CN112575027A - Plant expression vector for inhibiting HSL1 gene and application thereof - Google Patents

Abstract

The invention provides a plant expression vector for inhibiting HSL1 gene and application thereof, and a method for interfering expression of plant HSL1 and obtaining herbicide dominant sensitive plants. The RNAi plant expression vector is used for transforming rice, so that the expression of the gene HSL1 can be successfully inhibited, the rice is changed from being resistant to herbicide to be sensitive, sensitive plants can be eliminated by the herbicide, and the rice which is dominant sensitive to the herbicide is cultivated. The rice has important application value in the aspects of cultivating new transgenic varieties, producing hybrid rice seeds, preventing transgene escape and the like.

Description

Plant expression vector for inhibiting HSL1 gene and application thereof

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to a plant expression vector for inhibiting HSL1(HIS1-Like) genes, a construction method and application thereof.

Background

Transgenic technology is increasingly used in various crop fields. However, the development of transgenic products since their birth has been considered to be very noisy. Therefore, the transgenic products need to be strictly controlled and supervised, and it is important to prevent the transgene from drifting and polluting other varieties and even other species. Therefore, there is a need to establish a mechanism that allows targeted elimination of hybrid seeds or transgenic plants. The cultivation of sterile lines sensitive to herbicides is one of the effective means for solving the problems.

beta-Triketone herbicides (b-tribeno herbicides, bTHs) are 4-hydroxyphenylpyruvate dioxygenase (HPPD) inhibitors, are widely applied to agriculture, and can effectively prevent and kill various broadleaf weeds and gramineous weeds. Furanulone (TFT) belongs to one of triketone herbicides, can inhibit synthesis of pigment indispensable to plant growth, and is absorbed by root, stem, sprout and leaf and rapidly conducted. HPPD is one of the most important herbicide targets at present. The HPPD inhibitor herbicide inhibits the synthesis of tocopherol and plastoquinone in plants, so that the biosynthesis of carotenoid is hindered, chlorophyll in the plants is finally destroyed, leaves are whitened, and finally withered and dead. The HPPD inhibitor herbicide has unique action mechanism and no cross resistance with the current market mainstream medicament, so that the problem of the current resistant malignant weeds can be effectively solved. Furan sulcotrione is the most safe HPPD inhibitor herbicide for rice in four registered HPPD inhibitors for the rice field in China at present. The benzofuranone can be absorbed by weed roots, stems, buds and leaves, and can simultaneously prevent and control gramineous weeds and sedum latifolium.

There are 6 HIS1-like genes (HSL) in rice and are highly conserved. The 5 HSLs (1/2/4/5/6) are located at Chr6 and are present as a gene cluster. The protein encoded by HSL has a double-stranded beta-helix sheet and is a typical structural feature of fe (ii)/2-oxoglutarate-dependent oxygenase proteins. Evolutionary analysis has shown that HSL genes in plants may possess similar functions. In contrast, rice OsHSL1 has been shown to be resistant to beta-triones such as benzofuranone TFT (Maeda, Hideo, et al. "A edge gene that is a broad-spectrum herbicide to beta-trione herbicides." science 365.6451(2019): 393. 396.).

Therefore, a technical means capable of effectively and dominantly inhibiting the expression of the HSL1 gene is developed, and an effective control scheme can be provided for the aspects of hybrid rice seed production, cultivation of new transgenic varieties, prevention of transgene escape and the like.

Disclosure of Invention

The invention aims to provide a plant expression vector for inhibiting HSL1(HIS1-Like) gene and application thereof.

In order to achieve the above object, the present invention provides a plant expression vector for inhibiting expression of HSL1(HIS1-Like) gene, comprising a hairpin structure expression cassette, wherein the hairpin structure expression cassette comprises a hairpin structure formed by DNA fragments represented by SEQ ID Nos. 1-3.

Wherein, the DNA fragment shown in SEQ ID No.1 is a forward DNA fragment with the length of 319bp based on the HSL1 coding frame, and the DNA fragment shown in SEQ ID No.3 is a DNA fragment with the length of 319bp based on the HSL1 coding frame and is reversely complementary with the DNA fragment shown in SEQ ID No. 1. SEQ ID No.2 is an intron sequence (Rice intron) from the Rice Zinc finger gene.

The DNA fragments shown in SEQ ID Nos. 1 to 3 are arranged in order from the upstream to the downstream. The hairpin expression cassette can be transcribed in a transformed plant cell to form a hairpin-type secondary structure, the DNA fragment shown in SEQ ID No.2 forms a hairpin 'loop', and the DNA fragments shown in SEQ ID Nos. 1 and 3 are complemented to form a hairpin 'stem'.

Wherein the hairpin expression cassette further comprises a plant constitutive promoter or a plant tissue specific promoter upstream of the hairpin and a terminator downstream of the hairpin.

Wherein the plant constitutive promoter is a Ubi promoter, a CAMV35S promoter or an Actin promoter of rice or corn; the plant tissue specific promoter is a Rubisco small subunit promoter or a Cab promoter. Preferably, when the promoter is the Ubi promoter of rice or maize, the effect of interfering the expression of the HSL1 gene is very strong.

The terminator includes: DNA sequences capable of terminating gene transcription in plants, such as NOS terminator and Ubi terminator. Preferably, the terminator is a NOS terminator.

The plant expression vector also comprises a selective marker expression cassette, wherein the selective marker expression cassette contains a promoter, a marker gene and a terminator, the promoter is a Ubi promoter, a CAMV35S promoter or an Actin promoter of rice or corn, and preferably, when the promoter is the CAMV35S promoter, a good effect of driving the over-expression of the selective marker gene in the plant can be obtained. The terminator is a NOS terminator or a Ubi terminator, preferably a NOS terminator.

The marker gene is a gene of an enzyme capable of producing a color change (e.g., a GUS gene, a luciferase gene, etc.), a fluorescent marker gene (e.g., a fluorescent protein gene), an antibiotic marker gene (an antibiotic marker for selection such as a hygromycin, gentamicin, a kanamycin gene), a herbicide selection marker gene (e.g., a glyphosate-resistant gene, a bispyribac-resistant gene, etc.), or a chemical agent resistance marker gene (e.g., an herbicide-resistant gene, etc.). Particularly preferably, the marker gene is the hygromycin gene.

In a preferred embodiment of the invention, the plant expression vector is obtained by connecting the DNA fragment shown in SEQ ID No.1-3 between SacI and BamHI sites of a plant binary transformation vector pTCK303 by overlapping method to obtain a plant expression vector pTCK303-HSL1 i-3.

Particularly preferably, the plant expression vector has a nucleotide sequence shown as SEQ ID No. 4.

Wherein the plant is rice, preferably, the plant is a transgenic rice line.

It is noted that intermediate vectors for constructing plant expression vectors, expression vectors with selectable marker genes, engineering bacteria, cells containing stem-loop structures of HSL1i-3, calli, transgenic seedlings, seeds and the like all belong to the protection scope of the invention.

In another aspect of the present invention, there is provided a method for constructing a plant expression vector, the method comprising: the DNA fragment shown in SEQ ID No.1-3 is connected between SacI and BamHI sites of a plant binary transformation vector pTCK303 by overlapping method to obtain an RNAi plant expression vector pTCK303-HSL1 i-3.

Specifically, the method can be performed according to the following steps:

(1) 3 pairs of primers are designed, 5' ends of two adjacent primers on the upstream and downstream of the DNA fragment shown in SEQ ID No.1-3 are respectively amplified to have about 15 nucleotide sequences which are repeated with corresponding connection positions of the fragment or the vector, so that the DNA fragment is recombined and connected by utilizing Gibson Assembly.

HSL1i-3-F:ATCGGGGAAATTCGAGCTcGTTCTGAACGAGTACGCATC

HSL1i-3-Rv1:GATTTTCACCATGGTGTCACCTAAGTTG

HSL1i-3-F2:ACACCATGGTGAAAATCTCGAAACAGCCGTGT

HSL1i-3-Rv2:CACCATGGGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCC

HSL1i-3-F3:AACTTACCCCATGGTGTCACCTAAGTTG

HSL1i-3-Rv:CTGCAGGTCGACTCTAGAGgatccGTTCTGAACGAGTACGCATC

(2) Construction and transformation of plant expression vectors

Using rice cDNA as template, the primers were used to perform PCR amplification of HSL1i-3 gene fragments 1 and 3. The amplification system and procedure were as follows:

the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

The procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

Using rice DNA as template, the above primers were used to perform PCR amplification of HSL1i-3 gene fragment 2. The amplification system and procedure were as follows:

the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

PCR product fragments are obtained and are respectively named as HSL1i-3-1 (shown by SEQ ID No. 1), HSL1i-3-2 (shown by SEQ ID No. 2) and HSL1i-3-3 (shown by SEQ ID No. 3) after being recovered. The binary plant transformation vector pTCK303 is digested by SacI + BamHI, and target fragments HSL1i-3-1, HSL1i-3-2 and HSL1i-3-3 are directly connected into the digested pTCK303 plasmid to obtain the vector pTCK303-HSL1 i-3.

The invention also provides application of the plant expression vector in preparation of herbicide dominant sensitive plants by interfering with expression of plant HSL1(HIS1-Like) genes.

The plant expression vector of the present invention can be used for transforming plant cells or tissues by conventional biological methods such as an agrobacterium-mediated genetic transformation method, a gene gun method, a pollen tube channel method, and the like.

Preferably, said use comprises introducing pTCK303-HSL1i-3 into Agrobacterium EHA105 strain and transforming callus. The callus can be anther-induced callus, mature embryo-induced callus, young embryo-induced callus, and young ear-induced callus.

One aspect of the present invention also provides a method for obtaining a herbicide-dominant-sensitive plant, comprising transforming a plant with the plant expression vector, and interfering with plant HSL1(HIS1-Like) gene expression.

In one embodiment of the present invention, the method for obtaining a herbicide dominant sensitive plant comprises:

(1) constructing a plant expression vector: connecting the DNA fragment shown in SEQ ID No.1-3 between SacI and BamHI sites of a plant binary transformation vector pTCK303 by overlapping method to obtain a plant expression vector pTCK303-HSL1 i-3;

(2) and (3) transformation: introducing pTCK303-HSL1i-3 into Agrobacterium EHA105 strain, transforming callus, and inducing and differentiating the transformed callus to obtain herbicide dominant sensitive plant.

Wherein the plant expression vector pTCK303-HSL1i-3 has a nucleotide sequence shown in SEQ ID No. 4.

Wherein the herbicide may be a beta-triketone herbicide. The beta-triketone herbicides of the present invention include, but are not limited to, benzofuranone.

The plant is rice, preferably, the plant is a transgenic rice line.

The invention provides application of the plant expression vector in breeding new transgenic varieties, hybrid rice seed production or prevention of transgene escape.

The invention constructs a plant binary transgenic vector aiming at rice HSL1(HIS1-Like) gene through screening, the vector can efficiently inhibit HSL1(HIS1-Like) gene, and the sequence is completely rice endogenous sequence, thereby effectively eliminating the risk and worry of public to exogenous gene transgene. The vector is used for transforming rice, so that the expression of HSL1 gene is successfully inhibited, and the rice is converted from being resistant to beta-triketone herbicide to being sensitive, thereby cultivating the rice which is dominant sensitive to the beta-triketone herbicide. So that the transgenic plants can be eliminated by means of applying herbicides. The rice has very important application value in the aspects of cultivating new transgenic varieties, producing hybrid rice seeds, preventing transgene escape and the like.

Drawings

FIG. 1 shows the electrophoresis chart of the amplification and recovery of HSL1i-3-1, HSL1i-3-2 and HSL1 i-3-33 target fragments. Wherein lanes 1-5 are fragments of interest HSL1 i-3-1; lanes 7-11 are fragments of the order HSL1 i-3-2; lanes 13-17 are HSL1i-3-3 target fragments.

FIG. 2 is an electrophoresis diagram of the cleavage and recovery of pTCK303 backbone vector. Wherein CK is pTCK303 backbone vector as control; lanes 1-6 are Sac I/BamH I double-cleaved pTCK303 backbone vector.

FIG. 3 is an electrophoretogram of pTCK303-HSL1i-3 vector digested with SacI and BamHI. CK in the figure is pTCK303-HSL1i-3 monoclonal recombinant plasmid; lanes 1-3 are the digested monoclonal recombinant plasmids, M is marker, and the size of the excised fragment is 1122bp, including the forward and reverse complementary sequences of the target fragment and the rice intron sequence.

FIG. 4 is the electrophoresis diagram of PCR detection of hygromycin resistance gene of transgenic line; lane 1, H₂O; lane 2 negative control (middle flower 11 non-transgenic plants); lane 3, positive control (pTCK303-HSL1i-3 plasmid); lanes 4-19, transgenic lines (where lanes 4, 18, 19 are transgenic negative lines); m, Marker.

FIG. 5 is a sensitivity test of pTCK303-HSL1i-3 transgenic T0 trilobate seedling leaves to 21.5mg/L furansulcotrione solution. WT is a ZH11 non-transgenic plant, and 13-2, 39-2 and 50-2 are sensitive strains. 0d is before spraying; 7d and 14d are recorded 7 days and 14 days after spraying.

FIG. 6 shows the result of spraying benzofuranone with a concentration of more than 1290mg/L on transgenic seedlings 14d after RNAi vectors are constructed after different loop sequences are used to replace the sequence of SEQ ID No.2 in comparative example 1. The sensitive lines are indicated by arrows.

Detailed Description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

EXAMPLE 1 Strain, plasmid acquisition and PCR primer Synthesis

(1) Strains and plasmids

The plant binary transformation vector pTCK303 as a backbone vector comprises a hygromycin resistance gene, a maize Ubi promoter and a NOS terminator. The E.coli (Escherichia coli) strain is DH5 alpha; the Agrobacterium tumefaciens (Agrobacterium tumefaciens) strain was EHA 105.

(2) PCR primer sequences

3 pairs of primers are designed, 5' ends of two adjacent primers on the upstream and downstream of the DNA fragment shown in SEQ ID No.1-3 are respectively amplified to have about 15 nucleotide sequences which are repeated with corresponding connection positions of the fragment or the vector, so that the DNA fragment is recombined and connected by utilizing Gibson Assembly.

HSL1i-3-F:ATCGGGGAAATTCGAGCTcGTTCTGAACGAGTACGCATC

HSL1i-3-Rv1:GATTTTCACCATGGTGTCACCTAAGTTG

HSL1i-3-F2:ACACCATGGTGAAAATCTCGAAACAGCCGTGT

HSL1i-3-Rv2:CACCATGGGGTAAGTTACTACAAACCTTTTTGTATTTATGTTCC

HSL1i-3-F3:AACTTACCCCATGGTGTCACCTAAGTTG

HSL1i-3-Rv:CTGCAGGTCGACTCTAGAGgatccGTTCTGAACGAGTACGCATC

Example 2 construction and transformation of RNAi plant expression vectors

(1) In order to construct an interference vector for HSL1(HIS1-Like) gene, the primers of example 1 were used to perform PCR amplification of HSL1i-3 gene fragments 1 and 3 using rice cDNA as a template. The amplification system and procedure were as follows:

the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

The procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 60 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

(2) Using rice DNA as template, the above primers were used to perform PCR amplification of HSL1i-3 gene fragment 2. The amplification system and procedure were as follows:

the procedure is as follows: pre-denaturation at 94 deg.C for 5-10min, denaturation at 94 deg.C for 30s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 30s, 30-35 cycles, and re-extension at 72 deg.C for 5 min; and finishing at 16 ℃.

After agarose gel electrophoresis, using

The PCR product fragments were recovered from Gel Extraction kit (Omega, the same applies below) and the sizes were 319bp, 478bp and 319bp, respectively, and named HSL1i-3-1, HSL1i-3-2 and HSL1i-3-3, respectively (FIG. 1). The vector plasmid pTCK303 was digested simultaneously with Sac I + BamH I, subjected to agarose gel electrophoresis (FIG. 2), and used

A band of about 14kb in size was recovered from Gel Extraction kit (Omega, the same applies below) to obtain a pTCK303 linear fragment.

The SacI + BamHI double digestion reaction system is as follows:

(3)2x lighting Cloning Kit connection Kit

Three fragments of HSL1i-3-1, HSL1i-3-2 and HSL1i-3-3 are connected to the pTCK303 vector by the following connection system:

and (3) connecting procedures: 30min at 50 ℃.

The ligation product is transformed into an escherichia coli DH5 alpha competent cell, the recombinant plasmid is subjected to double enzyme digestion by Sac I and BamH I, the size of a target fragment accords with the expectation, and a recombinant is sent to sequencing verification to be correct, namely, an HSL1i-3RNAi vector is constructed by taking a Rice Zinc finger gene intron (Rice intron) as a loop, and the vector is named as pTCK303-HSL1i-3 (see figure 3).

Example 3 Agrobacterium transformation of Rice and identification of transgenic plants

Introducing the pTCK303-HSL1i-3 recombinant plasmid into an Agrobacterium EHA105 strain, transforming 11 calli of japonica rice flowers, screening hygromycin resistance, differentiating and rooting to obtain 16 regenerated transgenic strains, identifying hygromycin resistance genes transferred into the transgenic strains through PCR (polymerase chain reaction), and transplanting 13 PCR positive strains into soil to obtain 11 viable strains.

Example 4 acquisition of sensitive and resistant transgenic lines of the Rice beta-triketone herbicide Fusulcotrione

In order to test the effect of the designed interference vector fragment in the transgenic plants, 21.5 mg/L-860 mg/L of a fursulcotrione solution is prepared by using a mother liquor (Bayer crop science (China) Co., Ltd., batch No. PH8000076) with the trade name of reclaimed multi (containing 18% of fursulcotrione) herbicide, pTCK303-HSL1i-3 transgenic T0 generation leaf blades obtained in example 3 are sprayed, and continuous observation is carried out after spraying.

21.5mg/L of the benzofuranone is sprayed with 11 HSL1i-3 transgenic strains, and the leaf tips of part of the strains begin to yellow 7 days after the spraying; 14d after spraying, 3 strains have dry leaf edges, irregular green leaf tips and yellow curly leaves, and belong to highly sensitive strains (figure 5); 5 strains have withered and brownish leaf tips and belong to moderate sensitive strains; the leaf reaction is not obvious before and after the spraying of 3 strains, and the strain belongs to a resistant strain.

Further spraying 43mg/L of the benzofuranone to 6 HSL1i-3 transgenic lines, wherein 14d after spraying, 4 lines have white leaves and withered leaves and belong to highly sensitive lines; 2 strains have white leaves to withered yellow leaf tips, and belong to the medium-sensitive strains.

The results show that the invention successfully obtains the transgenic material with dominant sensitivity to the herbicide.

Comparative example 1

In order to test the influence of different stem loops on the interference efficiency, after the intron sequence of SEQ ID No.2 is shortened to 300bp (see SEQ ID No.11), a vector is constructed and the middle flower 11 is transformed to obtain a transgenic line.

The transgenic strains are respectively sprayed with the furan sulcotrione with the concentration of 21.5-860 mg/L, and the result shows that the transgenic strains show higher resistance and survive without sensitive strains. When the transgenic plant line is sprayed with the furanone with the concentration of more than 1290mg/L, the furanone has sensitive phenotype, and the proportion of the sensitive plant line is low, which indicates that the OsHSL1i designed by using the SEQ ID NO.11 has poor interference efficiency on the HSL1 gene. The results of testing OsHSL1i transgenic line designed using SEQ ID NO.11 for T0 generation 3-5 leaf stage seedlings against mesotrione 14d at a concentration of 1290mg/L or more are shown in FIG. 6.

Comparative example 2

After further shortening the SEQ ID No.2 intron sequence to 240bp (see SEQ ID No.12), a vector is constructed and the Zhonghua 11 is transformed to obtain a transgenic line.

The transgenic lines are respectively sprayed with the high-concentration fursulcotrione, and the results show that the transgenic lines also show higher resistance, and are similar to those in comparative example 1, which shows that the OsHSL1i with stem loops designed according to the method has poor interference efficiency on the HSL1 gene.

In addition to the 2 comparative examples, in the research process of the present invention, the entire intron sequence was selected for the intron sequence of OsHSL1 gene, and the sequences with different truncated sizes in the intron sequence of OsHSL1 gene are expected to form hairpin structures with the DNA fragments shown in SEQ ID Nos. 1 and 3, but it was found that the DNA fragments shown by these intron sequences could not form hairpin "loops" or the stem-loop structures formed were very inefficient, so that they could not make the DNA fragments shown in SEQ ID Nos. 1 and 3 complementary to form hairpin "stems" to form double-stranded short RNA in vivo successfully after replacing the sequence shown in SEQ ID No.2 of the present invention. The invention fully shows that the intron sequence of SEQ ID No.2 and the DNA segments shown in SEQ ID No.1 and SEQ ID No.3 form a hairpin structure, and the constructed plant expression vector can well inhibit the HSL1 gene, has high interference efficiency, and enables the transgenic plant to show obvious sensitivity to the beta-triketone herbicide.

Although the invention has been described in detail hereinabove with respect to a general description and specific embodiments thereof, it will be apparent to those skilled in the art that modifications or improvements may be made thereto based on the invention. Accordingly, such modifications and improvements are intended to be within the scope of the invention as claimed.

Sequence listing

<110> Hainan Borax Rice Gene science and technology Co., Ltd

<120> plant expression vector for inhibiting HSL1 gene and application thereof

<130> KHP201117373.5

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 319

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gttctgaacg agtacgcatc aagaaccaaa agaataagag acgatatcgt tcaggctatg 60

tccaagcttc ttgggcttga tgaggattac ttcttcgacc gactcaacaa agctcctgca 120

cttgcaagat tcaactacta ccctccctgt ccaaggcctg accttgtgtt cggcgtcagg 180

cctcactccg acggctccct ctttacgatt cttctcgtcg acgaagatgt cggtggcctg 240

caaattcaga gggatggcaa gtggtacaat gttcaggtca ctcccaacac attgctgatc 300

aacttaggtg acaccatgg 319

<210> 2

<211> 478

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60

gttttttcaa gtgttaatct tcatactaat atatacagtg ggtactcttt atctactgcc 120

gtggaactgt catatttgat tatgaaattt tagctctaga aaatatttga tcatcaatgt 180

caagacttta tgaccttgca aaatacattt cctaattgag aacagggtaa aattatgaac 240

tatgcctctg aaccttcata cacaggcagc acattttttg ttgtaaaatt catcttaata 300

tcagcggaaa gactggacca gagaaagaaa aagttaagac aggcatatac tcttgatcct 360

ctaaaagaga tgaggcggta caatgatcaa ccatgaacat taaagtgata cgtggaacat 420

gagaacacaa ataattgtca ctggaacata aatacaaaaa ggtttgtagt aacttacc 478

<210> 3

<211> 319

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ccatggtgtc acctaagttg atcagcaatg tgttgggagt gacctgaaca ttgtaccact 60

tgccatccct ctgaatttgc aggccaccga catcttcgtc gacgagaaga atcgtaaaga 120

gggagccgtc ggagtgaggc ctgacgccga acacaaggtc aggccttgga cagggagggt 180

agtagttgaa tcttgcaagt gcaggagctt tgttgagtcg gtcgaagaag taatcctcat 240

caagcccaag aagcttggac atagcctgaa cgatatcgtc tcttattctt ttggttcttg 300

atgcgtactc gttcagaac 319

<210> 4

<211> 15186

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

catggtagat ctgagggtaa atttctagtt tttctccttc attttcttgg ttaggaccct 60

tttctctttt tatttttttg agctttgatc tttctttaaa ctgatctatt ttttaattga 120

ttggttatgg tgtaaatatt acatagcttt aactgataat ctgattactt tatttcgtgt 180

gtctatgatg atgatgatag ttacagaacc gacgactcgt ccgtcctgta gaacgtgaaa 240

tcaaaaaact cgacggcctg tgggcattca gtctggatcg cgaaaactgt ggaattgatc 300

agcgttggtg ggaaagcgcg ttacaagaaa gccgggcaat tgctgtgcca ggcagtttta 360

acgatcagtt cgccgatgca gatattcgta attatgcggg caacgtctgg tatcagcgcg 420

aagtctttat accgaaaggt tgggcaggcc agcgtatcgt gctgcgtttc gatgcggtca 480

ctcattacgg caaagtgtgg gtcaataatc aggaagtgat ggagcatcag ggcggctata 540

cgccatttga agccgatgtc acgccgtatg ttattgccgg gaaaagtgta cgtatcaccg 600

tttgtgtgaa caacgaactg aactggcaga ctatcccgcc gggaatggtg attaccgacg 660

aaaacggcaa gaaaaagcag tcttacttcc atgatttctt taactatgcc ggaatccatc 720

gcagcgtaat gctctacacc acgccgaaca cctgggtgga cgatatcacc gtggtgacgc 780

atgtcgcgca agactgtaac cacgcgtctg ttgactggca ggtggtggcc aatggtgatg 840

tcagcgttga actgcgtgat gcggatcaac aggtggttgc aactggacaa ggcactagcg 900

ggactttgca agtggtgaat ccgcacctct ggcaaccggg tgaaggttat ctctatgaac 960

tgtgcgtcac agccaaaagc cagacagagt gtgatatcta cccgcttcgc gtcggcatcc 1020

ggtcagtggc agtgaagggc gaacagttcc tgattaacca caaaccgttc tactttactg 1080

gctttggtcg tcatgaagat gcggacttac gtggcaaagg attcgataac gtgctgatgg 1140

tgcacgacca cgcattaatg gactggattg gggccaactc ctaccgtacc tcgcattacc 1200

cttacgctga agagatgctc gactgggcag atgaacatgg catcgtggtg attgatgaaa 1260

ctgctgctgt cggctttaac ctctctttag gcattggttt cgaagcgggc aacaagccga 1320

aagaactgta cagcgaagag gcagtcaacg gggaaactca gcaagcgcac ttacaggcga 1380

ttaaagagct gatagcgcgt gacaaaaacc acccaagcgt ggtgatgtgg agtattgcca 1440

acgaaccgga tacccgtccg caagtgcacg ggaatatttc gccactggcg gaagcaacgc 1500

gtaaactcga cccgacgcgt ccgatcacct gcgtcaatgt aatgttctgc gacgctcaca 1560

ccgataccat cagcgatctc tttgatgtgc tgtgcctgaa ccgttattac ggatggtatg 1620

tccaaagcgg cgatttggaa acggcagaga aggtactgga aaaagaactt ctggcctggc 1680

aggagaaact gcatcagccg attatcatca ccgaatacgg cgtggatacg ttagccgggc 1740

tgcactcaat gtacaccgac atgtggagtg aagagtatca gtgtgcatgg ctggatatgt 1800

atcaccgcgt ctttgatcgc gtcagcgccg tcgtcggtga acaggtatgg aatttcgccg 1860

attttgcgac ctcgcaaggc atattgcgcg ttggcggtaa caagaaaggg atcttcactc 1920

gcgaccgcaa accgaagtcg gcggcttttc tgctgcaaaa acgctggact ggcatgaact 1980

tcggtgaaaa accgcagcag ggaggcaaac aagctagcca ccaccaccac caccacgtgt 2040

gaattacagg tgaccagctc gaatttcccc gatcgttcaa acatttggca ataaagtttc 2100

ttaagattga atcctgttgc cggtcttgcg atgattatca tataatttct gttgaattac 2160

gttaagcatg taataattaa catgtaatgc atgacgttat ttatgagatg ggtttttatg 2220

attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatata gcgcgcaaac 2280

taggataaat tatcgcgcgc ggtgtcatct atgttactag atcgggaatt aaactatcag 2340

tgtttgacag gatatattgg cgggtaaacc taagagaaaa gagcgtttat tagaataacg 2400

gatatttaaa agggcgtgaa aaggtttatc cgttcgtcca tttgtatgtg catgccaacc 2460

acagggttcc cctcgggatc aaagtacttt gatccaaccc ctccgctgct atagtgcagt 2520

cggcttctga cgttcagtgc agccgtcttc tgaaaacgac atgtcgcaca agtcctaagt 2580

tacgcgacag gctgccgccc tgcccttttc ctggcgtttt cttgtcgcgt gttttagtcg 2640

cataaagtag aatacttgcg actagaaccg gagacattac gccatgaaca agagcgccgc 2700

cgctggcctg ctgggctatg cccgcgtcag caccgacgac caggacttga ccaaccaacg 2760

ggccgaactg cacgcggccg gctgcaccaa gctgttttcc gagaagatca ccggcaccag 2820

gcgcgaccgc ccggagctgg ccaggatgct tgaccaccta cgccctggcg acgttgtgac 2880

agtgaccagg ctagaccgcc tggcccgcag cacccgcgac ctactggaca ttgccgagcg 2940

catccaggag gccggcgcgg gcctgcgtag cctggcagag ccgtgggccg acaccaccac 3000

gccggccggc cgcatggtgt tgaccgtgtt cgccggcatt gccgagttcg agcgttccct 3060

aatcatcgac cgcacccgga gcgggcgcga ggccgccaag gcccgaggcg tgaagtttgg 3120

cccccgccct accctcaccc cggcacagat cgcgcacgcc cgcgagctga tcgaccagga 3180

aggccgcacc gtgaaagagg cggctgcact gcttggcgtg catcgctcga ccctgtaccg 3240

cgcacttgag cgcagcgagg aagtgacgcc caccgaggcc aggcggcgcg gtgccttccg 3300

tgaggacgca ttgaccgagg ccgacgccct ggcggccgcc gagaatgaac gccaagagga 3360

acaagcatga aaccgcacca ggacggccag gacgaaccgt ttttcattac cgaagagatc 3420

gaggcggaga tgatcgcggc cgggtacgtg ttcgagccgc ccgcgcacgt ctcaaccgtg 3480

cggctgcatg aaatcctggc cggtttgtct gatgccaagc tggcggcctg gccggccagc 3540

ttggccgctg aagaaaccga gcgccgccgt ctaaaaaggt gatgtgtatt tgagtaaaac 3600

agcttgcgtc atgcggtcgc tgcgtatatg atgcgatgag taaataaaca aatacgcaag 3660

gggaacgcat gaaggttatc gctgtactta accagaaagg cgggtcaggc aagacgacca 3720

tcgcaaccca tctagcccgc gccctgcaac tcgccggggc cgatgttctg ttagtcgatt 3780

ccgatcccca gggcagtgcc cgcgattggg cggccgtgcg ggaagatcaa ccgctaaccg 3840

ttgtcggcat cgaccgcccg acgattgacc gcgacgtgaa ggccatcggc cggcgcgact 3900

tcgtagtgat cgacggagcg ccccaggcgg cggacttggc tgtgtccgcg atcaaggcag 3960

ccgacttcgt gctgattccg gtgcagccaa gcccttacga catatgggcc accgccgacc 4020

tggtggagct ggttaagcag cgcattgagg tcacggatgg aaggctacaa gcggcctttg 4080

tcgtgtcgcg ggcgatcaaa ggcacgcgca tcggcggtga ggttgccgag gcgctggccg 4140

ggtacgagct gcccattctt gagtcccgta tcacgcagcg cgtgagctac ccaggcactg 4200

ccgccgccgg cacaaccgtt cttgaatcag aacccgaggg cgacgctgcc cgcgaggtcc 4260

aggcgctggc cgctgaaatt aaatcaaaac tcatttgagt taatgaggta aagagaaaat 4320

gagcaaaagc acaaacacgc taagtgccgg ccgtccgagc gcacgcagca gcaaggctgc 4380

aacgttggcc agcctggcag acacgccagc catgaagcgg gtcaactttc agttgccggc 4440

ggaggatcac accaagctga agatgtacgc ggtacgccaa ggcaagacca ttaccgagct 4500

gctatctgaa tacatcgcgc agctaccaga gtaaatgagc aaatgaataa atgagtagat 4560

gaattttagc ggctaaagga ggcggcatgg aaaatcaaga acaaccaggc accgacgccg 4620

tggaatgccc catgtgtgga ggaacgggcg gttggccagg cgtaagcggc tgggttgtct 4680

gccggccctg caatggcact ggaaccccca agcccgagga atcggcgtga cggtcgcaaa 4740

ccatccggcc cggtacaaat cggcgcggcg ctgggtgatg acctggtgga gaagttgaag 4800

gccgcgcagg ccgcccagcg gcaacgcatc gaggcagaag cacgccccgg tgaatcgtgg 4860

caagcggccg ctgatcgaat ccgcaaagaa tcccggcaac cgccggcagc cggtgcgccg 4920

tcgattagga agccgcccaa gggcgacgag caaccagatt ttttcgttcc gatgctctat 4980

gacgtgggca cccgcgatag tcgcagcatc atggacgtgg ccgttttccg tctgtcgaag 5040

cgtgaccgac gagctggcga ggtgatccgc tacgagcttc cagacgggca cgtagaggtt 5100

tccgcagggc cggccggcat ggccagtgtg tgggattacg acctggtact gatggcggtt 5160

tcccatctaa ccgaatccat gaaccgatac cgggaaggga agggagacaa gcccggccgc 5220

gtgttccgtc cacacgttgc ggacgtactc aagttctgcc ggcgagccga tggcggaaag 5280

cagaaagacg acctggtaga aacctgcatt cggttaaaca ccacgcacgt tgccatgcag 5340

cgtacgaaga aggccaagaa cggccgcctg gtgacggtat ccgagggtga agccttgatt 5400

agccgctaca agatcgtaaa gagcgaaacc gggcggccgg agtacatcga gatcgagcta 5460

gctgattgga tgtaccgcga gatcacagaa ggcaagaacc cggacgtgct gacggttcac 5520

cccgattact ttttgatcga tcccggcatc ggccgttttc tctaccgcct ggcacgccgc 5580

gccgcaggca aggcagaagc cagatggttg ttcaagacga tctacgaacg cagtggcagc 5640

gccggagagt tcaagaagtt ctgtttcacc gtgcgcaagc tgatcgggtc aaatgacctg 5700

ccggagtacg atttgaagga ggaggcgggg caggctggcc cgatcctagt catgcgctac 5760

cgcaacctga tcgagggcga agcatccgcc ggttcctaat gtacggagca gatgctaggg 5820

caaattgccc tagcagggga aaaaggtcga aaaggtctct ttcctgtgga tagcacgtac 5880

attgggaacc caaagccgta cattgggaac cggaacccgt acattgggaa cccaaagccg 5940

tacattggga accggtcaca catgtaagtg actgatataa aagagaaaaa aggcgatttt 6000

tccgcctaaa actctttaaa acttattaaa actcttaaaa cccgcctggc ctgtgcataa 6060

ctgtctggcc agcgcacagc cgaagagctg caaaaagcgc ctacccttcg gtcgctgcgc 6120

tccctacgcc ccgccgcttc gcgtcggcct atcgcggccg ctggccgctc aaaaatggct 6180

ggcctacggc caggcaatct accagggcgc ggacaagccg cgccgtcgcc actcgaccgc 6240

cggcgcccac atcaaggcac cctgcctcgc gcgtttcggt gatgacggtg aaaacctctg 6300

acacatgcag ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg ggagcagaca 6360

agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca tgacccagtc 6420

acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca gattgtactg 6480

agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa ataccgcatc 6540

aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg gctgcggcga 6600

gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg ggataacgca 6660

ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa ggccgcgttg 6720

ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg acgctcaagt 6780

cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc tggaagctcc 6840

ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc ctttctccct 6900

tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc ggtgtaggtc 6960

gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg ctgcgcctta 7020

tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc actggcagca 7080

gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga gttcttgaag 7140

tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc tctgctgaag 7200

ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac caccgctggt 7260

agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg atctcaagaa 7320

gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc acgttaaggg 7380

attttggtca tgcattctag gtactaaaac aattcatcca gtaaaatata atattttatt 7440

ttctcccaat caggcttgat ccccagtaag tcaaaaaata gctcgacata ctgttcttcc 7500

ccgatatcct ccctgatcga ccggacgcag aaggcaatgt cataccactt gtccgccctg 7560

ccgcttctcc caagatcaat aaagccactt actttgccat ctttcacaaa gatgttgctg 7620

tctcccaggt cgccgtggga aaagacaagt tcctcttcgg gcttttccgt ctttaaaaaa 7680

tcatacagct cgcgcggatc tttaaatgga gtgtcttctt cccagttttc gcaatccaca 7740

tcggccagat cgttattcag taagtaatcc aattcggcta agcggctgtc taagctattc 7800

gtatagggac aatccgatat gtcgatggag tgaaagagcc tgatgcactc cgcatacagc 7860

tcgataatct tttcagggct ttgttcatct tcatactctt ccgagcaaag gacgccatcg 7920

gcctcactca tgagcagatt gctccagcca tcatgccgtt caaagtgcag gacctttgga 7980

acaggcagct ttccttccag ccatagcatc atgtcctttt cccgttccac atcataggtg 8040

gtccctttat accggctgtc cgtcattttt aaatataggt tttcattttc tcccaccagc 8100

ttatatacct tagcaggaga cattccttcc gtatctttta cgcagcggta tttttcgatc 8160

agttttttca attccggtga tattctcatt ttagccattt attatttcct tcctcttttc 8220

tacagtattt aaagataccc caagaagcta attataacaa gacgaactcc aattcactgt 8280

tccttgcatt ctaaaacctt aaataccaga aaacagcttt ttcaaagttg ttttcaaagt 8340

tggcgtataa catagtatcg acggagccga ttttgaaacc gcggtgatca caggcagcaa 8400

cgctctgtca tcgttacaat caacatgcta ccctccgcga gatcatccgt gtttcaaacc 8460

cggcagctta gttgccgttc ttccgaatag catcggtaac atgagcaaag tctgccgcct 8520

tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat cgagtggtga 8580

ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga tatattgtgg 8640

tgtaaacaaa ttgacgctta gacaacttaa taacacattg cggacgtttt taatgtactg 8700

aattaacgcc gaattaattc gggggatctg gattttagta ctggattttg gttttaggaa 8760

ttagaaattt tattgataga agtattttac aaatacaaat acatactaag ggtttcttat 8820

atgctcaaca catgagcgaa accctatagg aaccctaatt cccttatctg ggaactactc 8880

acacattatt atggagaaac tcgagcttgt cgatcgacag atccggtcgg catctactct 8940

atttctttgc cctcggacga gtgctggggc gtcggtttcc actatcggcg agtacttcta 9000

cacagccatc ggtccagacg gccgcgcttc tgcgggcgat ttgtgtacgc ccgacagtcc 9060

cggctccgga tcggacgatt gcgtcgcatc gaccctgcgc ccaagctgca tcatcgaaat 9120

tgccgtcaac caagctctga tagagttggt caagaccaat gcggagcata tacgcccgga 9180

gtcgtggcga tcctgcaagc tccggatgcc tccgctcgaa gtagcgcgtc tgctgctcca 9240

tacaagccaa ccacggcctc cagaagaaga tgttggcgac ctcgtattgg gaatccccga 9300

acatcgcctc gctccagtca atgaccgctg ttatgcggcc attgtccgtc aggacattgt 9360

tggagccgaa atccgcgtgc acgaggtgcc ggacttcggg gcagtcctcg gcccaaagca 9420

tcagctcatc gagagcctgc gcgacggacg cactgacggt gtcgtccatc acagtttgcc 9480

agtgatacac atggggatca gcaatcgcgc atatgaaatc acgccatgta gtgtattgac 9540

cgattccttg cggtccgaat gggccgaacc cgctcgtctg gctaagatcg gccgcagcga 9600

tcgcatccat agcctccgcg accggttgta gaacagcggg cagttcggtt tcaggcaggt 9660

cttgcaacgt gacaccctgt gcacggcggg agatgcaata ggtcaggctc tcgctaaact 9720

ccccaatgtc aagcacttcc ggaatcggga gcgcggccga tgcaaagtgc cgataaacat 9780

aacgatcttt gtagaaacca tcggcgcagc tatttacccg caggacatat ccacgccctc 9840

ctacatcgaa gctgaaagca cgagattctt cgccctccga gagctgcatc aggtcggaga 9900

cgctgtcgaa cttttcgatc agaaacttct cgacagacgt cgcggtgagt tcaggctttt 9960

tcatatctca ttgccccccc ggatctgcga aagctcgaga gagatagatt tgtagagaga 10020

gactggtgat ttcagcgtgt cctctccaaa tgaaatgaac ttccttatat agaggaaggt 10080

cttgcgaagg atagtgggat tgtgcgtcat cccttacgtc agtggagata tcacatcaat 10140

ccacttgctt tgaagacgtg gttggaacgt cttctttttc cacgatgctc ctcgtgggtg 10200

ggggtccatc tttgggacca ctgtcggcag aggcatcttg aacgatagcc tttcctttat 10260

cgcaatgatg gcatttgtag gtgccacctt ccttttctac tgtccttttg atgaagtgac 10320

agatagctgg gcaatggaat ccgaggaggt ttcccgatat taccctttgt tgaaaagtct 10380

caatagccct ttggtcttct gagactgtat ctttgatatt cttggagtag acgagagtgt 10440

cgtgctccac catgttatca catcaatcca cttgctttga agacgtggtt ggaacgtctt 10500

ctttttccac gatgctcctc gtgggtgggg gtccatcttt gggaccactg tcggcagagg 10560

catcttgaac gatagccttt cctttatcgc aatgatggca tttgtaggtg ccaccttcct 10620

tttctactgt ccttttgatg aagtgacaga tagctgggca atggaatccg aggaggtttc 10680

ccgatattac cctttgttga aaagtctcaa tagccctttg gtcttctgag actgtatctt 10740

tgatattctt ggagtagacg agagtgtcgt gctccaccat gttggcaagc tgctctagcc 10800

aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggcacgacag 10860

gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt aatgtgagtt agctcactca 10920

ttaggcaccc caggctttac actttatgct tccggctcgt atgttgtgtg gaattgtgag 10980

cggataacaa tttcacacag gaaacagcta tgaccatgat tacgaattcc ccgatctagt 11040

aacatagatg acaccgcgcg cgataattta tcctagtttg cgcgctatat tttgttttct 11100

atcgcgtatt aaatgtataa ttgcgggact ctaatcataa aaacccatct cataaataac 11160

gtcatgcatt acatgttaat tattacatgc ttaacgtaat tcaacagaaa ttatatgata 11220

atcatcgcaa gaccggcaac aggattcaat cttaagaaac tttattgcca aatgtttgaa 11280

cgatcgggga aattcgagct cgttctgaac gagtacgcat caagaaccaa aagaataaga 11340

gacgatatcg ttcaggctat gtccaagctt cttgggcttg atgaggatta cttcttcgac 11400

cgactcaaca aagctcctgc acttgcaaga ttcaactact accctccctg tccaaggcct 11460

gaccttgtgt tcggcgtcag gcctcactcc gacggctccc tctttacgat tcttctcgtc 11520

gacgaagatg tcggtggcct gcaaattcag agggatggca agtggtacaa tgttcaggtc 11580

actcccaaca cattgctgat caacttaggt gacaccatgg tgaaaatctc gaaacagccg 11640

tgtcatagtc aatcattagg tgttatagga acaatcaaag gttttttcaa gtgttaatct 11700

tcatactaat atatacagtg ggtactcttt atctactgcc gtggaactgt catatttgat 11760

tatgaaattt tagctctaga aaatatttga tcatcaatgt caagacttta tgaccttgca 11820

aaatacattt cctaattgag aacagggtaa aattatgaac tatgcctctg aaccttcata 11880

cacaggcagc acattttttg ttgtaaaatt catcttaata tcagcggaaa gactggacca 11940

gagaaagaaa aagttaagac aggcatatac tcttgatcct ctaaaagaga tgaggcggta 12000

caatgatcaa ccatgaacat taaagtgata cgtggaacat gagaacacaa ataattgtca 12060

ctggaacata aatacaaaaa ggtttgtagt aacttacccc atggtgtcac ctaagttgat 12120

cagcaatgtg ttgggagtga cctgaacatt gtaccacttg ccatccctct gaatttgcag 12180

gccaccgaca tcttcgtcga cgagaagaat cgtaaagagg gagccgtcgg agtgaggcct 12240

gacgccgaac acaaggtcag gccttggaca gggagggtag tagttgaatc ttgcaagtgc 12300

aggagctttg ttgagtcggt cgaagaagta atcctcatca agcccaagaa gcttggacat 12360

agcctgaacg atatcgtctc ttattctttt ggttcttgat gcgtactcgt tcagaacgga 12420

tcctctagag tcgacctgca gaagtaacac caaacaacag ggtgagcatc gacaaaagaa 12480

acagtaccaa gcaaataaat agcgtatgaa ggcagggcta aaaaaatcca catatagctg 12540

ctgcatatgc catcatccaa gtatatcaag atcaaaataa ttataaaaca tacttgttta 12600

ttataataga taggtactca aggttagagc atatgaatag atgctgcata tgccatcatg 12660

tatatgcatc agtaaaaccc acatcaacat gtatacctat cctagatcga tatttccatc 12720

catcttaaac tcgtaactat gaagatgtat gacacacaca tacagttcca aaattaataa 12780

atacaccagg tagtttgaaa cagtattcta ctccgatcta gaacgaatga acgaccgccc 12840

aaccacacca catcatcaca accaagcgaa caaaaagcat ctctgtatat gcatcagtaa 12900

aacccgcatc aacatgtata cctatcctag atcgatattt ccatccatca tcttcaattc 12960

gtaactatga atatgtatgg cacacacata cagatccaaa attaataaat ccaccaggta 13020

gtttgaaaca gaattctact ccgatctaga acgaccgccc aaccagacca catcatcaca 13080

accaagacaa aaaaaagcat gaaaagatga cccgacaaac aagtgcacgg catatattga 13140

aataaaggaa aagggcaaac caaaccctat gcaacgaaac aaaaaaaatc atgaaatcga 13200

tcccgtctgc ggaacggcta gagccatccc aggattcccc aaagagaaac actggcaagt 13260

tagcaatcag aacgtgtctg acgtacaggt cgcatccgtg tacgaacgct agcagcacgg 13320

atctaacaca aacacggatc taacacaaac atgaacagaa gtagaactac cgggccctaa 13380

ccatggaccg gaacgccgat ctagagaagg tagagagggg ggggggggga ggacgagcgg 13440

cgtaccttga agcggaggtg ccgacgggtg gatttggggg agatctggtt gtgtgtgtgt 13500

gcgctccgaa caacacgagg ttggggaaag agggtgtgga gggggtgtct atttattacg 13560

gcgggcgagg aagggaaagc gaaggagcgg tgggaaagga atcccccgta gctgccggtg 13620

ccgtgagagg aggaggaggc cgcctgccgt gccggctcac gtctgccgct ccgccacgca 13680

atttctggat gccgacagcg gagcaagtcc aacggtggag cggaactctc gagaggggtc 13740

cagaggcagc gacagagatg ccgtgccgtc tgcttcgctt ggcccgacgc gacgctgctg 13800

gttcgctggt tggtgtccgt tagactcgtc gacggcgttt aacaggctgg cattatctac 13860

tcgaaacaag aaaaatgttt ccttagtttt tttaatttct taaagggtat ttgtttaatt 13920

tttagtcact ttattttatt ctattttata tctaaattat taaataaaaa aactaaaata 13980

gagttttagt tttcttaatt tagaggctaa aatagaataa aatagatgta ctaaaaaaat 14040

tagtctataa aaaccattaa ccctaaaccc taaatggatg tactaataaa atggatgaag 14100

tattatatag gtgaagctat ttgcaaaaaa aaaggagaac acatgcacac taaaaagata 14160

aaactgtaga gtcctgttgt caaaatactc aattgtcctt tagaccatgt ctaactgttc 14220

atttatatga ttctctaaaa cactgatatt attgtagtac tatagattat attattcgta 14280

gagtaaagtt taaatatatg tataaagata gataaactgc acttcaaaca agtgtgacaa 14340

aaaaaatatg tggtaatttt ttataactta gacatgcaat gctcattatc tctagagagg 14400

ggcacgaccg ggtcacgctg cacaagcttg gcactggccg tcgttttaca acgtcgtgac 14460

tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc 14520

tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat 14580

ggcgaatgct agagcagctt gagcttggat cagattgtcg tttcccgcct tcagtttagc 14640

ttcatggagt caaagattca aatagaggac ctaacagaac tcgccgtaaa gactggcgaa 14700

cagttcatac agagtctctt acgactcaat gacaagaaga aaatcttcgt caacatggtg 14760

gagcacgaca cacttgtcta ctccaaaaat atcaaagata cagtctcaga agaccaaagg 14820

gcaattgaga cttttcaaca aagggtaata tccggaaacc tcctcggatt ccattgccca 14880

gctatctgtc actttattgt gaagatagtg gaaaaggaag gtggctccta caaatgccat 14940

cattgcgata aaggaaaggc catcgttgaa gatgcctctg ccgacagtgg tcccaaagat 15000

ggacccccac ccacgaggag catcgtggaa aaagaagacg ttccaaccac gtcttcaaag 15060

caagtggatt gatgtgatat ctccactgac gtaagggatg acgcacaatc ccactatcct 15120

tcgcaagacc cttcctctat ataaggaagt tcatttcatt tggagagaac acgggggact 15180

cttgac 15186

<210> 5

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

atcggggaaa ttcgagctcg ttctgaacga gtacgcatc 39

<210> 6

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gattttcacc atggtgtcac ctaagttg 28

<210> 7

<211> 32

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

acaccatggt gaaaatctcg aaacagccgt gt 32

<210> 8

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caccatgggg taagttacta caaacctttt tgtatttatg ttcc 44

<210> 9

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aacttacccc atggtgtcac ctaagttg 28

<210> 10

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctgcaggtcg actctagagg atccgttctg aacgagtacg catc 44

<210> 11

<211> 300

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60

gttttttcaa gtgttaatct tcatactaat atatacagtg ggtactcttt atctactgcc 120

gtggaactgt catatttgat tatgaaattt tagctctaga aaatatttga tcatcaatgt 180

caagacttta tgaccttgca aaatacattt cctaattgag aacagggtaa aattatgaac 240

tatgcctctg aaccttcata cacaggcagc acattttttg ttgtaaaatt catcttaata 300

<210> 12

<211> 240

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgaaaatctc gaaacagccg tgtcatagtc aatcattagg tgttatagga acaatcaaag 60

gttttttcaa gtgttaatct tcatactaat atatacagtg ggtactcttt atctactgcc 120

gtggaactgt catatttgat tatgaaattt tagctctaga aaatatttga tcatcaatgt 180

caagacttta tgaccttgca aaatacattt cctaattgag aacagggtaa aattatgaac 240

Claims (10)

1. A plant expression vector for inhibiting HSL1 gene, which comprises a hairpin structure expression cassette, wherein the hairpin structure expression cassette comprises a hairpin structure formed by DNA fragments as shown in SEQ ID No. 1-3.

2. The plant expression vector of claim 1, wherein the hairpin expression cassette further comprises a plant constitutive promoter or a plant tissue specific promoter upstream of the hairpin structure and a terminator downstream of the hairpin structure,

wherein the plant constitutive promoter is a Ubi promoter, a CAMV35S promoter or an Actin promoter of rice or corn; the plant tissue specific promoter is a Rubisco small subunit promoter or a Cab promoter.

3. The plant expression vector of claim 1, further comprising a selectable marker expression cassette comprising a promoter, a marker gene, and a terminator, wherein the promoter is a Ubi promoter, CAMV35S promoter, or an Actin promoter of rice or maize; the marker gene is a gene of enzyme capable of generating color change, a fluorescence marker gene, an antibiotic marker gene, a herbicide screening marker gene or an anti-chemical agent marker gene, and the terminator is a NOS terminator or a Ubi terminator.

4. The plant expression vector of any one of claims 1 to 3, having the nucleotide sequence shown in SEQ ID No. 4.

5. A biomaterial comprising the plant expression vector of any one of claims 1 to 4, wherein the biomaterial is an engineered bacterium, a cell comprising stem-loop structure of HSL1i-3, a callus, a plant, a seed.

6. A method of constructing a plant expression vector, the method comprising: the DNA fragment shown in SEQ ID No.1-3 is connected between SacI and BamHI sites of a plant binary transformation vector pTCK303 by overlapping method to obtain an RNAi plant expression vector pTCK303-HSL1 i-3.

7. Use of a plant expression vector according to any of claims 1 to 4 for interfering with the expression of the plant HSL1 gene for the preparation of herbicide-dominant sensitive plants, comprising introducing pTCK303-HSL1i-3 into agrobacterium EHA105 strain and transforming plant calli.

8. A method for interfering the expression of plant HSL1 gene, which comprises transforming the plant with the plant expression vector of any one of claims 1-4 to interfere the expression of plant HSL1 gene.

9. The method of claim 8, comprising:

(1) constructing RNAi plant expression vector: connecting the DNA fragment shown in SEQ ID No.1-3 between SacI and BamHI sites of a plant binary transformation vector pTCK303 by overlapping method to obtain a plant expression vector pTCK303-HSL1 i-3;

(2) and (3) transformation: introducing pTCK303-HSL1i-3 into Agrobacterium EHA105 strain, transforming callus, and inducing and differentiating the transformed callus to obtain dominant sensitive beta-triketone herbicide plant.

10. Use of the plant expression vector of any one of claims 1 to 4 for breeding new transgenic varieties, hybrid rice seed production, or prevention of transgene escape.

Images