaggcc agctggggtc 120

<210>169

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>169

acaaaaagtt agacctttta ataattctta ccttctagag aaaggtcagt atttttagta 60

aaacttgggg cagtgcgttt gaagatcttg gttcgttctc ctcccacaac cacctctggt 120

<210>170

<211>120

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>170

aacatcttcc atttgttctc tgtttccaaa gggcatccgc ttcgatcctg aaattccgca 60

aacactacga ctagagtttg ctaaggcaaa cacgaagatg gccaagaaca aactcgtagg 120

<210>171

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>171

aatgatacgg cgaccaccga 20

<210>172

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>172

caagcagaag acggcatacg a 21

<210>173

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>173

aatgatacgg cgaccaccga 20

<210>174

<211>21

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>174

caagcagaag acggcatacg a 21

Claims

1. A probe library for detecting fusion genes of the NTRK gene family, comprising:

a first probe group and a second probe group,

wherein, the detection of the fusion gene of the NTRK gene family is carried out based on the combination of a DNA layer and an RNA layer;

the first probe group is used for DNA level detection and capture, and the second probe group is used for RNA level detection and capture;

the first probe group comprises all probes with nucleotide sequences shown in SEQ ID NO.1-SEQ ID NO. 170;

the second probe group includes all probes having nucleotide sequences as shown in SEQ ID NO.21-SEQ ID number 170.

2. The probe library of claim 1, wherein:

wherein the fusion gene that can be detected includes:

any one of the genes included in the NTRK gene family is fused to any one of AFAP1, AGBL4, ARHGEF2, BCAN, BCR, BTBD1, CD74, CHTOP, EML4, ETV6, IRF2BP 6, LMNA, MPRIP, MYO5 6, NACC 6, NFASC, P2RY 6, PAN 6, PLEKHA6, PPL, QKI, RBPMS, SCYL 6, sq3672, SSBP 6, STRN, TFG, TP 6, TPM 6, TPR 6, TRAF 6, TRIM6, VCL, ZNF710, ntl 6, IRF2BP 6, ak3672, PRDX 6, SLC25a 72, RRNAD 6, MEF 26, WDR 6, setma 6, and tnikma genes.

3. A detection reagent for detecting fusion genes of NTRK gene family, which is characterized by comprising:

the probe library of any one of claims 1-2.

4. The detection reagent according to claim 3, further comprising:

reagents required by RNA nucleic acid reverse transcription treatment, reagents required by the construction process of gDNA library and cDNA library construction, reagents required by gDNA capture library and cDNA capture library except the probe library, DNA negative quality control substances, DNA positive quality control substances, RNA negative quality control substances and RNA positive quality control substances.

5. The application of a detection reagent in the preparation of a kit for detecting NTRK gene family fusion genes is characterized in that:

the detection reagent is the detection reagent according to claim 3 or 4.

6. Use according to claim 5, characterized in that:

wherein, the detection of the NTRK gene family fusion gene comprises the following steps:

step 1, obtaining a library: respectively constructing and performing library amplification treatment on DNA nucleic acid extracted from a sample to be detected and RNA nucleic acid extracted from the sample to be detected through reverse transcription treatment to obtain a corresponding gDNA library and a corresponding cDNA library;

step 2, obtaining a capture library: respectively acquiring corresponding capture products by adopting the hybridization capture of a first probe group in the probe library and the gDNA library and the hybridization capture of a second probe group in the probe library and the cDNA library, respectively performing capture amplification treatment, and then purifying to respectively acquire a corresponding gDNA capture library and a corresponding cDNA capture library;

step 3, sequencing on the computer: sequencing the gDNA capture library and the cDNA capture library by a high-throughput sequencing method to respectively obtain corresponding gDNA sequencing data and cDNA sequencing data;

step 4, fusion analysis: performing letter generation analysis by adopting gDNA sequencing data to obtain fusion information of a DNA layer, performing letter generation analysis by adopting cDNA sequencing data to obtain fusion information of an RNA layer, and combining the fusion gene of the DNA layer and the fusion gene of the RNA layer to perform reliability judgment to obtain a positive fusion result.

7. Use according to claim 6, characterized in that:

wherein, in step 1, the total amount of the DNA nucleic acid extracted from the sample to be detected satisfies the following requirements: greater than or equal to 50ng and less than or equal to 500 ng;

the total amount of RNA nucleic acid extracted from a sample to be detected meets the following requirements: greater than or equal to 100 ng.

8. Use according to claim 6 or 7, characterized in that:

wherein, in the step 1,

synthesizing cDNA and purifying to obtain purified cDNA nucleic acid when the extracted RNA nucleic acid is subjected to reverse transcription treatment;

and respectively carrying out nucleic acid fragmentation treatment on the extracted DNA nucleic acid and the purified cDNA nucleic acid to respectively obtain nucleic acid fragments for constructing a gDNA library and a cDNA library.

9. Use according to claim 6 or 7, characterized in that:

wherein, the construction processes of the gDNA library and the cDNA library are as follows: adding A at the tail end, performing joint connection, performing primary purification again to obtain a corresponding purified joint connection product,

the reaction system of the terminal repair and the addition of A is as follows:

nucleic acid fragments, i.e. products of nucleic acid fragmentation: the volume of the solution is 50 mu L,

end repairing mixed liquid: 15 mu L of the mixture is prepared into a small volume,

total volume: 65 mu L of the solution;

the reaction procedure for the end repair plus a was:

hot lid 105 ℃: on the basis of the measured data, and On,

20℃：15min，

65℃：15min，

4℃：Hold；

the reaction system connected by the joint is as follows:

end repair plus a product: the volume of the suspension is 65 mu L,

ligase buffer: 25 mu L of the mixture is added into the solution,

a ligase: the volume of the solution is 5 mu L,

a joint a: 2 mu L of the mixture is prepared into a solution,

Nuclease-Free Water：3μL，

total volume: 100 mu L of the solution;

the reaction procedure for the linker attachment is:

hot lid 105 ℃: on the basis of the measured data, and On,

20℃：15 min，

4℃：Hold。

10. use according to claim 9, characterized in that:

wherein the purified adaptor-ligated products used to form the gDNA library and cDNA library, respectively, are subjected to the library amplification treatment and post-amplification purification treatment to obtain the gDNA library and cDNA library, respectively,

the reaction system of the library amplification treatment is as follows:

linker ligation product after purification: 20 mu L of the mixture is added into the solution,

library construction amplification primers, 10 μ M: the volume of the solution is 5 mu L,

library construction amplification buffer: 25 mu L of the mixture is added into the solution,

total volume: the volume of the solution is 50 mu L,

the sequence of the library construction amplification primer is shown as SEQ ID NO.171-SEQ ID NO. 172;

the reaction procedure for the library amplification treatment comprises:

(1) pre-operation is carried out for 3 minutes at 98 ℃;

(2) denaturation at 98 ℃ for 20 seconds;

(3) annealing at 60 ℃ for 15 seconds;

(4) annealing at 72 ℃ for 30 seconds;

(5) keeping the temperature at 72 ℃ for 5 minutes;

wherein said steps (2) - (4) are repeated for 5-13 cycles.

11. Use according to claim 10, characterized in that:

wherein said steps (2) - (4) are repeated for at least 7 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 50ng, and said steps (2) - (4) are repeated for at least 3 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 500 ng;

when the total amount of cDNA obtained by reverse transcription of RNA nucleic acid extracted from a sample to be tested is 5ng, the steps (2) to (4) are repeated for at least 12 cycles.

12. Use according to claim 6, characterized in that:

in step 2, the reaction system of the library capture amplification mixed solution in the capture amplification treatment is as follows:

library capture amplification buffer: 25 mu L of the mixture is added into the solution,

library capture amplification primers, 10 μ M: 2.5 mu L of the mixture is prepared,

Nuclease-Free Water：2.5μL，

total volume: 30 mu L of the mixture is prepared,

the sequence of the library capture amplification primer is shown as SEQ ID NO.173-SEQ ID NO. 174;

transferring 30 mu L of library capture amplification mixed liquor to a 0.2mL PCR tube filled with the capture product, performing vortex mixing, micro-centrifugation, and placing into a PCR instrument for capture amplification reaction, wherein the reaction procedure of the capture amplification treatment comprises the following steps:

(1) pre-operating at 98 ℃ for 45 seconds;

(2) denaturation at 98 ℃ for 15 seconds;

(3) annealing at 60 ℃ for 30 seconds;

(4) annealing for 1 minute at 72 ℃;

(5) keeping the temperature at 72 ℃ for 1 minute,

13. A kit for detecting NTRK gene family fusion genes is characterized by comprising:

a detection reagent is used for detecting the concentration of the active ingredients,

wherein the detection reagent is the detection reagent according to claim 3 or 4.

14. The kit of claim 12, wherein:

wherein the detection reagent further comprises: reagents required by RNA nucleic acid reverse transcription treatment, reagents required by the construction process of gDNA library and cDNA library construction, reagents required by gDNA capture library and cDNA capture library except the probe library, DNA negative quality control substances, DNA positive quality control substances, RNA negative quality control substances and RNA positive quality control substances.

15. The kit according to claim 12 or 13, characterized in that:

wherein, in use of the kit,

the total amount of DNA nucleic acid required is such that:

50ng or more and 500ng or less,

the total amount of RNA nucleic acid required is required to satisfy: greater than or equal to 100 ng.

16. The kit of claim 13, wherein:

wherein, the DNA negative quality control substance is DNA of a constructed wild type cell line, the DNA positive quality control substance is DNA of a constructed ETV6-NTRK3 fusion cell line, the RNA negative quality control substance is RNA of a constructed wild type cell line, and the RNA positive quality control substance is RNA of a constructed ETV6-NTRK3 fusion cell line.

17. A method for detecting a non-diagnostic treatment of a fusion gene of the NTRK gene family, characterized in that:

detecting the fusion gene based on a specificity probe library,

wherein the fusion gene is detected on the basis of both a DNA level and an RNA level,

the probe library according to any one of claims 1 to 2.

18. The detection method according to claim 17, comprising the steps of:

19. The detection method according to claim 18, characterized in that:

20. The detection method according to claim 18, characterized in that:

wherein, in the step 1,

21. The detection method according to claim 18 or 19, characterized in that:

wherein, the construction processes of the gDNA library and the cDNA library are as follows: after the end is repaired and A is added, the connector connection is carried out, and then the purification is carried out again to obtain the corresponding purified connector connection product,

the reaction system of the terminal repair and the addition of A is as follows:

total volume: 65 mu L of the solution;

the reaction procedure for the end repair plus a was:

hot lid 105 ℃: on the basis of the measured data, and On,

20℃：15min，

65℃：15min，

4℃：Hold；

the reaction system connected by the joint is as follows:

end repair plus a product: the volume of the suspension is 65 mu L,

ligase buffer: 25 mu L of the mixture is added into the solution,

a ligase: the volume of the solution is 5 mu L,

a joint a: 2 mu L of the mixture is prepared into a solution,

Nuclease-Free Water：3μL，

total volume: 100 mu L of the solution;

the reaction procedure for the linker attachment is:

hot lid 105 ℃: on the basis of the measured data, and On,

20℃：15 min，

4℃：Hold。

22. the detection method according to claim 21, characterized in that:

the reaction system of the library amplification treatment is as follows:

total volume: the volume of the solution is 50 mu L,

the reaction procedure for the library amplification treatment comprises:

(1) pre-operation is carried out for 3 minutes at 98 ℃;

(2) denaturation at 98 ℃ for 20 seconds;

(3) annealing at 60 ℃ for 15 seconds;

(4) annealing at 72 ℃ for 30 seconds;

(5) keeping the temperature at 72 ℃ for 5 minutes;

wherein said steps (2) - (4) are repeated for 5-13 cycles.

23. The detection method according to claim 22, characterized in that:

wherein said steps (2) - (4) are repeated for at least 7 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 50ng, and said steps (2) - (4) are repeated for at least 3 cycles when the total amount of DNA nucleic acid extracted from the sample to be detected is 500 ng; when the total amount of cDNA obtained by reverse transcription of RNA nucleic acid extracted from a sample to be tested is 5ng, the steps (2) to (4) are repeated for at least 12 cycles.

24. The detection method according to claim 18, characterized in that:

Nuclease-Free Water：2.5μL，

total volume: 30 mu L of the mixture is prepared,

the sequence of the library capture amplification primer is shown in SEQ ID NO.173-SEQ ID NO. 174;

(1) pre-operating at 98 ℃ for 45 seconds;

(2) denaturation at 98 ℃ for 15 seconds;

(3) annealing at 60 ℃ for 30 seconds;

(4) annealing for 1 minute at 72 ℃;

(5) keeping the temperature at 72 ℃ for 1 minute,