CN112522228A

CN112522228A - R-transaminase from ammonia oxidation pseudonocardia and synthesis method thereof

Info

Publication number: CN112522228A
Application number: CN202010995350.1A
Authority: CN
Inventors: 李婷婷; 程艺; 卢辰; 许恒皓; 罗志丹; 司鑫鑫; 陈科奇; 霍一君; 吴佳懿
Original assignee: Jiangsu Ocean University
Current assignee: Jiangsu Ocean University
Priority date: 2020-09-21
Filing date: 2020-09-21
Publication date: 2021-03-19
Anticipated expiration: 2040-09-21
Also published as: CN112522228B

Abstract

The invention discloses an R-transaminase from ammonia-oxidizing pseudonocardia and a synthesis method thereof, wherein the R-transaminase is named as PamAT, the nucleotide sequence of the gene is shown as SEQ NO.1, the amino acid sequence is shown as SEQ NO.2, and the R-transaminase contains the amino acid sequence shown as SEQ NO.2 or has at least 90% identity with the SEQ NO.2 or is substituted, deleted or added with one or more amino acids; by highly stereoselective is meant that one stereoisomer is at least about 1.1 times more abundant than the other, and the R-aminotransferases of the present invention are highly stereoselective, have a broad substrate spectrum, and have great potential for use in the biological manufacture of chiral amines and unnatural amino acids.

Description

R-transaminase from ammonia oxidation pseudonocardia and synthesis method thereof

Technical Field

The invention relates to the field of biocatalysis, and mainly relates to a preparation method of R-transaminase derived from ammonia oxidation pseudomonas pseudonocardia amonioxydans and application of the R-transaminase in producing chiral amine and unnatural amino acid.

Background

Unnatural amino acids and chiral amines are key intermediates or key chiral modules in the synthesis of many fine chemicals and pharmaceuticals, for example: sitagliptin, paclitaxel, cisplatin, glufosinate; in addition, polypeptides containing unnatural amino acids are more stable than natural peptides and still retain their biological activity in the presence of proteases, and thus, they will play an irreplaceable role in the development of new drugs, antibodies and artificial proteins that are highly stable and are not rejected by the human body. However, unlike natural amino acids, the existing chiral amines and unnatural amino acids are synthesized organically, which has the disadvantages of high pressure, high temperature and high energy consumption, and the organic synthesis is difficult to obtain optically pure products, and cannot be industrialized by fermentation, which is contrary to the concept of green sustainable development.

Transaminases belong to the class of transferases, which are commonly used to catalyze the transfer of amino groups from an amino donor compound to an amino acceptor compound, and are ubiquitous in animals, plant tissues and microorganisms. Transaminases can be classified into α -transaminases and ω -transaminases according to the position of their substrate amino group: alpha-transaminase is common and can only catalyze the transfer of alpha-amino acid, omega-transaminase is rare, can catalyze the transfer of alpha amino and non-alpha amino, has wider substrate spectrum and strict stereoselectivity, and can be used for resolving amine racemate under mild conditions or catalyzing asymmetric ammonia addition on prochiral substrate carbonyl to produce chiral amine and non-natural amino acid. Transaminases are also involved in many metabolic pathways including vitamin synthesis, carbon nitrogen uptake, secondary metabolism, etc., and are enzymes belonging to the coenzyme 5 '-pyridoxal phosphate (PLP) -dependent class, i.e., class IV transaminases, which are reversible in their catalytic reaction in which PLP is interconverted with 5' -pyridoxamine phosphate (PMP). In a word, the R-transaminase is used for producing optically pure chiral amine and unnatural amino acid, and the problems of high temperature and pressure, high energy consumption and high pollution in the traditional chemical process can be avoided, so the invention discloses the R-transaminase derived from ammonia oxidation pseudonocardia and the application thereof in producing the chiral amine and the unnatural amino acid, the R-transaminase is named as PamAT and is IV-type transaminase with (R) stereoselectivity, the enzyme with specific stereoselectivity obtained by the invention is a key different from a chemical catalyst, accords with the green production concept, and is beneficial to subsequent research and modification and popularization of industrial application.

Disclosure of Invention

The invention discloses an R-transaminase derived from ammonia oxidation pseudonocardia pseudomonad Psendonocardia amonioxydans and application thereof in catalytic production of chiral amine and unnatural amino acid.

In order to achieve the above object, the present invention provides an R-transaminase derived from pseudomonas ammoxidation, named PamAT, or a modification, functional equivalent, functional fragment or variant thereof, characterized in that the amino acid sequence of the R-transaminase comprises a sequence selected from one of the following sequences: (1) an amino acid sequence shown as SEQ NO. 2; (2) an amino acid sequence having at least 90% identity to the amino acid sequence shown and having highly stereoselective R-configuration catalytic activity; (3) a protein which is derived from SEQ NO.2 by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ NO.2 and has transaminase activity with high stereoselective-R configuration catalytic activity; wherein, highly stereoselective means that one stereoisomer is present in an amount of at least 1.1 times greater than the other.

Further, the sequence of nucleotides comprises one of the sequences selected from: (1) a nucleotide sequence shown as SEQ NO. 1; (2) a nucleotide sequence which has at least 90% identity with the nucleotide sequence shown in SEQ NO.1 and codes for a transaminase having a highly stereoselective R-configuration catalytic activity; (3) a nucleotide sequence which hybridizes with the nucleotide sequence shown in SEQ NO.1 under high-stringency conditions and codes transaminase with high stereoselective R configuration catalytic activity; wherein, highly stereoselective means that one stereoisomer is present in an amount of at least 1.1 times greater than the other.

The invention provides a recombinant vector, wherein any one of the nucleotides is effectively connected in the recombinant vector.

Further, the recombinant vector is pET28 b-PamAT.

The present invention provides a host cell transformed or transfected with a recombinant vector of any of the above.

The invention provides a method for synthesizing R-aminotransferase from ammonia-oxidizing Pseudonocardia pseudonocardia amonioxydans, which comprises the following steps: reacting a ketone compound, an R-transaminase or a modification, functional equivalent, functional fragment or variant thereof, pyridoxal phosphate and an amino donor in a reaction system, thereby obtaining an R-chiral amine.

Further, the above ketone compound is

Wherein R1 and R2 are respectively and independently C1-C8 alkyl, C5-C10 cycloalkyl, C5-C10 aryl or C5-C10 heteroaryl, or one of R1 and R2 is carboxyl.

Furthermore, the reaction system also contains a cosolvent, and the cosolvent is dimethyl sulfoxide.

Further, the C1-C8 alkyl C1-C8 straight-chain alkyl is adopted, and the amino donor is isopropylamine or D-alanine.

Compared with the prior art, the invention has the following beneficial effects:

the invention can efficiently synthesize chiral amine with R configuration with higher chiral purity by utilizing R-transaminase with high stereoselectivity or a modifier, a functional equivalent, a functional fragment or a variant thereof, and is suitable for industrial production of the chiral amine; r-transaminases are a more rare class of ω -transaminases than S-transaminases, of particular interest in the biological manufacture of chiral amines and unnatural amino acids; the new R-transaminase HFO disclosed by the invention has strict (R) stereoselectivity and wide substrate spectrum, and shows industrial application prospects in green production of chiral amine and unnatural amino acid, the invention obtains the gene of the new R-transaminase by amplifying in Pseudonocardia ammoxidation through PCR technology, and the comparison of NCBI BlAST base sequences proves that the base sequence of the R-transaminase gene really belongs to the R-transaminase gene sequence of Pseudonocardia ammoxidation, the E.coli DE3-pET-28b-PamAT recombinant strain for expressing R-transaminase protein is obtained through genetic engineering technology, the R-transaminase PamAT is obtained by induction expression, the preparation method is simple and easy to operate, the PamAT can tolerate 40% DMSO, still has more than 90% of activity and has better activity, and meanwhile, the invention is based on the PamAT with high stereoselectivity, meanwhile, the chiral amine or the unnatural amino acid is prepared by taking the ketone compound, the amino compound and the pyridoxal phosphate as raw materials, the reaction condition is mild, the concept of green chemistry is met, an important basis is provided for research, modification and industrial application, the industrial large-scale popularization is facilitated, and the economic value and the social value are greatly improved.

Drawings

FIG. 1 is a plasmid map constructed by the R-transaminase of the present invention.

FIG. 2 shows the amplification results of the target gene of the R-transaminase of the present invention.

FIG. 3 shows the results of protein purification by recombinant expression of the R-transaminase of the present invention.

FIG. 4 is a representation of the enzymatic properties of the R-aminotransferase of the invention.

FIG. 5 shows the results of HPLC analysis of the product catalyzed by the R-transaminase of the present invention.

FIG. 6 shows the results of mass spectrometry of the catalytic products of the R-aminotransferase of the present invention.

FIG. 7 shows chiral analysis of the product of the present invention catalyzed by R-aminotransferase.

Detailed Description

The present invention will be further described in part with reference to the following examples and figures to provide further understanding of the invention by those skilled in the art, but should not be construed as limiting the invention. All other embodiments based on the embodiments of the present invention obtained without any inventive work belong to the scope of the present invention.

In order to meet the requirement of preparing chiral amine compounds, as shown in fig. 1-7, the invention develops a preparation method of an R-transaminase with high R configuration stereoselectivity from Pseudomonadacea aminoxide, the transaminase is named as PamAT, the transaminase is obtained by adopting a molecular biology technology, and is obtained by optimizing and modifying a nucleotide sequence of the transaminase gene from Pseudomonadacea aminoxide on the premise of not changing the amino acid sequence, the nucleotide sequence of the PamAT gene is shown as SEQ NO.1, and the amino acid sequence is shown as SEQ NO. 2.

The first embodiment is as follows: preparation of R-transaminase:

(1) construction of an R-transaminase PamAT vector from Pseudomonas ammoniaoxidans:

the R-transaminase PamAT gene sequence is derived from a GeneBank database wp-093355841.1, on the premise of not changing the amino acid sequence, firstly, the transaminase gene codon from Pseudonocardia ammoxidation is optimized, restriction enzymes Nco I and Hind III are used for connection (biological engineering (Shanghai) Co., Ltd.) to pET-28b vector, the plasmid map is shown in figure 1, the R-transaminase nucleic acid sequence is shown in SEQ NO.1, the amino acid sequence is shown in SEQ NO.2, the pET-28b vector is transformed into competent cells of Escherichia coli DH5 alpha strain, and the competent cells are coated on LB culture dish containing kana with the final concentration of 50 mug/ml after being recovered by a shaker, and cultured in an incubator at 37 ℃ overnight. And (3) selecting a single colony on the culture dish, inoculating the single colony in LB liquid culture medium containing kana with the final concentration of 50 mu g/ml, carrying out shaking culture at 37 ℃ and 220r/min overnight, extracting plasmids, and carrying out PCR identification, wherein the upstream primer is AAAATGGGCAGCAGCCATATGACCCTGGCGGAC, the downstream primer is TGCGGCCGCAAGCTTACGATCAACGTC, the identification result is shown in figure 2, and the size of a PCR amplification product is close to the predicted 1038bp, which indicates that the construction of the PamAT vector is successful.

FIG. 2 shows a gel electrophoresis of PCR amplification of a target gene of R-transaminase, in which bands 1 and 2 are the amplified target gene of R-transaminase and band 3 is a DNA Marker. According to the theoretical size of the target fragment of 1108bp, the amplified product can be judged to be in line with the expectation.

(2) Expression and purification of the R-transaminase protein PamAT:

and (2) transforming the recombinant plasmid pET-28b-PamAT obtained in the step (1) into a competent bacterium of an escherichia coli expression strain BL21(DE3) by adopting a heat shock method. BL21(DE3) -pET28b-PamAT was inoculated in 100ml LB medium and cultured overnight at 37 ℃ to obtain a large number of strains. The obtained expression strain was inoculated at 1% inoculum size to LB liquid medium containing kana at a final concentration of 50. mu.g/ml, and expanded at 37 ℃ at 220r/min to OD₆₀₀When the value is 0.6, IPTG with the final concentration of 0.5mmol/L is added, R-transaminase is induced and expressed at 28 ℃, thalli are collected by centrifugation after 16h, the thalli are subjected to high-pressure crushing and Ni affinity chromatography to obtain R-transaminase protein, the size of the R-transaminase protein is verified by SDS-PAGE electrophoresis, as shown in figure 3, the protein molecular weight of the obtained R-transaminase is about 40kd and is consistent with the theoretical expected value of 37.6kd, and the R-transaminase protein is successfully purified and obtained. The R-transaminase PamAT enzyme was characterized enzymatically in the next step.

FIG. 3 shows a SDS-PAGE pattern of Ni affinity chromatography of recombinant expression R-transaminase, in which the bands shown in the figure are, from left to right, the bacterial liquid before induction of R-transaminase PamAT (DE3), the fermentation liquid after induction, the crushed supernatant, the crushed precipitate, the flow-through liquid, the protein eluent of 20mmol/L imidazole, the protein eluent of 200mmol/L imidazole, the protein eluent of 400mmol/L imidazole and the matrix sample after elution.

(3) The enzymatic properties of the R-transaminase PamAT are characterized:

definition of enzyme activity: the amount of enzyme consumed by the R-transaminase to catalyze the formation of 1. mu. mol of product per minute at a given temperature and under given conditions is defined as 1U.

Preparing a transamination reaction solution: preparing 50mmol/L phenylethylamine and 50mmol/L pyruvic acid reaction liquid, wherein the final concentration of PLP is 2mmol/L, and the pH value of the reaction liquid is 7.5; derivatization of the reaction product: boric acid derivative solution pH 9.0: mixing 0.05mol/L borax solution and 0.2mol/L boric acid solution according to the volume ratio of 4:1 to obtain a derivative buffer solution; phosphate equilibration buffer pH 7.0: weighing 1.7g of potassium dihydrogen phosphate and 300ml of ultrapure water for dissolving, and transferring 72.75ml of 0.1mol/L sodium hydroxide solution; mixing, adding water to desired volume to obtain 500 ml; 1% DNFB was fixed volume using acetonitrile; a derivation step: taking 5ml of amino acid standard substance or sample, 5ml of boric acid derivative buffer solution with pH of 9.0 and 5ml of DNFB derivative solution with concentration of 1%, uniformly mixing, sealing, keeping out of the sun, reacting in water bath at 60 ℃ for 60min, cooling to room temperature, diluting to 50ml with phosphoric acid equilibrium buffer solution with pH of 7.0, standing for 15min, and filtering to obtain the subsequent filtrate.

Detection of the optimal pH value of the R-transaminase PamAT: preparing 9 groups of transamination reaction liquid by using 50mmol/L phenylethylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH of the reaction liquid to 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5 and 10 by using KOH, respectively taking 490 mu L of the transamination reaction liquid, adding 10 mu L of PamAT enzyme liquid, reacting for 5 hours at 30 ℃, measuring the generation amount of the product D-alanine by using the mixture after the reaction according to the method in the (3), and calculating the relative activity under different pH conditions, wherein the result is shown in figure 4, and the result shows that the optimum pH of the R-transaminase PamAT is 7.5.

Determination of the optimum temperature of the R-transaminase PamAT: taking 50mmol/L phenylethylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials; preparing a pH7.5 transaminase reaction solution, taking 490 mu l of the transaminase reaction solution, adding 10 mu l of PamAT enzyme solution, reacting for 5h under different temperature conditions of 4 ℃, 10 ℃, 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃, 50 ℃, 60 ℃ and the like, measuring the generation amount of a product D-alanine by using the mixture after the reaction according to the method in the step (4), calculating the relative activity under different temperature conditions, and obtaining the result shown in the attached figure 4, wherein the optimal reaction temperature of the transaminase PamAT is 30-35 ℃.

Plotting of the R-transaminase kinetic curves: the immobilized donor phenethylamine content was 50mmol/L, 2mmol/L PLP, the acceptor pyruvate concentration was set at 10mM, 20mM, 40mM, 80mM, 120mM, 160mM, 200mM, 240mM, the pH was adjusted to 7.5 with KOH, the immobilized acceptor pyruvate content was 50mmol/L, 2mmol/L PLP, the donor isopropylamine hydrochloride concentration was set at 10mM, 20mM, 40mM, 80mM, 120mM, 160mM, 200mM, 240mM, the pH was adjusted to 7.5 with KOH, 490. mu.l of the transamination reaction solution was taken, 10. mu.l of PamAT enzyme solution was added, the reaction was carried out at 30 ℃ for 5 hours, the resulting mixture after the reaction was measured for the amount of D-alanine produced by the method described in (4), the relative activities were calculated under different substrate concentrations, and an automatic kinetic curve was fitted by the Michaeli-nten algorithm in GraphPad.

R-transaminase organic solvent tolerance test: preparing a transaminase reaction solution by using 50mmol/L phenylethylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, respectively adding DMSO, methanol and acetonitrile, wherein the concentration gradient of each organic solvent is 20% and 40%, adjusting the pH value to 7.5 by KOH, taking 490 mu L of the transaminase reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at 30 ℃, measuring the generation amount of a product D-alanine by using the mixture obtained after the reaction according to the method in the step (4), and calculating the relative activity under the content of the organic solvent, so that the transaminase PamAT can tolerate 40% DMSO, but the activity of the transaminase PamAT is strongly inhibited by the methanol and the acetonitrile as shown in the attached figure 4.

Detection of R-transaminase metal ion tolerance: preparing transamination reaction liquid by taking 50mmol/L phenylethylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, and respectively adding Na⁺、K⁺、Mg²⁺、Zn²⁺、Mn²⁺、Cu²⁺、Co²⁺、Ni²⁺、Fe³⁺Adding metal ion 10mM and adjusting pH to 7.5, adding 10 μ l PamAT enzyme solution into 490 μ l transamination reaction solution, reacting at 30 deg.C for 5h, measuring the formation amount of D-alanine according to the method in (4), calculating the relative activity of transaminases PamAT under different metal ion conditions, and finding out the result shown in figure 4²⁺、Cu² ⁺、Co²⁺、Ni²⁺Is strong and strongInhibiting enzyme activity, on Na⁺、K⁺Better tolerance to Mg²⁺、Mn²⁺、Fe³⁺The enzyme activity is inhibited by about 50%.

(4) Spectral identification of R-transaminase PamAT amino donor substrate

The reaction is as follows:

reaction conditions are as follows: adding 50mmol/L amino donor, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water into 1ml reaction system as raw materials to prepare a transamination reaction solution, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, and reacting for 5 hours at 30 ℃.

And (3) calculating the vitality: the relative activity of each substrate was calculated by measuring the amount of D-alanine produced from the reacted mixture according to the method (3) above.

Example two: PamAT catalyzes the donor D-serine and the acceptor pyruvate to generate D-alanine and 3-hydroxy pyruvate:

using 50mmol/L D-serine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials to prepare a transamination reaction solution, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at 30 ℃, and measuring the generation amount of the product D-alanine by the method (3) of the mixture after the reaction.

Example three: PamAT catalyzes the donor D-alanine and the acceptor 3-hydroxy pyruvic acid to generate D-serine:

preparing a transamination reaction solution by using 50mmol/L D-alanine, 50 mmol/L3-hydroxy pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at the temperature of 30 ℃, and measuring the generation amount of the product D-serine by using the mixture after the reaction according to the method in the step (3).

Example four: PamAT catalyzes the formation of D-alanine and by-product acetone from donor isopropylamine and acceptor pyruvate:

preparing a transamination reaction solution by using 50mmol/L isopropylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at 30 ℃, and measuring the generation amount of a product D-alanine by using the mixture after the reaction according to the method in the step (3).

Example five: PamAT catalyzes donor R-phenylethylamine and acceptor pyruvic acid to generate acetophenone and isopropylamine:

using 50 mmol/LR-acetophenone, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials to prepare a transaminase reaction solution, adjusting pH to 7.5, taking 490 mu L of the transaminase reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at 30 ℃, detecting the reacted mixture at 245nm wavelength by using an enzyme-labeling instrument due to the strong absorption peak of acetophenone at 245nm, and detecting according to the measured OD₂₄₅To calculate the activity of PamAT when acetone is used as a receptor.

Example six: PamAT catalyzes a donor sec-butylamine and an acceptor pyruvic acid to generate D-alanine and a byproduct butanone:

preparing a transamination reaction solution by using 50mmol/L sec-butylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at the temperature of 30 ℃, and measuring the generation amount of a product D-alanine by using the reacted mixture according to the method in the step (3).

Example seven: PamAT catalyzes a donor 2-pentylamine and an acceptor pyruvate to generate D-alanine and a byproduct 2-pentanone:

preparing a transaminase reaction solution by using 50 mmol/L2-pentylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transaminase reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at 30 ℃, and measuring the generation amount of a product D-alanine by using the mixture after the reaction according to the method in the step (3).

(5) Identification of substrate spectrum of PamAT amino receptor of R-transaminase

The reaction is as follows:

reaction conditions are as follows: adding 50mmol/L amino acceptor, 50mmol/L R-phenylethylamine, 2mmol/L PLP and deionized water into 1ml reaction system as raw materials to prepare a transamination reaction solution, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, and reacting for 5 hours at 30 ℃.

And (3) calculating the vitality: the relative activity of each substrate was calculated by measuring the amount of product produced from the reacted mixture by the following method.

Example eight: PamAT catalyzes a donor R-phenethylamine and an acceptor 2-pentanone to generate 2-pentylamine and a byproduct acetophenone:

preparing a transamination reaction solution by taking 50mmol/L R-phenylethylamine, 50 mmol/L2-pentanone, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5 hours at 30 ℃, detecting the reacted mixture at 245nm wavelength by using a microplate reader because acetophenone has a strong absorption peak at 245nm, and detecting according to the measured OD₂₄₅To calculate the activity of PamAT when 2-pentanone was used as receptor.

Example nine: PamAT catalyzes a donor R-phenylethylamine and an acceptor pyruvic acid to generate D-alanine and a byproduct acetophenone:

preparing a transamination reaction solution by using 50mmol/L R-phenylethylamine, 50mmol/L pyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at the temperature of 30 ℃, and measuring the generation amount of a product D-alanine by using a mixture after the reaction according to the method in the step (3).

Example ten: PamAT catalyzes a donor R-phenylethylamine and an acceptor 3-hydroxy pyruvic acid to generate D-alanine and a byproduct acetophenone:

preparing a transamination reaction solution by using 50mmol/L R-phenylethylamine, 50 mmol/L3-hydroxypyruvic acid, 2mmol/L PLP and deionized water as raw materials, adjusting the pH to 7.5, taking 490 mu L of the transamination reaction solution, adding 10 mu L of PamAT enzyme solution, reacting for 5h at the temperature of 30 ℃, and measuring the generation amount of the product D-alanine by using the mixture after the reaction according to the method in the step (3).

To determine that the catalytic product of the R-transaminase is D-alanine, the reaction mixture was subjected to HPLC, mass spectrometry and chiral chromatography, respectively. The detection of the theoretical product alanine requires pre-column derivatization followed by HPLC analysis, while the alanine standard derivative is also prepared as a positive control. As shown in FIG. 5, (a) the arrows in the figure indicate the peaks of the alanine standard derivative, and (b) the arrows in the figure indicate the peaks of the reaction product after the derivatization, the retention times of which coincide with the retention times of the alanine standard derivative, and it is presumed that the reaction product of PamAT may have alanine.

However, in order to directly confirm that the product produced is alanine, it is necessary to accurately measure the relative molecular mass. Therefore, after purification of the derivative product, the derivative product is sent to a third party for mass spectrometry, and the result is shown in fig. 6, and the molecular mass of the derivative alanine is 255.1, which corresponds to the molecular mass 254.1 detected in the figure. In addition, mass spectrometry determined the molecular mass of 509.2 compounds, actually after the derivative alanine two dimer. Thus, it was determined that the transaminase PamAT is able to catalyze the production of alanine, but that the mass spectrum is unable to analyze chirality.

In order to determine whether the alanine is in D or L form, it is necessary to perform chiral column chromatography. And (3) deriving and purifying products generated by the transamination reaction, simultaneously deriving and purifying an L-alanine standard substance and a D-alanine standard substance, and handing the three processed samples to a third party for chiral column detection. The detection result is shown in FIG. 7, (a) the arrow of the figure indicates the peak of the L-alanine standard derivative, and the corresponding retention time is 9.677 min; (b) the arrow in the figure indicates the peak of the D-alanine standard derivative, which corresponds to a retention time of 13.016 min; (c) in the figure, the two arrows indicate the peaks of the reaction product after derivatization, wherein the corresponding retention time of the peak indicated by the left arrow is 9.723min, which indicates that the component is an L-alanine derivative, and the corresponding retention time of the peak indicated by the right arrow is 13.092min, which indicates that the component is a D-alanine derivative, and the ee value of D-alanine in the reaction product is calculated to be 78%. The transaminase PamAT is capable of catalyzing the production of D-alanine with phenethylamine as the amino donor and pyruvate as the amino acceptor, and is therefore an R-selective transaminase (R-ATA).

The invention can use D-amino acid and R-amine as amino donor, adopt asymmetric synthesis method of adding ammonia to chiral carbonyl compound to generate chiral amine and unnatural amino acid, and the R-transaminase PamAT has catalytic activity to D-amino acid or R-amine: among them, D-alanine, D-serine, isopropylamine, R-phenylethylamine, 2-aminopentane, 3-aminopentane, pyruvic acid, 3-hydroxypyruvic acid, acetone, etc. are preferable as catalytic activities.

From the above description, it can be seen that the above-described embodiments of the present invention achieve the following technical effects: the novel transaminase disclosed by the invention catalyzes the transfer of amino in an amino donor to prochiral ketone or aldehyde to generate chiral amine with corresponding R configuration, and the preparation of amine synthesis by utilizing the novel transaminase disclosed by the invention can convert more substrates to obtain the chiral amine with R configuration, and the purity of the obtained chiral amine is high and is stable to more than 98%. The synthesis method has the advantages of easily available raw materials, simple method, mild chemical reaction conditions, high yield and high enantiomer purity, is simple to operate in the whole production process, is a feasible synthesis process with low pollution, and provides a new approach and a new method for preparing chiral amine.

See table 1-table 2 below for specific PamAT activity assays:

TABLE 1 determination of the Activity of the transaminase PamAT on the amino donors

TABLE 2 determination of the Activity of the transaminase PamAT on the receptor ketones

The above description is only for the specific embodiments of the present invention, but the scope of the present invention is not limited thereto, and any person skilled in the art can easily conceive of the changes or substitutions within the technical scope of the present invention, and all the changes or substitutions should be covered within the scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the protection scope of the appended claims.

Sequence listing

<110> university of oceanic Jiangsu

<120> R-transaminase derived from ammonia oxidation pseudonocardia and synthesis method thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1038

<212> DNA

<213> Psendonocardia ammonioxydans

<400> 1

atgaccctcg ccgattccgg aaccgacttc tcgaccagca acctcgtcgc ggtcgagccc 60

ggggcgatcc gtgaggacac gccgcccggc tccgtgatcc agtacagcga ctacgagctc 120

gacacctcca gcccctacgc cggaggcgcg gcgtggatcg aaggcgagta cgtcccggcg 180

tcggaggccc ggatctccat cttcgacacc ggcttcggcc actccgacct gacctacacc 240

gtcgcccacg tctggcacgg caacatcttc cggctggccg accacatcga acgcctcctc 300

gacggagccc ggaagctgcg gctcgcctcg ccgtacgacg agaccgagat cgccgagatc 360

gcgaaacgct gtgtcggtct gtcccaattg cgcgaggcct atgtgaacat cacgctcacc 420

cgcggctacg gcaagcggaa gggcgagaag gatctgagca agctcacctc gcagatctac 480

gtctacgcga tcccgtacct gtgggcgttc cctccgtacg aacagatctt cgggacctcc 540

gcggtcgtac cccgccacgt gcaacgcgcc gggcgcaaca ccatcgatcc gacgatcaag 600

aactatcagt ggggggacct gaccgccgcg agcttcgagg ccaaggaccg cggtgcccgc 660

accggcatcc tgctggacgc cgacggatgt gttgccgagg gaccagggtt caacgtcgtc 720

gtggtcaagg acggcgcgct ggcgtccccg tcccggaacg cgctacccgg gatcacccgc 780

aagaccgtct tcgagatcgc ccacgcgcga gggatctcgg ccgagttgcg cgacgtcacg 840

agccgggagc tctacgacgc cgacgagttg atggccgtca cgacggcggg cggagtcacc 900

ccgatcacct cgctcgacgg cgccgctgtc ggcgacggcg agccgggccc gatcacggtg 960

gcgatccggg accggttctg ggcgctcatg gacgagccgt cggacttgat cgacacgatc 1020

aggtacgacg tggatcgc 1038

<210> 2

<211> 346

<212> PRT

<213> Psendonocardia ammonioxydans

<400> 2

Met Thr Leu Ala Asp Ser Gly Thr Asp Phe Ser Thr Ser Asn Leu Val

1 5 10 15

Ala Val Glu Pro Gly Ala Ile Arg Glu Asp Thr Pro Pro Gly Ser Val

20 25 30

Ile Gln Tyr Ser Asp Tyr Glu Leu Asp Thr Ser Ser Pro Tyr Ala Gly

35 40 45

Gly Ala Ala Trp Ile Glu Gly Glu Tyr Val Pro Ala Ser Glu Ala Arg

50 55 60

Ile Ser Ile Phe Asp Thr Gly Phe Gly His Ser Asp Leu Thr Tyr Thr

65 70 75 80

Val Ala His Val Trp His Gly Asn Ile Phe Arg Leu Ala Asp His Ile

85 90 95

Glu Arg Leu Leu Asp Gly Ala Arg Lys Leu Arg Leu Ala Ser Pro Tyr

100 105 110

Asp Glu Thr Glu Ile Ala Glu Ile Ala Lys Arg Cys Val Gly Leu Ser

115 120 125

Gln Leu Arg Glu Ala Tyr Val Asn Ile Thr Leu Thr Arg Gly Tyr Gly

130 135 140

Lys Arg Lys Gly Glu Lys Asp Leu Ser Lys Leu Thr Ser Gln Ile Tyr

145 150 155 160

Val Tyr Ala Ile Pro Tyr Leu Trp Ala Phe Pro Pro Tyr Glu Gln Ile

165 170 175

Phe Gly Thr Ser Ala Val Val Pro Arg His Val Gln Arg Ala Gly Arg

180 185 190

Asn Thr Ile Asp Pro Thr Ile Lys Asn Tyr Gln Trp Gly Asp Leu Thr

195 200 205

Ala Ala Ser Phe Glu Ala Lys Asp Arg Gly Ala Arg Thr Gly Ile Leu

210 215 220

Leu Asp Ala Asp Gly Cys Val Ala Glu Gly Pro Gly Phe Asn Val Val

225 230 235 240

Val Val Lys Asp Gly Ala Leu Ala Ser Pro Ser Arg Asn Ala Leu Pro

245 250 255

Gly Ile Thr Arg Lys Thr Val Phe Glu Ile Ala His Ala Arg Gly Ile

260 265 270

Ser Ala Glu Leu Arg Asp Val Thr Ser Arg Glu Leu Tyr Asp Ala Asp

275 280 285

Glu Leu Met Ala Val Thr Thr Ala Gly Gly Val Thr Pro Ile Thr Ser

290 295 300

Leu Asp Gly Ala Ala Val Gly Asp Gly Glu Pro Gly Pro Ile Thr Val

305 310 315 320

Ala Ile Arg Asp Arg Phe Trp Ala Leu Met Asp Glu Pro Ser Asp Leu

325 330 335

Ile Asp Thr Ile Arg Tyr Asp Val Asp Arg

340 345

Claims

1. An R-transaminase derived from pseudomonas ammoxidation, characterized by: the enzyme is ordered as PamAT, and the amino acid sequence of said R-transaminase comprises a sequence selected from one of the following sequences:

(1) an amino acid sequence shown as SEQ NO. 2;

(2) an amino acid sequence having at least 90% identity in its amino acid sequence and having highly stereoselective R-configuration catalytic activity;

(3) a protein which is derived from SEQ NO.2 by substituting, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ NO.2 and has transaminase activity with high stereoselective-R configuration catalytic activity;

wherein, the stereoselectivity is high; meaning that one stereoisomer is at least 1.1 times as great as the other.

2. The enzyme of claim 1, which is an R-transaminase derived from pseudomonas ammoxidation, and which is characterized by: a sequence encoding a PamAT, the nucleotide sequence of which comprises a sequence selected from one of the following:

(1) a nucleotide sequence shown as SEQ NO. 1;

(2) a nucleotide sequence which has at least 90% identity with the nucleotide sequence shown in SEQ NO.1 and codes for a transaminase having a highly stereoselective R-configuration catalytic activity;

(3) a nucleotide sequence which hybridizes with the nucleotide sequence shown in SEQ NO.1 under high-stringency conditions and codes transaminase with high stereoselective R configuration catalytic activity;

wherein, highly stereoselective means that one stereoisomer is present in an amount of at least 1.1 times greater than the other.

3. The enzyme of claim 1, which is an R-transaminase derived from pseudomonas ammoxidation, and which is characterized by: the recombinant vector operatively linked to the nucleotide of claim 2.

4. The enzyme of claim 3, which is an R-transaminase derived from Pseudonocardia ammoxidation enzyme, and which is characterized by: the recombinant vector is pET28 b-PamAT.

5. The enzyme of claim 4, which is an R-transaminase derived from Pseudonocardia ammoxidation enzyme, and which is characterized by: the recombinant vector transfects or transforms a host cell.

6. A method of synthesizing the R-transaminase of claim 1, wherein: the method comprises the following steps: reacting a ketone compound, an R-type transaminase or a modification, functional equivalent, functional fragment or variant thereof, pyridoxal phosphate and an amino donor in a reaction system, thereby obtaining an R-type chiral amine.

7. The method of synthesizing an R-transaminase of claim 6, wherein: the ketone compound is

8. The method of synthesizing an R-transaminase of claim 7, wherein: the reaction system also contains a cosolvent, and the cosolvent is dimethyl sulfoxide.

9. The method of synthesizing an R-transaminase of claim 7, wherein: the C1-C8 alkyl is C1-C8 straight-chain alkyl, and the amino donor is isopropylamine or D-alanine.