CN112553230A - High-yield IAA trichoderma viride engineering strain and construction method and application thereof - Google Patents

Abstract

The invention provides a high-yield IAA trichoderma viride engineering strain and a construction method and application thereof, belonging to the technical field of microorganisms. The invention identifies coding genes respectively coding tryptophan synthetase and tryptophan decarboxylase from Trichoderma viride Tv-1511 genome, and successfully constructs Trichoderma viride engineering bacteria (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) with TvTRPS and/or TvTDC over-expression.

Description

High-yield IAA trichoderma viride engineering strain and construction method and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a high-yield IAA trichoderma viride engineering strain as well as a construction method and application thereof.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

The abuse of chemical fertilizers leads to serious environmental pollution, pesticide and chemical fertilizer residues release a large amount of harmful substances to the environment, pollute soil, water sources and food, and greatly threaten human health and living environment, so that the development of novel fertilizers which can reduce the consumption of chemical fertilizers and meet the agricultural sustainable development is necessary. The existence of a large amount of growth-promoting bacteria in plants and plant rhizosphere soil can ensure that the soil has ineffective nutrition and effectiveness to enhance the nutrient utilization rate and can generate metabolites beneficial to the growth of the plants.

Indole-3-acetic acid (IAA) is a signal substance for producing auxin and an auxin substance commonly existing in plants. It has the most obvious functions of promoting cell growth, increasing cell volume and weight, promoting cell division and differentiation, regulating rooting and other physiological functions.

Since 1977 scientists found that azospirillum brasilense could synthesize IAA, more studies found that about 50% or more of the bacteria in soil could produce IAA.

Trichoderma spp is an important multifunctional filamentous fungus, an important biocontrol strain and plant growth promoting strain in agricultural production. The trichoderma metabolites contain various plant growth hormones, such as: cytokinins (CTK), auxins (IAA), gibberellins (GA3), abscisic acid (ABA), etc., which regulate many metabolic processes of plants.

Experiments at home and abroad prove that trichoderma can promote the growth of plants by producing indoleacetic acid (IAA). Indole Acetic Acid (IAA) produced by metabolism of trichoderma virens (t.virens) increased the fresh weight of arabidopsis thaliana by 62%. In addition, auxin 6-PP (6-n-dependent l-6H-pyran-2-one) separated and purified from metabolites of Trichoderma koningii (T.konagii) and Trichoderma harzianum (T.harzianum) can also promote the growth of wheat coleoptile, rape and tomato seedlings.

The biosynthesis of IAA is mainly divided into 4 branches, namely an indole acetaldoxime route, an indole pyruvic acid route, a tryptamine route and an indole acetamide route, through a tryptophan-dependent route according to different intermediates of IAA synthesis. In recent years, many important catalytic enzyme systems and key regulatory genes associated with auxin synthesis have been identified and cloned. Among them, Tryptophan decarboxylase (L-Tryptophan decarboxylase, TDC) is one of the important catalytic enzymes in tryptamine pathway.

Meanwhile, as an important precursor for IAA synthesis, the synthesis and content of tryptophan are also key factors influencing the generation of IAA. The metabolic pathway for tryptophan synthesis via chorismate involves five steps of reactions involving various catalytic enzymes. Wherein, the tryptophan synthase (TRPS) catalyzing the last step of synthesis is a heterotetrameric structure and consists of alpha subunit and beta subunit coded by trpA and trpB genes. In the breeding of tryptophan metabolism engineering, tryptophan synthase is one of the important rate-limiting enzymes affecting tryptophan yield.

By utilizing genome analysis and genetic engineering technology, the regulation and control of the expression of important metabolites in trichoderma is an effective way for improving the stress resistance and growth promoting capability of trichoderma. The trichoderma engineering strain with high IAA production efficiency is constructed and screened, so that an original strain can be provided for research and development of growth-promoting biofertilizer, and the trichoderma engineering strain has important significance for promoting application of trichoderma in agricultural production.

Disclosure of Invention

In order to overcome the technical problems, the invention provides a high-yield IAA Trichoderma viride engineering strain and a construction method and application thereof, coding genes respectively coding tryptophan synthase and tryptophan decarboxylase are identified from Trichoderma viride Tv-1511 genome, and Trichoderma viride engineering bacteria (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) with TvTRPS and/or TvTDC over-expression are successfully constructed.

In order to achieve the technical purpose, the technical scheme adopted by the invention is as follows:

in a first aspect of the present invention, there is provided an enzyme-encoding gene comprising a tryptophan synthase (TvTRPS) -encoding gene and/or a tryptophan decarboxylase (TvTDC) -encoding gene, the gene having the nucleotide sequence set forth in any one of (a1) to (a 3):

(a1) a nucleotide sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2;

(a2) a nucleotide sequence complementary to (a 1);

(a3) a nucleotide sequence which has > 90% (e.g. 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) identity to the nucleotide sequence shown in (a1) or (a2) and encodes the same functional protein.

In a second aspect of the present invention, there is provided an enzyme comprising a tryptophan synthase TvTRPS and/or a trehalose phosphatase TvTDC, the amino acid sequence of which is (b1) or (b 2):

(b1) protein composed of amino acid sequences shown in SEQ ID NO.3 and/or SEQ ID NO. 4;

(b2) and (b1) is a protein which is derived from the protein and has the same biological activity after the substitution and/or deletion and/or addition of one or more amino acid residues.

In the third aspect of the present invention, amplification primers designed based on the above enzyme-encoding gene, recombinant expression vectors containing the above enzyme-encoding gene, and/or engineered bacteria containing the above enzyme-encoding gene are also within the scope of the present invention.

Wherein the amplification primer comprises a sequence shown in SEQ ID NO. 5-8.

The recombinant expression vector is obtained by effectively connecting the gene to an expression vector, wherein the expression vector is any one or more of a viral vector, a plasmid, a phage, a phagemid, a cosmid, an F cosmid, a phage or an artificial chromosome; the viral vector may comprise an adenoviral vector, a retroviral vector, or an adeno-associated viral vector, the artificial chromosomes comprising a Bacterial Artificial Chromosome (BAC), a bacteriophage P1 derived vector (PAC), a Yeast Artificial Chromosome (YAC), or a Mammalian Artificial Chromosome (MAC); further preferred are fungal plasmids; still more preferably pBARGPE1-Hygro plasmid;

the engineering bacteria include but are not limited to bacteria and fungi, and are further selected from Escherichia coli, Bacillus, Saccharomyces cerevisiae, Trichoderma viride and Penicillium oxalate; more preferably, the Trichoderma viride is Trichoderma viride (Trichoderma viride) Tv-1511, which has a preservation number of CGMCC No.16800 in the China general microbiological culture Collection center, a preservation date of 2018, 12 months and 04 days, and a preservation address of the institute of microbiology of China institute of academy of sciences No.3, North Chen West Lu No.1, North Chen Yang district, Beijing City. This strain is disclosed in the issued patent (CN 110218659B).

The invention successfully constructs Trichoderma viride engineering bacteria with over-expressed TvTRPS and/or TvTDC, namely TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE, and tests prove that compared with the original Trichoderma strain, the three Trichoderma viride engineering bacteria have the advantages that the IAA production capacity is obviously enhanced, wherein the IAA production capacity by TvTRPS/TDC-OE is strongest.

In the fourth aspect of the invention, methods for obtaining the enzyme coding gene, the recombinant expression vector and the engineering bacteria are provided.

Wherein, the enzyme coding gene can be obtained by artificial synthesis or amplification by using the genome DNA or cDNA of the Trichoderma viride Tv-1511 as a template and using primers; preferably, the amplification primer comprises a sequence shown in SEQ ID NO. 5-8.

The method for obtaining the recombinant expression vector comprises the steps of connecting the gene or the gene expression cassette thereof into a plasmid; preferably, the amplification primer in the construction of the gene expression cassette comprises a sequence shown in SEQ ID NO.5-8, and the restriction enzyme connecting sites are EcoRI and KpnI; preferably, a pBARGPE1-Hygro linear vector is adopted in the construction of the plasmid, and the TvTPS/TPP gene expression cassette is connected into the pBARGPE1-Hygro linear vector which is subjected to double enzyme digestion by EcoRI and KpnI, so as to obtain the TvTPS/TPP gene expression cassette.

The construction method of the engineering bacteria comprises the steps of transferring the recombinant expression vector into a host cell protoplast; preferably, the host cell protoplast is a trichoderma protoplast, or the transfer method comprises a biologically acceptable direct transformation method (including particle gun method, electric shock method, ultrasonic method, microinjection method, PEG method) or indirect transformation method (including DNA virus vector-mediated method, agrobacterium-mediated method), preferably, PEG-CaCl is used₂A method; preferably, the Trichoderma is Trichoderma viride, and further preferably, the Trichoderma viride is Trichoderma viride (Trichoderma viride) Tv-1511.

In a fifth aspect of the invention, there is provided the use of the above enzyme coding gene, recombinant expression vector and/or engineered bacterium in any one or more of:

c1) the adaptability of the trichoderma to adverse environments is improved;

c2) the growth performance of trichoderma is improved;

c3) the IAA production capacity of trichoderma is improved;

c4) improving the application effect of the trichoderma in agricultural production.

Wherein the trichoderma is preferably trichoderma viride.

The c1) application, adverse environments include but are not limited to salt and alkali and high temperature;

the c4) application is particularly to improve the growth promoting capability of trichoderma to plants, more particularly, the plants comprise but are not limited to wheat, cucumber and peppermint.

The beneficial technical effects of one or more technical schemes are as follows:

the technical scheme identifies a coding gene TvTRPS of tryptophan synthetase and a coding gene TvTDC of key enzyme tryptophan decarboxylase in IAA synthetic pathway in Trichoderma viride Tv-1511. And constructing Trichoderma engineering strains with TvTRPS overexpression, TvTDC overexpression and TvTRPS/TDC co-overexpression by using an expression vector and protoplast fusion method.

According to the technical scheme, researches show that the capability of producing IAA by the trichoderma viride engineering strain is improved by over-expressing TvTRPS and TvTDC genes, the obtained trichoderma viride engineering strain has stronger stress resistance and plant growth promoting capability, and the application of trichoderma viride in agricultural production can be promoted, so that the trichoderma viride engineering strain has good practical application value.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 is a schematic diagram of the amino acid sequence domains of TvTRPS and TvTDC of the present invention, wherein A is TvTRPS and B is TvTDC.

FIG. 2 is a TvTRPS and TvTDC gene overexpression plasmid map of the present invention, wherein A is TvTRPS and B is TvTDC.

FIG. 3 shows the qPCR detection results of TvTRPS and TvTDC genes expressed in original strain and engineering bacteria of Trichoderma viride (Trichoderma viride), wherein A is TvTRPS and B is TvTDC.

FIG. 4 is the detection of tryptophan synthase and tryptophan decarboxylase activity in original Trichoderma viride Tv-1511 strain and its engineered strain, wherein A is tryptophan synthase and B is tryptophan decarboxylase.

FIG. 5 is the detection of IAA content in original strain Tv-1511 of Trichoderma viride (Trichoderma viride) and its engineering strain fermentation broth.

FIG. 6 is the analysis of the salt tolerance of original strain of Trichoderma viride (Trichoderma viride) Tv-1511 and its engineered strain of the present invention; wherein, A is a flat plate, B is a colony growth diameter diagram, and C is a strain biological quantity diagram.

FIG. 7 is the analysis of the high temperature resistance of the original Trichoderma viride Tv-1511 strain and its engineered strain.

FIG. 8 is the analysis of the Trichoderma viride (Trichoderma viride) Tv-1511 original strain and its engineered strain promoting wheat seed germination.

FIG. 9 is the analysis of cucumber growth promoting ability of original strain of Trichoderma viride Tv-1511 and its engineered strain of the present invention.

FIG. 10 is the analysis of the growth promoting ability of the original strain of Trichoderma viride Tv-1511 and its engineered strain to Mentha piperita according to the present invention.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

As mentioned above, the regulation and control of the expression of important metabolites in Trichoderma by genome analysis and genetic engineering techniques is an effective way to improve the stress resistance and growth promoting ability of Trichoderma. The trichoderma engineering strain with high IAA production efficiency is constructed and screened, so that an original strain can be provided for research and development of growth-promoting biofertilizer, and the trichoderma engineering strain has important significance for promoting application of trichoderma in agricultural production.

In view of the above, in one embodiment of the present invention, genes encoding tryptophan synthase and tryptophan decarboxylase, respectively, are identified from the Trichoderma viride Tv-1511 genome. Detailed genetic information of TvTRPS and TvTDC was obtained by whole genome sequencing and fine genome mapping work (GenBank Accession No. VCEC00000000; BioProject: PRJNA 543939; BioSample: SAMN11791795) previously performed on Tv-1511.

The nucleotide sequence of TvTRPS is shown in SEQ ID NO. 1:

SEQ ID NO.1：

ATGGCGATTATCAAGCAGACTTGTCAACGCTGCAAGGCGCAGGGCCGGCCGGCGCTGGTCACGTATGTGACTGCGGGATACCCTCGACCGGAAGACACGCCTGGAATCTTGCTGGCTATGGAGAGGGGAGGAGCCGATGTCCTCGAACTCGGTGCTCCCTTCACGGATCCCATTGCTGACGGACCGACCATTCAAACGGCAAACACGATTGCTCTGCAAAATGGCGTGAGCATCGAGTCGACTCTGGGCATGGTCAAGGAGGCCAGGTCTCGCGGCCTCAAGGCTCCCGTCATGCTCATGGGCTACTACAACCCCCTTCTCAGCTACGGCGAGGAGCGTCTGCTGCAGGACTGCAAGGAATCCGGTGTCAATGGCTTCATTGTCGTCGATTTGCCCCCCGAGGAGGCAGTCTCCTTCCGCAAGCTCTGCACCAAGGGACATCTCTCATATGTCCCCTTGATCGCTCCTGCGACCTCAGATACTCGTATGAAGATTCTTTGCCAGCTGGCGGACTCTTTCATCTACGTTGTCTCAAGACAAGGTGTTACCGGCGCTACCGGATCTCTCAGTTCCCATCTCCCTGAGCTCCTCGGCCGAGTTAAGAAGTACAGCGGCAACAAGCCGGCAGCCGTCGGCTTCGGTGTCAGCACCCACGAGCACTTCCAGAGCGTCGCCGCCATCGCCGACGGTGTTGTTGTCGGCAGTCAGATCATTACCACGATCCAGAAGGCCGCCTCTGGCCAGCACGAAGCCGACGTTGAGAACTACTGCGCCTACCTCTGCGGCCGCGATGCTCGACCTGTTTTCAAGGATGAAGTTGCTCTGGTTCAGGATGCCCCTGGCAATCAGGGCGCCAGCTCAGATTCCGTCTCCGTTAATGCAGTTGTTACTGATGTCCAAATCACGGCAGAGCAAGACAGCGCCTTGGTGGCCCAGTTGGCTGCTCTCCATGGCAAAATTCCTGAGCGATTTGGAGAGTTTGGTGGCCAGTATGTCCCTGAGAGTTTGATGGACTGCTTGTCCGAGCTTGAGGAGGGTTTCAACAAGATCAAGGACGATCCATCGTTCTGGGAGGAGTACCGATCATACTATGACTACATGGGACGACCTTCTCGTCTTCACCTGGCAGACCGTCTTACCGAGCACTGTGGCGGTGCCAACATCTGGCTCAAGCGAGAGGATCTGAACCACACCGGTAGCCACAAGATCAACAACGCCCTCGGACAGCTGCTTCTGGCTAGACGTCTGGGAAAGACCAAGATTATTGCTGAGACTGGAGCCGGCCAGCACGGTGTTGCCACTGCTACCGTGTGTGCCAAATTTGGCATGGAGTGCACAGTTTACATGGGAGCTGAGGATGTTCGTCGACAGGCTCTCAACGTCTTCAGAATGAGACTGCTTGGCGCCAAGGTTGTGGCTGTGGAGGCTGGAAGCAAGACTCTTCGAGATGCCGTCAACGAGGCTCTCCGTGCCTGGGTGACTGATCTCGAGACCACTCACTACATCATCGGATCTGCCATTGGACCTCACCCCTACCCTACCATTGTGAGGACCTTCCAGTCCGTGATCGGTGACGAGACCAAGAAGCAGATGCAGGAGCTGCGAGGCAAGCTCCCCGATGCCGTTGTTGCCTGTGTTGGTGGAGGCAGCAACGCCGTTGGCATGTTCTACCCCTTTGCCAATGATCCCACAGTCAAGCTTCTGGGTGTTGAGGCCGGTGGTGATGGTGTCGACACGGCCAGACATAGCGCCACCCTTACCGGTGGATCAAAGGGCGTTCTTCACGGAGTCCGAACATACGTTCTCCAGGACAAGAACGGCCAGATCATCGAGACGCACTCTGTCTCTGCTGGTCTCGACTACCCCGGTGTCGGTCCTGAGCTGAGCTCCTGGAAGGATGCTGAGCGTGCCAAGTTTATTGCTGCAACTGATGCTGAGGCTCTGATGGGCTTCAAGCTTCTCAGCCAACTGGAGGGTATTATCCCTGCGCTGGAGTCGGCTCACGGAATCTATGGTGCCATTGAGCTGGCCAAGACGATGAAGAAGGACGAGGACCTGGTCATCTGCCTTTCCGGCAGAGGAGACAAGGATGTGCAGAGCGTGGCTGAGGAGTTGCCCCGACTTGGTCCCAAGATTGGCTGGGACCTTCGCTTTTAG

the amino acid sequence of TvTRPS is shown in SEQ ID NO.2, and comprises a tryptophan synthsase alpha chain (trpA) and a tryptophan synthsase beta chain (trpB) structural domain (FIG. 1, A).

SEQ ID NO.2:

MEAIKQTFQRCKAQGRPALVTYVTAGYPRPEDTPGILLAMERGGADVLELGAPFTDPIADGPTIQTANTIALQNGVSIESTLGMVKEARSRGLKAPVMLMGYYNPLLSYGEERLLQDCKESGVNGFIVVDLPPEEAVSFRKLCTKGHLSYVPLIAPATSDTRMKILCQLADSFIYVVSRQGVTGATGSLSSHLPELLGRVKKYSGNKPAAVGFGVSTHEHFQSVAAIADGVVVGSQIITTIQKAASGQHEADVENYCAYLCGRDARPVFKDEVALVQDAPGNQGASSDSVSVNAVVTDVQITAEQDSALVAQLAALHGKIPERFGEFGGQYVPESLMDCLSELEEGFNKIKDDPSFWEEYRSYYDYMGRPSRLHLADRLTEHCGGANIWLKREDLNHTGSHKINNALGQLLLARRLGKTKIIAETGAGQHGVATATVCAKFGMECTVYMGAEDVRRQALNVFRMRLLGAKVVAVEAGSKTLRDAVNEALRAWVTDLETTHYIIGSAIGPHPYPTIVRTFQSVIGDETKKQMQELRGKLPDAVVACVGGGSNAVGMFYPFANDPTVKLLGVEAGGDGVDTARHSATLTGGSKGVLHGVRTYVLQDKNGQIIETHSVSAGLDYPGVGPELSSWKDAERAKFIAATDAEALMGFKLLSQLEGIIPALESAHGIYGAIELAKTMKKDEDLVICLSGRGDKDVQSVAEELPRLGPKIGWDLRF

The nucleotide sequence of TvTDC is shown as SEQ ID NO. 3:

SEQ ID NO.3：

ATGGATACAGAACAGTTTCGGGTGGCGGCCAAGGCGGCCATCGATGAGATTGCCAACTACTATGACAACATCTCTGATCATCGAGTTGTCGCTGATGTTGAGCCCGGCTACCTGAGACCGCTTCTTCCTGCCTCAGCGCCTCTTGATCCCGAGCCATGGGAGTCGATTCAGTCCGATATCCAGTCCAAGATCCTGCCTGGAATCACGCACTGGCAGTCTCCCGGATTCATGGCCTTCTTCCCCTGCTCGAGCAGTTACCCTGCCGCCATTGCTGAGATGTATTCTAATGCCTTCAACGGTGCTCACTTCAACTGGATCTGCTCCCCTGCGGTAACTGAGTTGGAGACGATTGTGATGGATTGGTTGGCCCAGGCTTTGGGACTGCCTGAATGCTTCCTGAGTGGCGGACCGACTCACGGCGGTGGCGTGCTTCACGGAAGCGCGAGCGAGGCTATTCTGACGGTCATGGTTGCCGCTAGGGACAAGTACCTGAACGAGGCAACGGCTCATCTGCCTGAGGGTGAGGAGAAGGAGGAGGAAACCTGGAGACTCCGCAGCAAGCTGGTTGCTCTGGGAAGTGCAGGTGCACACTCGAGCACCAAGAAGGCCGCACAAGTCTTGGGAGTGCGCTTCGCCACGGTGCCGGTGTCAGAAGAGAATGGCTTTTCCATGACGGGTGAAGCTCTGACAAAGACGCTCGATGAGCTCAAGGCAAAGGGCCTCGAGCCGTTCTACTTGACAGCCACGCTAGGAACGACAGACGTCTGCGCTGTCGACGACTTTCCCAGCATCGCCGAGGCCCTGGCTCCGAGAGCCGGAAAGCCTGGCGAGGTCTGGGTCCACGTCGATGCAGCCTATGCCGGTGCCGCGCTGCTCCTCGACGAGAACAAGCCCCTGGCGAAGCCCATGGCTGATTTCCACTCCTTCAACTACAACCCCCACAAGTGGATGCTCACGACGTTTGATTGCTCCGCGGTCTGGGTTCGCGCTCGTGGCCATCTCATCAATGCGCTTAGCATCAAGCCCCCCTACCTGCGGAACCAGTACAGCGACAACGAACTTGTCACCGATTACCGCGACTGGCAGATCCCCCTGGGCCGACGATTCCGCTCCTTGAAGCTGTGGTTCGTCCTCCGCAGCTACGGCATCCGCGGCCTGCAAGCGCACATTCAGAACGGCGTCACGCAGGGCGAGTCTCTGGAGGCTAAGTTCGTGACACGGCCTGACCTGTTCACCATCTTCACTAAGGCGCGGTTTGGCCTGGTGTCGTTCCGGGCCAAGGGCGATGGCGAGGACCAGATCAACAGCCGGACGGAGAAGCTGTATGAGGCGATCAATGCGAGCGGCCAGTTTTACTTGACGAGCACGGTGGTGAATGGTCACTTTGCGATTAGAGTGTGTACGGGAGTGGCGGCGATCAGGGAGGAGCATGTGCAGAAGCTGTTTGACTTGTTGGTTGAGACGATTGAGGCGCAGTTGAAGCTGGAGTAG

the amino acid sequence of TvTDC is shown in SEQ ID NO.4, and comprises a pyridoxal-dependent decarbonylase domain (FIG. 1, B).

SEQ ID NO.4：

MDTEQFRVAAKAAIDEIANYYDNISDHRVVADVEPGYLRPLLPASAPLDPEPWESIQSDIQSKILPGITHWQSPGFMAFFPCSSSYPAAIAEMYSNAFNGAHFNWICSPAVTELETIVMDWLAQALGLPECFLSGGPTHGGGVLHGSASEAILTVMVAARDKYLNEATAHLPEGEEKEEETWRLRSKLVALGSAGAHSSTKKAAQVLGVRFATVPVSEENGFSMTGEALTKTLDELKAKGLEPFYLTATLGTTDVCAVDDFPSIAEALAPRAGKPGEVWVHVDAAYAGAALLLDENKPLAKPMADFHSFNYNPHKWMLTTFDCSAVWVRARGHLINALSIKPPYLRNQYSDNELVTDYRDWQIPLGRRFRSLKLWFVLRSYGIRGLQAHIQNGVTQGESLEAKFVTRPDLFTIFTKARFGLVSFRAKGDGEDQINSRTEKLYEAINASGQFYLTSTVVNGHFAIRVCTGVAAIREEHVQKLFDLLVETIEAQLKLE

In a specific embodiment, the invention relates to a method for constructing a trichoderma viride engineering strain for over-expressing a TvTRPS gene or a TvTDC gene, comprising the following steps: extracting genome DNA from Trichoderma viride Tv-1511 as a template, cloning to obtain TvTRPS or TvTDC gene expression cassettes with restriction enzyme connecting sites (EcoRI and KpnI) respectively by using primer sequences shown in SEQ ID NO.5 (TvTRPS-FL-EcoRI-Forward: CGGAATTCATGGCGATTATCAAGCAGA) and SEQ ID NO.6 (TvTRPS-FL-KpnI-Reverse: GGGGTACCCTAAAAGCGAAGGTCCCAGC) and SEQ ID NO.7 (TvTDC-FL-EcoRI-Forward: CGGAATTCATGGATACAGAACAGTTTCG) and SEQ ID NO.8 (TvTDC-FL-KpnI-Reverse: GGGGTACCCTACTCCAGCTTCAACTG), respectively, ligating to pBARGPE1-Hygro linear vectors with double restriction enzymes (EcoRI and KpnI), constructing pBARGPE 1-Hygro-TvS expression vectors containing Tryptophan synthase encoding gene TvTRPS, and pBARGPE 1-Hygro-HygrTDC expression vectors containing Tryptophan decarboxylase encoding gene TvTRPS. Using PEG-CaCl₂The mediated method comprises the step of transferring fungus expression vectors of pBARGPE1-Hygro-TvTRPS or pBARGPE1-Hygro-TvTDC into trichoderma viride protoplasts to obtain trichoderma viride engineering strains for over-expressing TvTRPS genes or TvTDC genes. The Trichoderma viride engineering strain for over-expressing the TvTRPS gene (TvTRPS-OE) or the TvTDC gene (TvTDC-OE) obtained by the construction method has the advantage that the transcriptional expression of the TvTRPS gene or the TvTDC gene is obviously improved.

The invention relates to a construction method for obtaining a trichoderma viride engineering strain capable of simultaneously over-expressing a TvTRPS gene and a TvTDC gene by using a protoplast fusion technology, which comprises the following steps: respectively preparing protoplasts of TvTRPS-OE and TvTDC-OE Trichoderma viride engineering strains, carrying out protoplast inactivation on the TvTRPS-OE and the TvTDC-OE by adopting a heat inactivation method and an ultraviolet irradiation method, mixing and melting the inactivation solution in equal volume to obtain Trichoderma fusant, and obtaining the Trichoderma viride engineering strains (TvTRPS/TDC-OE) which simultaneously over-express the TvTRPS genes and the TvTDC genes, wherein the transcriptional expression of the TvTRPS genes and the TvTDC genes is obviously improved.

The capability of producing IAA by the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) is obviously improved compared with that of wild strains, wherein the IAA yield of the TvTRPS/TDC-OE strain is the highest.

The application and effect of the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) in salt stress tolerance of trichoderma show that the over-expressed trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) constructed by the invention can obviously improve the growth capacity of original trichoderma strains under salt stress, wherein the TvTRPS/TDC-OE strain has the strongest stress resistance.

The application and effect of the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) in high temperature stress tolerance of trichoderma show that the over-expressed trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) constructed by the invention can obviously improve the growth capacity of original trichoderma strains under high temperature stress, wherein the TvTRPS/TDC-OE strain has the strongest stress resistance.

The application and effect of the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) in promoting plant growth show that the over-expression trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) constructed by the invention can obviously improve the growth of wheat, cucumber and peppermint.

In order to make the technical solutions of the present disclosure more clearly understood by those skilled in the art, the technical solutions of the present disclosure will be described in detail below with reference to specific embodiments.

The source of the biological material is as follows:

trichoderma viride Tv-1511 is a Trichoderma viride strain screened and identified in the laboratory, which has good growth promoting and disease resisting capability and the preservation number in China general microbiological culture Collection center is CGMCC No. 16800; this strain is disclosed in the issued patent (CN 110218659B).

Escherichia coli DH5 alpha, T4 ligase kit, high fidelity Taq enzyme and the like were purchased from Nanjing Novowed company;

overexpression vector construction plasmid pBARGPE1-Hygro was purchased from Addgene;

restriction enzymes KpnI and EcoRI were purchased from NEB;

ampicillin, hygromycin B and lysozyme were purchased from Sigma;

LB medium, PDA medium, PDB medium and the like were purchased from haibo, Qingdao.

Example 1: cloning of Trichoderma viride TvTRPS and TvTDC gene sequences and construction of expression vector

(1) Cloning of TvTRPS and TvTDC Gene expression cassettes

Trichoderma viride Tv-1511 genomic DNA was extracted with reference to the fungal genome extraction Kit (E.Z.N.AFungal DNA Kit, OMEGA, USA).

And (2) amplifying the complete sequence of the TvTRPS gene expression cassette by taking the genome DNA as a template, wherein the amplification primers are respectively as follows: TvTRPS-FL-EcoRI-Forward: CGGAATTCATGGCGATTATCAAGCAGA (SEQ ID NO.5) and TvTRPS-FL-KpnI-Reverse: GGGGTACCCTAAAAGCGAAGGTCCCAGC (SEQ ID NO. 6).

And (2) amplifying the complete sequence of the TvTDC gene expression cassette by taking the genome DNA as a template, wherein the amplification primers are respectively as follows: TvTDC-FL-EcoRI-Forward: CGGAATTCATGGATACAGAACAGTTTCG (SEQ ID NO.7) and TvTDC-FL-KpnI-Reverse: GGGGTACCCTACTCCAGCTTCAACTG (SEQ ID NO. 8).

Performing PCR amplification by using a high-fidelity PCR polymerase premix (2 x Phanta Master Mix, Nanjing Novozam) to obtain TvTRPS and TvTDC gene expression cassettes with restriction enzyme ligation sites (EcoRI and KpnI); carrying out 1% agarose Gel electrophoresis on the PCR product, and recovering the amplified DNA fragment by utilizing a DNA recovery Kit (FastPure Gel DNA Extraction Mini Kit, Nanjing Novozam); connecting the DNA fragment with a T vector, sequencing and verifying the correctness of the sequence to obtain the complete sequence of the TvTRPS and TvTDC gene expression cassette.

(2) Double digestion of DNA fragment and expression vector

Carrying out double enzyme digestion on the TvTRPS and TvTDC gene expression cassette and the vector pBARGPE1 obtained by recovery by using restriction enzymes KpnI and EcoRI (NEB company); the enzyme-cleaved product was subjected to 1% agarose Gel electrophoresis, the objective band was cut into Gel, and the digested DNA fragment and linearized pBARGPE1 plasmid were recovered using a DNA recovery Kit (FastPure Gel DNA Extraction Mini Kit, Nanjing Novozam).

(3) Construction and transformation of overexpression vectors

The connection of the DNA fragment and the expression vector is carried out by adopting T4 ligase (Nanjing Novozam), the TvTRPS or TvTDC gene expression cassette is respectively connected with a pBARGPE1 linearization vector, and the reaction system is 10 mu L.

Taking 50 mu L DH5 alpha competent cells, evenly mixing with 10 mu L of the connecting system, incubating, transforming the plasmid, and coating the transformed plasmid on an LB plate containing 100 mu g/mL ampicillin; after culturing at 37 ℃ for 12-20h, colonies were picked up on LB liquid medium containing 100. mu.g/mL ampicillin, cultured at 37 ℃ for 12-20h at 200rpm, and then subjected to colony PCR validation.

The sequencing verified expression vectors pBARGPE1-Hygro-TvTRPS (FIG. 2, A) and pBARGPE1-Hygro-TvTDC (FIG. 2, B) were extracted with endotoxin-free Plasmid macroextraction Kit (FastPure Endofree Plasmid Maxi Kit).

Example 2: protoplasm preparation and construction of over-expression engineering strain

(1) Protoplast preparation

Inoculating Trichoderma viride Tv-1511 to a PDA plate, and culturing at 28 ℃ for 10 days to generate a large amount of fresh conidia; washing the surface of the mycelium with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), filtering with cellophane, and removing the mycelium to obtain spore suspension;

coating 200 mu L of spore suspension on a PDA (personal digital Assistant) plate covered by cellophane, and culturing at 28 ℃ in a dark place for 24h to ensure that spores on the PDA plate germinate;

preparing a lytic enzyme solution: 0.15g of lytic enzyme (Lysing enzyme, Sigma: L1412) was dissolved in 20mL of solution I (1.2M D-sorbitol,0.1M KH)₂PO₄pH 5.6), 0.2 μ M filter membrane filtration sterilization;

taking out the PDA flat plate, taking out the fiber membrane with the hyphae, reversely sticking the fiber membrane on the flat plate containing 3-4 mL of lysate, and treating for 100min at 28 ℃ and 100 rpm;

taking out the fiber membrane in the flat plate under an aseptic ultra-clean bench to ensure that most of mycelia are kept in the flat plate, flushing residual mycelium blocks on the fiber membrane with a solution I in the process, and repeatedly blowing and sucking the mycelium blocks in the liquid for more than 200 times by using a gun head to fully release internal protoplasts;

filtering the mixture with a 1.5mL tube containing 4 layers of gauze, retaining the lower filtrate and centrifuging at 4 deg.C, centrifuging at 2000rpm for 10min, discarding the supernatant, and retaining the bottom protoplast

Adding 1mL of solution I, centrifuging again, and removing the supernatant;

1mL of 4 ℃ Pre-cooled solution II (1M sorbitol,50mM CaCl) was added₂10mM Tris-HCl, pH 7.5), obtaining protoplasts on ice; observing and counting with a blood counting chamber, diluting the protoplast to 10⁷one/mL.

(2) Protoplast transformation and mutant screening

Place 15mL centrifuge tube on ice, add 200. mu.L protoplast suspension, 10. mu.L plasmid vector, 50. mu.L PEG solution (25% PEG600,50mM CaCl)₂10mM Tris-HCl, pH 7.5); mixing with a gun head, and standing on ice for 20 min;

adding 2mL of PEG solution, gently mixing, and standing at room temperature for 5 min; adding 2mL of solution II, and gently mixing;

adding 2mL of mixed solution, and coating the mixed solution on a PDA (personal digital assistant) plate which covers chromatographic paper and contains 1M sucrose, wherein the chromatographic paper is cut into strips in advance; culturing at 28 deg.C in dark for 24 h;

transferring the strip-shaped chromatographic paper onto a PDA plate containing antibiotics, culturing for 36h at 28 ℃ in a dark place, picking colonies after the colonies grow out from the edge of the strip-shaped chromatographic paper, transferring the colonies onto a fresh antibiotic plate, and culturing for 2 days.

After transformation, a Tv-1511 transformant strain 17 expressing pBARGPE1-Hygro-TvTRPS and a Tv-1511 transformant strain 13 expressing pBARGPE1-Hygro-TvTDC are obtained.

Detecting the transcription expression of TvTRPS and TvTDC by adopting a fluorescent quantitative PCR method, wherein amplification primers are respectively as follows: TvTRPS-qPCR-sense: GTCGGCAGTCAGATCATTA (SEQ ID NO.9) and TvtTRPS-qPCR-antisense: CCAGAGCAACTTCATCCTT (SEQ ID NO. 10); TvTDC-qPCR-sense: TACAGCGACAACGAACTT (SEQ ID NO.11) and TvTDC-qPCR-antisense: GAACTTAGCCTCCAGAGAC (SEQ ID NO. 12). The results show that compared with the original strain, the transcriptional expression of the TvTRPS gene or the TvTDC gene of the obtained Trichoderma viride engineering strain over-expressing the TvTRPS gene (TvTRPS-OE) or the TvTDC gene (TvTDC-OE) is obviously improved (figure 3).

The activity of tryptophan synthase and tryptophan decarboxylase in the original strain and the engineering strain is detected by liquid chromatography, and the result shows that compared with the original strain, the activity of tryptophan synthase in the trichoderma viride engineering strain (TvTRPS-OE) for over-expressing the TvTRPS gene is obviously improved, and the activity of tryptophan decarboxylase in the trichoderma viride engineering strain (TvTDC-OE) for over-expressing the TvTDC gene is obviously improved (figure 4).

Example 3: trichoderma viride engineering strain for simultaneously over-expressing TvTRPS gene and TvTDC gene by using protoplast fusion technology

Protoplasts of the TvTRPS-OE and TvTDC-OE strains were prepared separately as described in example 2 above. Subsequently, the two protoplasts were subjected to heat inactivation and uv inactivation, respectively.

The inactivation rate of the protoplast is prolonged and increased along with the treatment time, wherein the inactivation rate of the TvTRPS-OE protoplast is 100% after heat treatment at 55 ℃ for 25min, and the inactivation rate of the TvTDC-OE protoplast is 100% after ultraviolet treatment for 20 min.

Mixing the two inactivation solutions in equal volume, and adding PTC solution (PTC: 60% PEG4000, 10mM Tris-HCl, 10mM CaCl)₂pH 7.5), maintaining the temperature in a water bath at 35 ℃ for 5min, centrifuging, diluting in a gradient manner, mixing into a regeneration medium, culturing at the constant temperature of 28 ℃ for 3 days, transferring a single colony growing on the plate to a PDA plate, and storing.

According to Wright's injury complementation principle, only protoplasts with parental fusions can grow, so that theoretically all protoplasts grow on regeneration medium as parental fusions. 7 fusants were obtained by this method, and all the fusants were determined to be trichoderma viride engineered strains (TvTRPS/TDC-OE) overexpressing both TvTRPS gene and TvTDC gene by the fluorescent quantitative PCR method (fig. 3). Compared with the wild type, the TvTRPS/TDC-OE strain has obviously improved tryptophan synthetase activity and tryptophan decarboxylase (figure 4).

Example 4: detection of original trichoderma viride strain and IAA production capacity of engineering strain

We examined the production of auxin IAA by fermentation of Trichoderma strains. Respectively inoculating 200 mu L of spores of original trichoderma strains (Wildtype) and engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) into a PDB liquid culture medium, culturing at 28 ℃ and 180rpm for 72h, filtering mycelia through 2 layers of sterile gauze, recovering liquid fermentation liquor, centrifuging the recovered liquid fermentation liquor at 10,000rpm, taking supernatant, and detecting the IAA content in the fermentation liquor by using GC-MS.

The results show that the IAA content produced by the engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) is obviously improved compared with the original strain (Wildtype), wherein the amount of IAA produced by the TvTRPS/TDC-OE strain is the highest (figure 5).

Example 5: analysis of stress tolerance of original strain and engineering strain of trichoderma viride

(1) Collection of sterile spores

Inoculating original strains and engineering strains of trichoderma viride to a PDA (personal digital Assistant) plate, and culturing at 28 ℃ for 10 days to generate a large amount of fresh conidia; washing the surface of the mycelium with 10mL of normal saline (0.9% NaCl, 0.05% Tween), filtering with cellophane, and removing the mycelium to obtain spore suspension; suspending with 30% glycerol, mixing, packaging into 1.5mL centrifuge tube, labeling name and time, and freezing at-80 deg.C; taking a tube of spore liquid for viable bacteria counting, and determining the concentration of the spore liquid.

(2) Experiment of salt tolerance of flat plate

Firstly activating original strains (Wildtype) and engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) of trichoderma on a PDA plate, culturing for 48-72 h at 28 ℃ in a dark place to ensure that the original strains and the mutant engineering strains grow uniformly, preparing bacterial blocks with uniform size by using a puncher, and transferring the bacterial blocks to the center of the PDA plate containing 300mM NaCl. The plate with the attached pellet was incubated at 28 ℃ for 72 hours, and then the colony growth diameter was measured.

As a result, the diameter of the engineered strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) is remarkably increased on average compared with the original strain (Wildtype) under the stress of 300mM NaCl, wherein the diameter of the TvTRPS/TDC-OE strain is the largest (FIG. 6, A, B).

(3) Liquid shake flask salt tolerance experiment

200 mu L of spores of original trichoderma strains (Wildtype) and engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) are respectively inoculated in a PDB liquid culture medium, cultured for 48h at 28 ℃ and 180rpm, and filtered by 2 layers of sterile gauze to obtain sterile mycelia. Equal amount of mycelia were inoculated into PDB liquid medium containing 200mM NaCl, respectively, cultured at 28 ℃ and 180rpm for 72 hours, the mycelia were collected, and biomass of the mycelia was measured after drying.

As a result, the biomass of the engineered strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) was significantly increased under 300mM NaCl stress compared to the original strain (Wildtype), wherein the biomass of the TvTRPS/TDC-OE strain was the largest (FIG. 6, C).

(4) Liquid shake flask heat resistance experiment

200 mu L of spores of original trichoderma strains (Wildtype) and engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) are respectively inoculated in a PDB liquid culture medium, cultured for 48h at 28 ℃ and 180rpm, and filtered by 2 layers of sterile gauze to obtain sterile mycelia. Respectively inoculating equal amount of mycelia into new PDB liquid culture medium, culturing at 35 deg.C and 180rpm for 48 hr, collecting mycelia, oven drying, and determining thallus biomass.

As a result, it was found that the biomass of the engineered strains (TvTRPS-OE, TvTDC-OE, and TvTRPS/TDC-OE) was significantly increased in the culture environment at 35 ℃ as compared to the original strain (Wildtype), wherein the biomass of the TvTRPS/TDC-OE strain was the largest (FIG. 7).

Example 6: analysis of growth promoting capability of original strain and engineering strain of trichoderma viride on plant

The test plants are wheat, cucumber and peppermint.

Wheat growth promotion experiment:

taking full wheat seeds with consistent size, cleaning, sucking dry water, immersing the wheat seeds into fermentation liquor of original trichoderma strains (Wildtype) or engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) for 24 hours, then placing the wheat seeds on wet filter paper, and observing seed germination and seedling growth. Each process set 3 replicates.

The result shows that the growth promoting effect of the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) on wheat seed germination and seedling growth is obviously stronger than that of the original strain (Wildtype). Wherein the growth promotion effect of wheat treated by the TvTRPS/TDC-OE fermentation broth is most obvious (figure 8).

Cucumber growth promotion experiment:

and selecting the cucumber seeds which are plump and consistent, culturing the cucumber seeds for a certain time in a laboratory, selecting the seedlings with consistent growth vigor, transferring the seedlings to a water culture device, and treating the seedlings. Adding spore liquid (final concentration of 10) of original strain (Wildtype) or mutant engineering strain (delta TvGCN5 and TvGCN5-OE) of Trichoderma⁵) Each treatment was set to 3 replicates for different treatment groups.

The result shows that the growth promoting effect of the trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) on cucumber is obviously stronger than that of the original strain (Wildtype), wherein the growth promoting effect of cucumber treated by TvTRPS/TDC-OE is most obvious (figure 9).

Peppermint growth promotion experiment:

and (3) taking peppermint seedlings which are cut and cultivated in a laboratory for a period of time and have consistent sizes, moving the peppermint seedlings to a water culture device, and treating the peppermint seedlings. Adding spore liquid (with final concentration of 10) of original strain (Wildtype) or engineering strain (TvtTRPS-OE, TvtDC-OE and TvtTRPS/TDC-OE) of Trichoderma⁵) Each treatment was set to 3 replicates for different treatment groups.

As a result, the growth promoting effect of the Trichoderma engineering strains (TvTRPS-OE, TvTDC-OE and TvTRPS/TDC-OE) on the peppermint is obviously stronger than that of the original strain (Wildtype), wherein the growth promoting effect of the TvTRPS/TDC-OE treatment on cucumber is the most obvious (figure 10).

It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and the present invention is not limited thereto, and although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications and equivalents can be made in the technical solutions described in the foregoing embodiments, or equivalents thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Although the present invention has been described with reference to the specific embodiments, it should be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

SEQUENCE LISTING

<110> institute of biological research of academy of sciences of Shandong province

<120> high-yield IAA trichoderma viride engineering strain and construction method and application thereof

<130>

<160> 12

<170> PatentIn version 3.3

<210> 1

<211> 2157

<212> DNA

<213> TvTRPS coding Gene

<400> 1

atggcgatta tcaagcagac ttgtcaacgc tgcaaggcgc agggccggcc ggcgctggtc 60

acgtatgtga ctgcgggata ccctcgaccg gaagacacgc ctggaatctt gctggctatg 120

gagaggggag gagccgatgt cctcgaactc ggtgctccct tcacggatcc cattgctgac 180

ggaccgacca ttcaaacggc aaacacgatt gctctgcaaa atggcgtgag catcgagtcg 240

actctgggca tggtcaagga ggccaggtct cgcggcctca aggctcccgt catgctcatg 300

ggctactaca acccccttct cagctacggc gaggagcgtc tgctgcagga ctgcaaggaa 360

tccggtgtca atggcttcat tgtcgtcgat ttgccccccg aggaggcagt ctccttccgc 420

aagctctgca ccaagggaca tctctcatat gtccccttga tcgctcctgc gacctcagat 480

actcgtatga agattctttg ccagctggcg gactctttca tctacgttgt ctcaagacaa 540

ggtgttaccg gcgctaccgg atctctcagt tcccatctcc ctgagctcct cggccgagtt 600

aagaagtaca gcggcaacaa gccggcagcc gtcggcttcg gtgtcagcac ccacgagcac 660

ttccagagcg tcgccgccat cgccgacggt gttgttgtcg gcagtcagat cattaccacg 720

atccagaagg ccgcctctgg ccagcacgaa gccgacgttg agaactactg cgcctacctc 780

tgcggccgcg atgctcgacc tgttttcaag gatgaagttg ctctggttca ggatgcccct 840

ggcaatcagg gcgccagctc agattccgtc tccgttaatg cagttgttac tgatgtccaa 900

atcacggcag agcaagacag cgccttggtg gcccagttgg ctgctctcca tggcaaaatt 960

cctgagcgat ttggagagtt tggtggccag tatgtccctg agagtttgat ggactgcttg 1020

tccgagcttg aggagggttt caacaagatc aaggacgatc catcgttctg ggaggagtac 1080

cgatcatact atgactacat gggacgacct tctcgtcttc acctggcaga ccgtcttacc 1140

gagcactgtg gcggtgccaa catctggctc aagcgagagg atctgaacca caccggtagc 1200

cacaagatca acaacgccct cggacagctg cttctggcta gacgtctggg aaagaccaag 1260

attattgctg agactggagc cggccagcac ggtgttgcca ctgctaccgt gtgtgccaaa 1320

tttggcatgg agtgcacagt ttacatggga gctgaggatg ttcgtcgaca ggctctcaac 1380

gtcttcagaa tgagactgct tggcgccaag gttgtggctg tggaggctgg aagcaagact 1440

cttcgagatg ccgtcaacga ggctctccgt gcctgggtga ctgatctcga gaccactcac 1500

tacatcatcg gatctgccat tggacctcac ccctacccta ccattgtgag gaccttccag 1560

tccgtgatcg gtgacgagac caagaagcag atgcaggagc tgcgaggcaa gctccccgat 1620

gccgttgttg cctgtgttgg tggaggcagc aacgccgttg gcatgttcta cccctttgcc 1680

aatgatccca cagtcaagct tctgggtgtt gaggccggtg gtgatggtgt cgacacggcc 1740

agacatagcg ccacccttac cggtggatca aagggcgttc ttcacggagt ccgaacatac 1800

gttctccagg acaagaacgg ccagatcatc gagacgcact ctgtctctgc tggtctcgac 1860

taccccggtg tcggtcctga gctgagctcc tggaaggatg ctgagcgtgc caagtttatt 1920

gctgcaactg atgctgaggc tctgatgggc ttcaagcttc tcagccaact ggagggtatt 1980

atccctgcgc tggagtcggc tcacggaatc tatggtgcca ttgagctggc caagacgatg 2040

aagaaggacg aggacctggt catctgcctt tccggcagag gagacaagga tgtgcagagc 2100

gtggctgagg agttgccccg acttggtccc aagattggct gggaccttcg cttttag 2157

<210> 2

<211> 718

<212> PRT

<213> TvTRPS protein

<400> 2

Met Glu Ala Ile Lys Gln Thr Phe Gln Arg Cys Lys Ala Gln Gly Arg

1 5 10 15

Pro Ala Leu Val Thr Tyr Val Thr Ala Gly Tyr Pro Arg Pro Glu Asp

20 25 30

Thr Pro Gly Ile Leu Leu Ala Met Glu Arg Gly Gly Ala Asp Val Leu

35 40 45

Glu Leu Gly Ala Pro Phe Thr Asp Pro Ile Ala Asp Gly Pro Thr Ile

50 55 60

Gln Thr Ala Asn Thr Ile Ala Leu Gln Asn Gly Val Ser Ile Glu Ser

65 70 75 80

Thr Leu Gly Met Val Lys Glu Ala Arg Ser Arg Gly Leu Lys Ala Pro

85 90 95

Val Met Leu Met Gly Tyr Tyr Asn Pro Leu Leu Ser Tyr Gly Glu Glu

100 105 110

Arg Leu Leu Gln Asp Cys Lys Glu Ser Gly Val Asn Gly Phe Ile Val

115 120 125

Val Asp Leu Pro Pro Glu Glu Ala Val Ser Phe Arg Lys Leu Cys Thr

130 135 140

Lys Gly His Leu Ser Tyr Val Pro Leu Ile Ala Pro Ala Thr Ser Asp

145 150 155 160

Thr Arg Met Lys Ile Leu Cys Gln Leu Ala Asp Ser Phe Ile Tyr Val

165 170 175

Val Ser Arg Gln Gly Val Thr Gly Ala Thr Gly Ser Leu Ser Ser His

180 185 190

Leu Pro Glu Leu Leu Gly Arg Val Lys Lys Tyr Ser Gly Asn Lys Pro

195 200 205

Ala Ala Val Gly Phe Gly Val Ser Thr His Glu His Phe Gln Ser Val

210 215 220

Ala Ala Ile Ala Asp Gly Val Val Val Gly Ser Gln Ile Ile Thr Thr

225 230 235 240

Ile Gln Lys Ala Ala Ser Gly Gln His Glu Ala Asp Val Glu Asn Tyr

245 250 255

Cys Ala Tyr Leu Cys Gly Arg Asp Ala Arg Pro Val Phe Lys Asp Glu

260 265 270

Val Ala Leu Val Gln Asp Ala Pro Gly Asn Gln Gly Ala Ser Ser Asp

275 280 285

Ser Val Ser Val Asn Ala Val Val Thr Asp Val Gln Ile Thr Ala Glu

290 295 300

Gln Asp Ser Ala Leu Val Ala Gln Leu Ala Ala Leu His Gly Lys Ile

305 310 315 320

Pro Glu Arg Phe Gly Glu Phe Gly Gly Gln Tyr Val Pro Glu Ser Leu

325 330 335

Met Asp Cys Leu Ser Glu Leu Glu Glu Gly Phe Asn Lys Ile Lys Asp

340 345 350

Asp Pro Ser Phe Trp Glu Glu Tyr Arg Ser Tyr Tyr Asp Tyr Met Gly

355 360 365

Arg Pro Ser Arg Leu His Leu Ala Asp Arg Leu Thr Glu His Cys Gly

370 375 380

Gly Ala Asn Ile Trp Leu Lys Arg Glu Asp Leu Asn His Thr Gly Ser

385 390 395 400

His Lys Ile Asn Asn Ala Leu Gly Gln Leu Leu Leu Ala Arg Arg Leu

405 410 415

Gly Lys Thr Lys Ile Ile Ala Glu Thr Gly Ala Gly Gln His Gly Val

420 425 430

Ala Thr Ala Thr Val Cys Ala Lys Phe Gly Met Glu Cys Thr Val Tyr

435 440 445

Met Gly Ala Glu Asp Val Arg Arg Gln Ala Leu Asn Val Phe Arg Met

450 455 460

Arg Leu Leu Gly Ala Lys Val Val Ala Val Glu Ala Gly Ser Lys Thr

465 470 475 480

Leu Arg Asp Ala Val Asn Glu Ala Leu Arg Ala Trp Val Thr Asp Leu

485 490 495

Glu Thr Thr His Tyr Ile Ile Gly Ser Ala Ile Gly Pro His Pro Tyr

500 505 510

Pro Thr Ile Val Arg Thr Phe Gln Ser Val Ile Gly Asp Glu Thr Lys

515 520 525

Lys Gln Met Gln Glu Leu Arg Gly Lys Leu Pro Asp Ala Val Val Ala

530 535 540

Cys Val Gly Gly Gly Ser Asn Ala Val Gly Met Phe Tyr Pro Phe Ala

545 550 555 560

Asn Asp Pro Thr Val Lys Leu Leu Gly Val Glu Ala Gly Gly Asp Gly

565 570 575

Val Asp Thr Ala Arg His Ser Ala Thr Leu Thr Gly Gly Ser Lys Gly

580 585 590

Val Leu His Gly Val Arg Thr Tyr Val Leu Gln Asp Lys Asn Gly Gln

595 600 605

Ile Ile Glu Thr His Ser Val Ser Ala Gly Leu Asp Tyr Pro Gly Val

610 615 620

Gly Pro Glu Leu Ser Ser Trp Lys Asp Ala Glu Arg Ala Lys Phe Ile

625 630 635 640

Ala Ala Thr Asp Ala Glu Ala Leu Met Gly Phe Lys Leu Leu Ser Gln

645 650 655

Leu Glu Gly Ile Ile Pro Ala Leu Glu Ser Ala His Gly Ile Tyr Gly

660 665 670

Ala Ile Glu Leu Ala Lys Thr Met Lys Lys Asp Glu Asp Leu Val Ile

675 680 685

Cys Leu Ser Gly Arg Gly Asp Lys Asp Val Gln Ser Val Ala Glu Glu

690 695 700

Leu Pro Arg Leu Gly Pro Lys Ile Gly Trp Asp Leu Arg Phe

705 710 715

<210> 3

<211> 1491

<212> DNA

<213> TvTDC Gene

<400> 3

atggatacag aacagtttcg ggtggcggcc aaggcggcca tcgatgagat tgccaactac 60

tatgacaaca tctctgatca tcgagttgtc gctgatgttg agcccggcta cctgagaccg 120

cttcttcctg cctcagcgcc tcttgatccc gagccatggg agtcgattca gtccgatatc 180

cagtccaaga tcctgcctgg aatcacgcac tggcagtctc ccggattcat ggccttcttc 240

ccctgctcga gcagttaccc tgccgccatt gctgagatgt attctaatgc cttcaacggt 300

gctcacttca actggatctg ctcccctgcg gtaactgagt tggagacgat tgtgatggat 360

tggttggccc aggctttggg actgcctgaa tgcttcctga gtggcggacc gactcacggc 420

ggtggcgtgc ttcacggaag cgcgagcgag gctattctga cggtcatggt tgccgctagg 480

gacaagtacc tgaacgaggc aacggctcat ctgcctgagg gtgaggagaa ggaggaggaa 540

acctggagac tccgcagcaa gctggttgct ctgggaagtg caggtgcaca ctcgagcacc 600

aagaaggccg cacaagtctt gggagtgcgc ttcgccacgg tgccggtgtc agaagagaat 660

ggcttttcca tgacgggtga agctctgaca aagacgctcg atgagctcaa ggcaaagggc 720

ctcgagccgt tctacttgac agccacgcta ggaacgacag acgtctgcgc tgtcgacgac 780

tttcccagca tcgccgaggc cctggctccg agagccggaa agcctggcga ggtctgggtc 840

cacgtcgatg cagcctatgc cggtgccgcg ctgctcctcg acgagaacaa gcccctggcg 900

aagcccatgg ctgatttcca ctccttcaac tacaaccccc acaagtggat gctcacgacg 960

tttgattgct ccgcggtctg ggttcgcgct cgtggccatc tcatcaatgc gcttagcatc 1020

aagcccccct acctgcggaa ccagtacagc gacaacgaac ttgtcaccga ttaccgcgac 1080

tggcagatcc ccctgggccg acgattccgc tccttgaagc tgtggttcgt cctccgcagc 1140

tacggcatcc gcggcctgca agcgcacatt cagaacggcg tcacgcaggg cgagtctctg 1200

gaggctaagt tcgtgacacg gcctgacctg ttcaccatct tcactaaggc gcggtttggc 1260

ctggtgtcgt tccgggccaa gggcgatggc gaggaccaga tcaacagccg gacggagaag 1320

ctgtatgagg cgatcaatgc gagcggccag ttttacttga cgagcacggt ggtgaatggt 1380

cactttgcga ttagagtgtg tacgggagtg gcggcgatca gggaggagca tgtgcagaag 1440

ctgtttgact tgttggttga gacgattgag gcgcagttga agctggagta g 1491

<210> 4

<211> 496

<212> PRT

<213> TvTDC protein

<400> 4

Met Asp Thr Glu Gln Phe Arg Val Ala Ala Lys Ala Ala Ile Asp Glu

1 5 10 15

Ile Ala Asn Tyr Tyr Asp Asn Ile Ser Asp His Arg Val Val Ala Asp

20 25 30

Val Glu Pro Gly Tyr Leu Arg Pro Leu Leu Pro Ala Ser Ala Pro Leu

35 40 45

Asp Pro Glu Pro Trp Glu Ser Ile Gln Ser Asp Ile Gln Ser Lys Ile

50 55 60

Leu Pro Gly Ile Thr His Trp Gln Ser Pro Gly Phe Met Ala Phe Phe

65 70 75 80

Pro Cys Ser Ser Ser Tyr Pro Ala Ala Ile Ala Glu Met Tyr Ser Asn

85 90 95

Ala Phe Asn Gly Ala His Phe Asn Trp Ile Cys Ser Pro Ala Val Thr

100 105 110

Glu Leu Glu Thr Ile Val Met Asp Trp Leu Ala Gln Ala Leu Gly Leu

115 120 125

Pro Glu Cys Phe Leu Ser Gly Gly Pro Thr His Gly Gly Gly Val Leu

130 135 140

His Gly Ser Ala Ser Glu Ala Ile Leu Thr Val Met Val Ala Ala Arg

145 150 155 160

Asp Lys Tyr Leu Asn Glu Ala Thr Ala His Leu Pro Glu Gly Glu Glu

165 170 175

Lys Glu Glu Glu Thr Trp Arg Leu Arg Ser Lys Leu Val Ala Leu Gly

180 185 190

Ser Ala Gly Ala His Ser Ser Thr Lys Lys Ala Ala Gln Val Leu Gly

195 200 205

Val Arg Phe Ala Thr Val Pro Val Ser Glu Glu Asn Gly Phe Ser Met

210 215 220

Thr Gly Glu Ala Leu Thr Lys Thr Leu Asp Glu Leu Lys Ala Lys Gly

225 230 235 240

Leu Glu Pro Phe Tyr Leu Thr Ala Thr Leu Gly Thr Thr Asp Val Cys

245 250 255

Ala Val Asp Asp Phe Pro Ser Ile Ala Glu Ala Leu Ala Pro Arg Ala

260 265 270

Gly Lys Pro Gly Glu Val Trp Val His Val Asp Ala Ala Tyr Ala Gly

275 280 285

Ala Ala Leu Leu Leu Asp Glu Asn Lys Pro Leu Ala Lys Pro Met Ala

290 295 300

Asp Phe His Ser Phe Asn Tyr Asn Pro His Lys Trp Met Leu Thr Thr

305 310 315 320

Phe Asp Cys Ser Ala Val Trp Val Arg Ala Arg Gly His Leu Ile Asn

325 330 335

Ala Leu Ser Ile Lys Pro Pro Tyr Leu Arg Asn Gln Tyr Ser Asp Asn

340 345 350

Glu Leu Val Thr Asp Tyr Arg Asp Trp Gln Ile Pro Leu Gly Arg Arg

355 360 365

Phe Arg Ser Leu Lys Leu Trp Phe Val Leu Arg Ser Tyr Gly Ile Arg

370 375 380

Gly Leu Gln Ala His Ile Gln Asn Gly Val Thr Gln Gly Glu Ser Leu

385 390 395 400

Glu Ala Lys Phe Val Thr Arg Pro Asp Leu Phe Thr Ile Phe Thr Lys

405 410 415

Ala Arg Phe Gly Leu Val Ser Phe Arg Ala Lys Gly Asp Gly Glu Asp

420 425 430

Gln Ile Asn Ser Arg Thr Glu Lys Leu Tyr Glu Ala Ile Asn Ala Ser

435 440 445

Gly Gln Phe Tyr Leu Thr Ser Thr Val Val Asn Gly His Phe Ala Ile

450 455 460

Arg Val Cys Thr Gly Val Ala Ala Ile Arg Glu Glu His Val Gln Lys

465 470 475 480

Leu Phe Asp Leu Leu Val Glu Thr Ile Glu Ala Gln Leu Lys Leu Glu

485 490 495

<210> 5

<211> 27

<212> DNA

<213> Artificial sequence

<400> 5

cggaattcat ggcgattatc aagcaga 27

<210> 6

<211> 28

<212> DNA

<213> Artificial sequence

<400> 6

ggggtaccct aaaagcgaag gtcccagc 28

<210> 7

<211> 28

<212> DNA

<213> Artificial sequence

<400> 7

cggaattcat ggatacagaa cagtttcg 28

<210> 8

<211> 26

<212> DNA

<213> Artificial sequence

<400> 8

ggggtaccct actccagctt caactg 26

<210> 9

<211> 19

<212> DNA

<213> Artificial sequence

<400> 9

gtcggcagtc agatcatta 19

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

ccagagcaac ttcatcctt 19

<210> 11

<211> 18

<212> DNA

<213> Artificial sequence

<400> 11

tacagcgaca acgaactt 18

<210> 12

<211> 19

<212> DNA

<213> Artificial sequence

<400> 12

gaacttagcc tccagagac 19

Claims (10)

1. An enzyme-encoding gene comprising a tryptophan synthase (TvTRPS) -encoding gene and/or a tryptophan decarboxylase (TvTDC) -encoding gene, said gene having the nucleotide sequence set forth in any one of (a1) - (a 3):

(a1) a nucleotide sequence shown as SEQ ID NO.1 and/or SEQ ID NO. 2;

(a2) a nucleotide sequence complementary to (a 1);

(a3) a nucleotide sequence which has more than or equal to 90% of identity with the nucleotide sequence shown in (a1) or (a2) and encodes the same functional protein.

2. An enzyme comprising a tryptophan synthase, TvTRPS, and/or a trehalose phosphatase, TvTDC, having an amino acid sequence as follows (b1) or (b 2):

(b1) protein composed of amino acid sequences shown in SEQ ID NO.3 and/or SEQ ID NO. 4;

(b2) and (b1) is a protein which is derived from the protein and has the same biological activity after the substitution and/or deletion and/or addition of one or more amino acid residues.

3. A recombinant expression vector comprising the gene encoding the enzyme of claim 1.

4. The recombinant expression vector according to claim 3, wherein the recombinant expression vector is obtained by operably linking the gene of claim 1 to an expression vector;

preferably, the expression vector is any one or more of a viral vector, a plasmid, a phage, a phagemid, a cosmid, an F cosmid, a phage or an artificial chromosome; further preferred are fungal plasmids; still more preferably pBARGPE1-Hygro plasmid.

5. An engineered bacterium comprising the gene encoding the enzyme of claim 1.

6. The engineered bacterium of claim 5, wherein said engineered bacterium comprises bacteria and fungi, further preferably selected from the group consisting of Escherichia coli, Bacillus, Saccharomyces cerevisiae, Trichoderma viride, and Penicillium oxalicum; more preferably Trichoderma viride.

7. The method for obtaining a gene encoding an enzyme according to claim 1, which is obtained by artificial synthesis or amplification using a primer using genomic DNA or cDNA of Trichoderma viride Tv-1511 as a template; preferably, the amplification primer comprises a sequence shown in SEQ ID NO. 5-8.

8. The method for obtaining the recombinant expression vector of claim 3 or 4, comprising ligating the gene of claim 1 or the gene expression cassette thereof into a plasmid;

preferably, the amplification primer in the construction of the gene expression cassette comprises a sequence shown in SEQ ID NO.5-8, and the restriction enzyme connecting sites are EcoRI and KpnI;

preferably, a pBARGPE1-Hygro linear vector is adopted in the construction of the plasmid, and the enzyme coding gene expression cassette is connected into the pBARGPE1-Hygro linear vector which is subjected to double enzyme digestion by EcoRI and KpnI, so as to obtain the plasmid.

9. The method for constructing the engineering bacteria of claim 5 or 6, which comprises transferring the recombinant expression vector into a protoplast of a host cell;

preferably, the host cell protoplast is a trichoderma protoplast, or the transfer method comprises a biologically acceptable direct transformation method (including a particle gun method, an electric shock method, an ultrasonic method, a microinjection method and a PEG method) or indirect transformation method (including a DNA virus vector mediated method and an agrobacterium mediated method);

preferably, PEG-CaCl is used₂A method;

preferably, the Trichoderma is Trichoderma viride, and further preferably, the Trichoderma viride is Trichoderma viride (Trichoderma viride) Tv-1511.

10. Use of the gene encoding an enzyme according to claim 1, the recombinant expression vector according to claim 3 or 4 and/or the engineered bacterium according to claim 5 or 6 in any one or more of:

c1) the adaptability of the trichoderma to adverse environments is improved;

c2) the growth performance of trichoderma is improved;

c3) the IAA production capacity of trichoderma is improved;

c4) the application effect of the trichoderma in agricultural production is improved;

wherein the trichoderma is preferably trichoderma viride;

the c1) application, adverse environments include but are not limited to salt and alkali and high temperature;

the c4) application is particularly to improve the growth promoting capability of trichoderma to plants, preferably, the plants comprise but are not limited to wheat, cucumber and peppermint.

Images