CN112522221B - High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof - Google Patents
High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof Download PDFInfo
- Publication number
- CN112522221B CN112522221B CN202011491802.9A CN202011491802A CN112522221B CN 112522221 B CN112522221 B CN 112522221B CN 202011491802 A CN202011491802 A CN 202011491802A CN 112522221 B CN112522221 B CN 112522221B
- Authority
- CN
- China
- Prior art keywords
- superoxide dismutase
- sod
- aasod
- temperature
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0089—Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
- C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
- C12Y115/01001—Superoxide dismutase (1.15.1.1)
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention provides a high-temperature-resistant acid-resistant superoxide dismutase and a preparation method and application thereof, belonging to the technical field of biological medicines, cosmetics and foods. The SOD gene cloned from alicyclobacillus in hot spring environment is recombined to perform exogenous expression, and the enzymatic characteristics of the SOD gene are deeply analyzed, so that the expressed superoxide dismutase has the characteristics of high temperature resistance, acid resistance and the like, can be used in the fields of biological medicine, food, cosmetics and the like, and has good practical application value.
Description
Technical Field
The invention belongs to the technical field of biological medicines, cosmetics and foods, and particularly relates to a high-temperature-resistant and acid-resistant superoxide dismutase and a preparation method and application thereof.
Background
The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.
Superoxide dismutase (SOD) is a metal enzyme which can catalyze superoxide anion free radicals to generate disproportionation reaction, can specifically eliminate superoxide anion free radicals in organisms, can resist damage of oxygen radicals and other oxide free radicals to cytoplasmic membranes, proteases and other biological macromolecules and organelles, and can remove damage of exogenous oxygen radicals to the organisms, so that the SOD plays an important role in maintaining the balance of oxygen radicals of the organisms. SOD is widely found in humans, animals, plants and various microorganisms. As the most effective enzymes for eliminating superoxide radicals, the product has the characteristics of radiation resistance, aging resistance, oxidation resistance and tumor prevention and treatment, is widely applied to the industries of cosmetics, medicines, health products and foods, and has great application potential and wide development prospect.
SOD is divided into three types according to metal auxiliary groups: copper-and zinc-containing superoxide dismutase (Cu/Zn-SOD), manganese-containing superoxide dismutase (Mn-SOD) and iron-containing superoxide dismutase (Fe-SOD). Cu/Zn-SOD is mainly present in eukaryotic cytoplasm, chloroplast and bacterial cytoplasm and periplasmic space. Mn-SOD is mainly present in the mitochondria of prokaryotes and eukaryotes. Fe-SOD is present in prokaryotes, protozoa, a few algae and plants. Ni-SOD studies are relatively rare and found only in Streptomyces and cyanobacteria.
In recent years, with the research of SOD, its application is becoming more and more extensive, such as: medical clinical, agricultural, food industry and cosmetic industry, etc. In the clinical aspect of medical treatment: SOD has good anti-inflammatory property, is used clinically, and has good curative effect on some inflammatory diseases (arthritis, rheumatoid arthritis and the like); by intravenous injection of SOD, the symptoms of bone marrow damage and leukopenia caused by chemotherapy of patients can be obviously relieved; in addition, the SOD has obvious effect on treating autoimmune diseases, senile cataract, burn and scald, neonatal dyspnea syndrome, radiation disease, emphysema and other diseases. In the agricultural aspect: the research of SOD mainly focuses on the aspects of plant diseases, freezing injury, aging, drought, fruit and vegetable storage and the like; in some plant transgenic researches, Fe-SOD transgenic plants show stronger stress resistance. In the food industry: SOD is commercialized after chemical modification (heparin compound, chondroitin sulfate, hyaluronic acid, lauric acid, etc.) and microencapsulation, and is added into health product oral liquid, canned food, fruit juice, yogurt, beer, etc. as additive; the fruit and vegetable fresh-keeping agent is used for fruit and vegetable fresh-keeping after picking by inhibiting the oxidation of oxidase. In the cosmetics industry, the cosmetic additive is mainly used as the cosmetic additive: the SOD can effectively prevent the skin from being damaged by light radiation and has obvious sunscreen effect; delaying skin aging, removing speckle, and resisting wrinkle, and has antioxidant oxidase effect; in addition, the Chinese medicinal composition has good effects of preventing and treating certain skin diseases and scar formation, and has small side effect. In the aspect of feed, the SOD added into the feed can improve the serum immunity index, the intestinal oxidation resistance and the digestive enzyme activity of the broiler chicken, improve the oxidation resistance of the broiler chicken and improve the meat quality.
As described above, SOD is mainly used in the fields of food, medicine, cosmetics, agriculture, and the like, and high stability and activity are required for SOD in these fields. Traditionally, SOD prepared mainly from plant tissues, animal blood and liver has low yield, high cost and poor stability, and the application of the SOD is limited. The efficient expression by utilizing a microorganism-gene engineering method is an effective way for obtaining SOD products required by application. Compared with SOD at normal temperature, SOD derived from extreme microorganisms not only has higher resistance to temperature but also shows higher stability in tolerance to physical and chemical denaturants. Therefore, the microorganism with the dual characteristics of heat resistance and acid resistance and the heat resistance and acid resistance SOD produced by the microorganism have wide application prospects in the aspects of food chemical industry.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a high-temperature-resistant acid-resistant superoxide dismutase and a preparation method and application thereof. The SOD gene cloned from alicyclobacillus in hot spring environment is recombined to perform exogenous expression, and the enzymatic characteristics of the SOD gene are deeply analyzed, so that the expressed superoxide dismutase has the characteristics of high temperature resistance, acid resistance and the like, thereby having good practical application value.
The invention is realized by the following technical scheme:
in a first aspect of the invention, a high temperature and acid resistant superoxide dismutase is provided, wherein the amino acid sequence of the superoxide dismutase is shown as SEQ ID NO. 1. Tests prove that the antioxidant activity of the superoxide dismutase reaches 94.56U/mg (calculated by pyrogallol autoxidation method), the superoxide dismutase has the highest antioxidant activity at 35 ℃, the superoxide dismutase still has more than 90% of residual activity after being placed at 70 ℃ for 1h, and the superoxide dismutase still has 75% of residual activity after being placed at 80 ℃ for 1h, which indicates that the superoxide dismutase has very strong heat resistance; meanwhile, the enzyme can play good enzyme activity at pH4.0, and the active center of the enzyme is opposite to Fe 2+ And Mn 2+ Without selectivity, the ability of a protein to bind two ions during folding is nearly identical, and what can affect the binding of the enzyme is the concentration of the two ions in solution. More importantly, the active center is Mn 2+ The superoxide dismutase has antioxidant activity of about combined Fe 2+ Ten times higher.
In a second aspect of the present invention, there is provided a superoxide dismutase analog having the same biological activity as the superoxide dismutase, wherein the superoxide dismutase analog is a polypeptide sequence or protein having biological activity formed by fusing another polypeptide or protein with the superoxide dismutase or with an amino acid sequence of the superoxide dismutase.
In the third aspect of the invention, the superoxide dismutase derivative is provided, the amino acid sequence of the derivative has 70% or more consistency and 90% or more similarity with the main amino acid sequence of the superoxide dismutase, and the derivative refers to the superoxide dismutase which has the same biological activity as the superoxide dismutase after replacing a certain group of one or more amino acids in the amino acid sequence of the superoxide dismutase by another group.
In a fourth aspect of the present invention, there is provided a superoxide dismutase variant having an amino acid sequence with 70% or more identity and 90% or more similarity to the amino acid main sequence of superoxide dismutase, wherein the variant is an amino acid sequence having one or more amino acid or nucleotide changes including deletion, insertion or substitution of amino acid or nucleotide at any position in the middle of the sequence or addition of amino acid or nucleotide at both ends of the sequence, or a nucleotide sequence encoding the same, and the superoxide dismutase variant has the same biological activity as the superoxide dismutase.
In a fifth aspect of the present invention, there is provided a nucleotide encoding the superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative or superoxide dismutase variant, comprising any one of the following groups:
a) a nucleotide encoding a polypeptide having the amino acid sequence or an analogue, derivative or variant thereof;
b) a nucleotide complementary to the nucleotide of a);
c) a nucleotide having 75% or more sequence identity to the nucleotide in a) or b).
The nucleotide can be prepared by adopting an artificial synthesis method.
Wherein, in a), the nucleotide sequence is shown as SEQ ID NO. 2.
In a sixth aspect of the present invention, there is provided a method for producing the above-mentioned superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative or superoxide dismutase variant, said method comprising producing from a genetically engineered bacterium by gene recombination.
Further, the preparation method comprises the following steps:
synthesizing a nucleotide encoding said superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative, or superoxide dismutase variant;
introducing the nucleotide into an expression vector to construct a recombinant expression vector, then introducing the recombinant expression vector into a host for culturing and collecting.
In a seventh aspect of the present invention, there is provided the use of the above superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative or superoxide dismutase variant in the fields of biomedicine, feed, food, cosmetics and biotransformation, especially in high temperature and/or acidic environments.
The beneficial technical effects of one or more technical schemes are as follows:
the technical proposal obtains a new superoxide dismutase AaSOD by cloning and exogenously expressing Alicyclobacillus sp.HJ, and the experiment proves that the enzyme activity of the superoxide dismutase SOD can reach 94.56 U.mg -1 The pyrogallol has the characteristics of outstanding high temperature resistance (75 percent of enzyme activity still exists in the environment of 80 ℃ for 1 hour, the melting temperature Tm reaches 89.54 ℃), acid resistance (about 4.0) and the like (calculated by a pyrogallol autoxidation method), can be used in the fields of biological medicines, foods, cosmetics and the like, and has good practical application value.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.
FIG. 1 shows PCR electrophoresis of AaSOD gene in example 1 of the present invention.
FIG. 2 is SDS-PAGE analysis of AaSOD purification in example 2 of the present invention; m, protein molecular weight marker; 1,250 mM imidazole eluted sample; 2, precipitating the crushing liquid; and 3, crushing liquid supernatant.
FIG. 3 is a graph showing temperature tolerance and optimum temperature of superoxide dismutase in example 3 of the present invention, wherein A is a temperature tolerance graph and B is an optimum temperature graph.
FIG. 4 is a DSC analysis of AaSOD in example 3 of the present invention.
FIG. 5 is a graph showing the effects of pH tolerance and metal ions on AaSOD activity in example 3 of the present invention; wherein A is pH tolerance, and B is the influence of metal ions on the activity of AaSOD.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise. It is to be understood that the scope of the invention is not to be limited to the specific embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention. The experimental procedures, if specific conditions are not indicated in the following detailed description, are generally in accordance with conventional procedures and conditions of molecular biology within the skill of the art, which are fully explained in the literature. See, e.g., Sambrook et al, molecular cloning: the techniques and conditions described in the Experimental handbook ", or according to the manufacturer's recommendations.
As described above, SOD is mainly used in the fields of food, medicine, cosmetics, agriculture, and the like, and high stability and activity are required for SOD in these fields. Traditionally, SOD prepared mainly from plant tissues, animal blood and liver has low yield, high cost and poor stability, and the application of the SOD is limited. The efficient expression by utilizing a microorganism-gene engineering method is an effective way for obtaining SOD products required by application. Compared with SOD at normal temperature, SOD derived from extreme microorganisms not only has higher resistance to temperature but also shows higher stability in tolerance to physical and chemical denaturants. Therefore, the microorganism with the dual characteristics of heat resistance and acid resistance and the heat resistance and acid resistance SOD produced by the microorganism have wide application prospects in the aspects of food chemical industry.
In view of the above, in one embodiment of the present invention, a high temperature and acid resistant superoxide dismutase is provided, wherein the amino acid sequence of the superoxide dismutase is shown as SEQ ID No. 1. Tests prove that the antioxidant activity of the superoxide dismutase reaches 94.56U/mg (calculated by pyrogallol autoxidation method), the superoxide dismutase has the highest antioxidant activity at 35 ℃, the superoxide dismutase still has more than 90% of residual activity after being placed at 70 ℃ for 1h, and the superoxide dismutase still has 75% of residual activity after being placed at 80 ℃ for 1h, which indicates that the superoxide dismutase has very strong heat resistance; meanwhile, the enzyme can play good enzyme activity at pH4.0, and the active center of the enzyme is opposite to Fe 2+ And Mn 2+ Without selectivity, the ability of a protein to bind two ions during folding is nearly identical, and what can affect the binding of the enzyme is the concentration of the two ions in solution. More importantly, the active center is Mn 2+ The superoxide dismutase has antioxidant activity of about combined Fe 2+ Ten times higher.
In still another embodiment of the present invention, there is provided a superoxide dismutase analog having the same biological activity as the superoxide dismutase, wherein the superoxide dismutase analog is a polypeptide sequence or protein having biological activity formed by fusing the superoxide dismutase with another compound or fusing another polypeptide or protein with an amino acid sequence of the superoxide dismutase.
In still another embodiment of the present invention, there is provided a superoxide dismutase derivative having an amino acid sequence with an identity of > 70% (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) to the amino acid main sequence of superoxide dismutase, a similarity of > 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more), the derivative refers to superoxide dismutase which has the same biological activity with the superoxide dismutase after replacing one or a plurality of amino acid groups in the amino acid sequence with other groups.
In still another embodiment of the present invention, there is provided a variant of superoxide dismutase having an amino acid sequence with an identity of 70% or more (e.g., 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) to the amino acid main sequence of superoxide dismutase and a similarity of 90% or more (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more), the variant being an amino acid sequence having one or several amino acid or nucleotide changes included in the amino acid sequence or nucleotide sequence encoding it, the superoxide dismutase variant has the same biological activity as the superoxide dismutase, wherein the amino acid or the nucleotide is deleted, inserted or replaced at any position in the middle of the sequence, or the amino acid or the nucleotide is added at two ends of the sequence.
In a further embodiment of the present invention, there is provided a nucleotide encoding the superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative or superoxide dismutase variant, comprising any one of the following groups:
(a) a nucleotide encoding a polypeptide having the amino acid sequence or an analogue, derivative or variant thereof;
(b) a nucleotide complementary to the nucleotide of (a);
(c) a nucleotide that is more than or equal to 75% (e.g., 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% (complete) sequence) identical to the nucleotide of (a) or (b).
In still another embodiment of the present invention, in a), the nucleotide sequence is shown in SEQ ID No. 2.
The nucleotide is prepared by adopting an artificial synthesis method.
In still another embodiment of the present invention, there is provided a method for producing the above-mentioned superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative, or superoxide dismutase variant, the method at least comprising:
synthesizing a nucleotide encoding said superoxide dismutase, superoxide dismutase analog, superoxide dismutase derivative, or superoxide dismutase variant;
introducing the nucleotide into an expression vector to construct a recombinant expression vector, then introducing the recombinant expression vector into a host for culturing and collecting.
In yet another embodiment of the present invention, the expression vector is any one or more of a viral vector, a plasmid, a phage, a phagemid, a cosmid, an F-cosmid, a phage, or an artificial chromosome; the viral vector may comprise an adenoviral vector, a retroviral vector, or an adeno-associated viral vector, the artificial chromosomes comprising a Bacterial Artificial Chromosome (BAC), a bacteriophage P1 derived vector (PAC), a Yeast Artificial Chromosome (YAC), or a Mammalian Artificial Chromosome (MAC); further preferably a plasmid; even more preferably pET-24a plasmid;
in yet another embodiment of the present invention, the host includes, but is not limited to, bacteria, fungi and eukaryotic cells, further selected from the group consisting of Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Trichoderma reesei, and Penicillium oxalicum; more preferably Escherichia coli BL 21.
In another embodiment of the present invention, the present invention provides the application of the superoxide dismutase, the superoxide dismutase analog, the superoxide dismutase derivative or the superoxide dismutase variant in the fields of biomedicine, feed, food, cosmetics and biotransformation, especially the application fields of high temperature and/or acidic environment. The high temperature environment is not lower than 30 ℃ (such as 35 ℃ -45 ℃, 45 ℃ -55 ℃ or 55 ℃ -65 ℃); further, it is not lower than 65 ℃ (e.g., 65 ℃ to 70 ℃, 70 ℃ to 75 ℃, 75 ℃ to 80 ℃, 80 ℃ to 85 ℃, 85 ℃ to 90 ℃ or higher temperature, or 65 ℃, 66 ℃, 67 ℃, 68 ℃, 69 ℃, 70 ℃, 71 ℃, 72 ℃, 73 ℃, 74 ℃, 75 ℃, 76 ℃, 77 ℃, 78 ℃, 79 ℃, 80 ℃, 81 ℃, 82 ℃, 83 ℃, 84 ℃, 85 ℃, 86 ℃, 87 ℃, 88 ℃, 89 ℃, 90 ℃).
The pH value of the acidic environment is not higher than 7 (for example, the pH value is 2-6, including the pH value is 2, 3, 4, 5 or 6, and the preferable pH value is 4), and the superoxide dismutase has higher stability in the acidic environment, so that the superoxide dismutase still has better enzyme activity in the acidic stomach environment, thereby indicating that the superoxide dismutase has wide application value in the fields of food, feed, medicine and the like.
The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. The test methods in the following examples, which are not specified under specific conditions, are generally carried out under conventional conditions.
Example 1: cloning and expression of AaSOD Gene
AaSOD gene PCR amplification
The PCR primers designed by oneself (Primer 5.0) were sent to Huada gene synthesis, and the primers were:
forward AaSOD-F (5' -CG)GGATCCATGCCACATCAACTCCCAC–3’，SEQ ID NO.3)；
Reverse AaSOD-R (5' -CCC)AAGCTTGCCGTTCAGCGCGGCCTCGT–3’,SEQ ID NO.4)。
Genomic DNA of Alicyclobacillus (Alicyclobacillus sp.hj) was extracted using a bacterial genome extraction kit. Using genome as template, constructing the PCR reaction system as follows:
TABLE 1 PCR amplification System for target genes
AaSOD gene was amplified using the following PCR amplification procedure:
denaturation at 95 deg.C for 5 min; b, performing 30 cycles of denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s and extension at 72 ℃; c.72 ℃ extension for 10min, cooling to 4 ℃.
The PCR product was electrophoresed in 1% agarose gel at 120V for 20min and observed in a gel imaging system, and the band of about 600bp was recovered as shown in FIG. 1.
The PCR product was recovered by the method of gel recovery kit, and eluted with 20. mu.L of sterile water.
2. Enzyme digestion
The PCR product was digested using the following system: endonucleases BamHI 2.5. mu.L and Hind III 2.5. mu.L, DNA (PCR product) 5. mu.g, 10 XBuffer 10. mu.L, sterile distilled water to 100. mu.L, and digestion at 37 ℃ for 1 h.
Double digestion of plasmid pET-24 a: coli DH 5. alpha. single colonies containing the plasmid were picked and cultured overnight. Extracting plasmids by using a plasmid extraction kit, and carrying out double digestion reaction by using endonucleases BamH I and Hind III according to the following system: 5 μ L of BamHI and 5 μ L of Hind III, 10 μ g of plasmid DNA, 20 μ L of 10 XBuffer, sterile distilled water to 200 μ L, and a cleavage time of 1h at 37 ℃.
The restriction enzyme used in the above double digestion is a quick endonuclease produced by Thermo.
3. Connection of
The PCR product subjected to double enzyme digestion and the plasmid vector pET-24a are connected according to the following table, T4 ligase used for connection is purchased from Beijing Quanyujin biotechnology company, the connection temperature is 25 ℃, the connection time is 40min, and the connected connection product is named as: pET-24 a-AaSOD.
TABLE 2 ligation System of target genes and plasmid vectors
4. Transformation and screening
And adding the 10 mu L of the ligation product into competent cells of escherichia coli BL21, carrying out ice bath for 30min, carrying out heat shock at 37 ℃ for 5min, carrying out ice bath for 5min, adding 500mL of sterilized LB liquid culture medium, carrying out shake culture at 37 ℃ for 1h in a shaking table, coating an LB flat plate, and carrying out culture at 37 ℃ overnight.
And (3) selecting transformants from the LB plate, culturing the transformants in a liquid LB culture medium overnight, extracting plasmids, and carrying out PCR (polymerase chain reaction) and sequencing verification to obtain the target transformant named as BL 21-AaSOD.
Example 2: AaSOD expression, purification and enzyme activity determination
1. Protein induced expression
Selecting BL21-AaSOD single colony, inoculating into 5mL LB culture medium, culturing at 37 deg.C and 200r/min overnight, transferring 1mL culture into 100mL fresh LB culture medium, culturing at 37 deg.C and 200r/min to OD 600 When the concentration is 0.8-1.0, IPTG is added to the final concentration of 1mM, the temperature is 37 ℃, and induction culture is carried out for 4-5h at 180 r/min. 17000g of the obtained fermentation liquid is centrifuged for 3min, and thalli are collected and stored at the temperature of minus 20 ℃ for later use.
Purification of AaSOD
The cells obtained above were resuspended in 100mL of loading Buffer (Buffer A: 25mM TRIS, 250mM NaCl, pH 8.0), and disrupted by sonication for 5min (or homogenized under high pressure at 600 and 800bar, 3-5 cycles). 17000g of the disruption solution was centrifuged for 30min, and the centrifuged supernatant was filtered through a 0.22 μm membrane and then placed on ice for use.
Taking a chromatographic column (HisTrap FF column), washing a preservation solution with deionized water, balancing by using 5 times of column volume Buffer A, transferring a filtered supernatant of a crushed solution to the column, washing by using 5 times of column volume Buffer A, washing by using Buffer A containing 30mM imidazole for 20 times of column volume, eluting a target protein (5 times of column volume) by using Buffer A containing 250mM imidazole, analyzing the obtained sample by using SDS-PAGE, concentrating the sample with the highest purity of the target protein to 5-10mL (ultrafiltration centrifugation), dialyzing by using Buffer B (50mM TRIS, pH 8.0), and storing at 4 ℃.
AaSOD enzyme activity assay
The activity of AaSOD was measured by pyrogallol autoxidation.
Determination of blank control. Adding pyrogallol (50mM) into Buffer B to make the final volume of the reaction solution be 3mL, quickly mixing, pouring into a cuvette, reacting for 4min, and measuring A every 30s 325 Calculating the slope Δ A of the obtained line 0 The amount of pyrogallol added is controlled so that the autoxidation rate is about 0.07 OD/min.
And (4) measuring the sample. Adding sample and pyrogallol (50mM) into Buffer B to make the final volume of reaction solution be 3mL, quickly mixing, pouring into a cuvette, reacting for 4min, and measuring A every 30s 325 Calculating the slope Δ A of the obtained line 1 。
The SOD enzyme activity unit is defined as: the amount of enzyme added when the reaction rate of pyrogallol autoxidation was decreased by 50% was 1U. The SOD enzyme activity in the sample can be calculated according to the following formula:
the expression level of the AaSOD reaches 150mg/L after 12h induction, the purity of the AaSOD obtained by purification by a metal chelate chromatography method is more than 95 percent (shown in figure 2), and the activity of antioxidant enzyme reaches 94.56U/mg (calculated by pyrogallol autoxidation method).
Example 3: enzymatic Properties of AaSOD
AaSOD optimum temperature and temperature resistance
Optimum temperature: the cuvette was heated to 25, 30, 35, 40, 50, 60, 70, 80 ℃ using the pyrogallol method, respectively, and the activity of the sample was measured.
Temperature resistance: the samples were placed in water baths at 60, 70, 80, and 90 ℃ for 1h, respectively, and the remaining activity of the samples was determined using the pyrogallol method, respectively.
Melting curve by DSC: AaSOD samples were dialyzed for 12h against 200mM HEPES, diluted to 1mg/mL, degassed and cooled to 20 ℃. Gradually heating to 110 ℃ by using MicroCal VP-DSC (Marven), taking the solution outside the dialysis bag as a blank to correct a baseline, scanning the AaSOD sample, collecting energy change data at 70-110 ℃ at the speed of 1.5 ℃/min, and calculating the Tm value of the AaSOD according to the data.
AaSOD has the highest antioxidant activity at 35 deg.C (figure 3B), and AaSOD still has more than 90% residual activity after standing at 70 deg.C for 1h, and still has 75% residual activity after standing at 80 deg.C for 1h (figure 3A), and its Tm value is 89.54 deg.C as measured by DSC experiment (figure 4), and the above measured data prove that AaSOD has strong heat resistance.
Acid and alkali resistance of AaSOD
A100. mu.L LAaSoD sample was added with 200. mu.L of buffer solutions of different pH (2-10), allowed to stand at room temperature for 1 hour, and the residual activity of the sample was measured by the pyrogallol method. Different buffers were used for different pH intervals, in order pH 1-2: KCl-HCl, 200 mM; pH 2-5: CH (CH) 3 COONa，200mM；pH 5-7：Na 2 HPO 4 /NaH 2 PO 4 200 mM; pH 7-9: TRIS-HCl, 200 mM; pH 9-10, glycine-NaOH, 200 mM.
AaSOD was left at different pH for 1h, and the residual activity was measured, and the results are shown in FIG. 5A. After standing at pH4.0 for 1h, AaSOD had the highest residual activity than in its storage buffer. The existence environment of alicyclobacillus is 65 ℃, pH is 4.0, SOD as an antioxidant enzyme has the best activity under the physiological condition, therefore, the characteristics of heat resistance and acid resistance of AaSOD prove that the SOD accords with the condition of playing the physiological function.
3. Effect of divalent Metal ions on AaSOD Activity
A100. mu.L sample of AaSOD was taken and different metal ions (MgCl) were added 2 、ZnSO 4 、BaCl 2 、CaCl 2 、CuSO 4 、NiSO 4 、CoCl 2 、MnSO 4 、FeSO 4 ) The sample was left at room temperature for 30min to a final concentration of 1mM, and the SOD activity in the sample was measured by the pyrogallol method. The results are shown in FIG. 5B, in which calcium and zinc ions have strong inhibitory effect on their activities, the inhibitory effect is over 50%, iron and nickel ions have little influence on their activities, and the inhibitory effect of magnesium, calcium, manganese, barium and cobalt ions on their activities is less between 20% and 40%。
4. Effect of active center ions on AaSOD Activity
a. Adding Fe to the culture medium 2+ /Mn 2+ Effect on AaSOD Activity
Respectively adding FeSO with the final concentration of 1mM into the fermentation medium 4 Or MnSO 4 The AaSOD samples were expressed and purified by the method described above, and the activities thereof were measured by the pyrogallol method, respectively.
b.Fe 2+ /Mn 2+ Preparation of recombinant binding proteins
Preparation of apoprotein: AaSOD samples obtained by fermentation using a common LB medium were first dialyzed for 16 hours using a solution (8M urea, 50mM sodium acetate, pH 3.8), and then dialyzed for 4 hours using the following solutions in order: 8M Urea, 50mM sodium acetate, pH 3.8; 8M Urea, 50mM phosphate, pH 7.0; 50mM TRIS-HCl, pH 8.0.
Preparation of the heavy binding protein: the prepared apoproteins were dialyzed sequentially using the following solutions:
8M Urea, 50mM sodium acetate, 10mM FeSO 4 Or MnSO 4 ，pH 3.8；
8M Urea, 50mM phosphate, 10mM FeSO 4 Or MnSO 4 ，pH 7.0；
4M Urea, 50mM phosphate, 10mM FeSO 4 Or MnSO 4 ，pH 7.0；
2M Urea, 50mM phosphate, 10mM FeSO 4 Or MnSO 4 ，pH 7.0；
50mM phosphate, 1mM FeSO 4 Or MnSO 4 ，pH 7.0；
50mM TRIS，0.5mM EDTA，pH 8.0。
The activity of the prepared AaSOD sample is determined by using a pyrogallol method.
TABLE 3 enzymatic Activity of AaSOD cultured in different media and reconstituted with different Metal ions
By comparison of enzyme activity (Table above)3) When additional Fe is added to the medium 2+ /Mn 2+ When the enzyme activity is from high to low, the addition of Mn in the culture medium is more than the addition of Mn + Fe, and the addition of Fe is more than the addition of Fe. The enzyme activity of the method for preparing the recombination protein is Mn & gt Mn + Fe & gt untreated sample & gt Fe & gt apoprotein from high to low. As can be seen from the above rules, AaSOD active center is paired with Fe 2+ And Mn 2+ Without selectivity, the ability of a protein to bind two ions during folding is nearly identical, and what can affect AaSOD binding is the concentration of the two ions in solution. More importantly, the active center is Mn 2+ AaSOD with antioxidant activity of about combined Fe 2+ Ten times of the total weight of the product has important guiding significance for production and application.
It should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples given, it will be apparent to those skilled in the art that modifications and equivalents can be made thereto without departing from the spirit and scope of the invention as set forth in the appended claims.
SEQUENCE LISTING
<110> Shandong university
<120> high-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof
<130>
<160> 4
<170> PatentIn version 3.3
<210> 1
<211> 204
<212> PRT
<213> superoxide dismutase
<400> 1
Met Pro His Gln Leu Pro Pro Leu Pro Tyr Ala Tyr Asp Ala Leu Glu
1 5 10 15
Pro His Ile Asp Ala Ala Thr Met Asn Val His Tyr Asn Gly His His
20 25 30
Ala Ala Tyr Val Asn Asn Leu Asn Lys Ala Leu Glu Gly His Pro Asp
35 40 45
Leu Glu Ser Lys Thr Val Glu Gln Leu Ile Ser Asn Leu Asp Ala Val
50 55 60
Pro Glu Asn Ile Arg Thr Ala Val Arg Asn Asn Gly Gly Gly His Ala
65 70 75 80
Asn His Ser Leu Phe Trp Pro Leu Leu Ser Pro Asn Gly Gly Gly Glu
85 90 95
Pro Thr Gly Lys Leu Ala Asp Ala Ile Arg Glu Thr Phe Gly Ser Phe
100 105 110
Glu Ala Phe Lys Glu Gln Phe Thr Gln Val Ala Thr Ala Arg Phe Gly
115 120 125
Ser Gly Trp Ala Trp Leu Val Leu Asp Asn Gly Lys Leu Ala Leu Met
130 135 140
Ser Thr Ala Asn Gln Asp Asn Pro Leu Met Glu Gly Lys Lys Pro Ile
145 150 155 160
Leu Gly Leu Asp Val Trp Glu His Ala Tyr Tyr Leu Lys Tyr Gln Asn
165 170 175
Arg Arg Pro Glu Tyr Ile Lys Ala Trp Trp Asn Val Val Asn Trp Asp
180 185 190
Gln Ala Asn Lys Asn Tyr Glu Ala Ala Leu Asn Gly
195 200
<210> 2
<211> 615
<212> DNA
<213> superoxide dismutase coding gene
<400> 2
atgccacatc aactcccacc gcttccctac gcgtatgacg cgctggaacc ccacatcgac 60
gcggcgacca tgaacgttca ctacaatggc caccacgcgg cgtacgtcaa caacctgaac 120
aaggcgctcg agggccatcc ggatcttgaa tccaagaccg tggaacagct catcagcaac 180
ctggatgccg ttccggagaa tatccgcacc gcggttcgca acaacggcgg cggtcacgcc 240
aaccacagcc tgttctggcc gctcctttcg ccgaacggcg gcggcgagcc gaccggcaag 300
ctggcggacg ccatccggga gacgttcggt agctttgagg cgttcaagga gcagttcacg 360
caggtcgcca cggctcgctt cggaagcggc tgggcttggc tcgtcctcga caacggcaag 420
ctcgccctga tgagcacggc gaaccaggac aatccgctca tggagggcaa gaagcccatc 480
ctcggcctcg acgtatggga gcacgcgtac tacctcaagt atcaaaaccg ccgtccggaa 540
tacatcaagg cctggtggaa cgtcgtgaac tgggatcagg ccaacaagaa ctacgaggcc 600
gcgctgaacg gctga 615
<210> 3
<211> 27
<212> DNA
<213> Artificial sequence
<400> 3
cgggatccat gccacatcaa ctcccac 27
<210> 4
<211> 29
<212> DNA
<213> Artificial sequence
<400> 4
cccaagcttg ccgttcagcg cggcctcgt 29
Claims (10)
1. The application of superoxide dismutase in preparing biological medicine, feed, food and cosmetics in high temperature and acidic environment;
wherein the amino acid sequence of the superoxide dismutase is shown as SEQ ID NO. 1;
the high-temperature environment is not lower than 65 ℃.
2. The use according to claim 1, wherein the high temperature environment is at a temperature of 75 ℃.
3. The use according to claim 1, wherein the acidic environment is a pH of not more than 7.
4. The use according to claim 3, wherein the pH is from 2 to 6.
5. The use according to claim 4, wherein the pH is 4.
6. The use according to claim 1, wherein the superoxide dismutase is produced by a method comprising producing the superoxide dismutase from a genetically engineered bacterium by genetic recombination.
7. Use according to claim 6, characterized in that the preparation method comprises at least:
synthesizing a nucleotide encoding the superoxide dismutase;
introducing the nucleotide into an expression vector to construct a recombinant expression vector, then introducing the recombinant expression vector into a host for culturing and collecting.
8. The use of claim 7, wherein the expression vector is any one or more of a plasmid, a phage, and an artificial chromosome;
the host includes bacteria and fungi.
9. The use of claim 8, wherein the expression vector is a plasmid;
the host is selected from Escherichia coli, Bacillus subtilis, Saccharomyces cerevisiae, Trichoderma reesei and Penicillium oxalicum.
10. The use of claim 9, wherein the expression vector is a pET-24a plasmid; the host is Escherichia coli BL 21.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011491802.9A CN112522221B (en) | 2020-12-16 | 2020-12-16 | High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011491802.9A CN112522221B (en) | 2020-12-16 | 2020-12-16 | High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112522221A CN112522221A (en) | 2021-03-19 |
| CN112522221B true CN112522221B (en) | 2022-08-09 |
Family
ID=75001101
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011491802.9A Active CN112522221B (en) | 2020-12-16 | 2020-12-16 | High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112522221B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116121214B (en) * | 2022-12-13 | 2023-11-21 | 广州美神生物科技有限公司 | SOD mutant, expression method of recombinant bacillus and application of SOD mutant in preparation of whitening cosmetics |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1874798A1 (en) * | 2005-04-15 | 2008-01-09 | Novo Nordisk A/S | Basic protein purification tags from thermophilic bacteria |
| CN104388401A (en) * | 2014-11-20 | 2015-03-04 | 中国科学院南海海洋研究所 | High-temperature resistant superoxide dismutase and encoding gene and application thereof |
-
2020
- 2020-12-16 CN CN202011491802.9A patent/CN112522221B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112522221A (en) | 2021-03-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kuddus et al. | Expression, purification and characterization of the recombinant cysteine-rich antimicrobial peptide snakin-1 in Pichia pastoris | |
| CN108794635B (en) | Bovine lactoferricin-human lysozyme fusion protein, gene and application thereof | |
| CN109748962B (en) | Acanthopanax migratorius serine protease inhibitor serpin1, and coding gene and application thereof | |
| CN112522221B (en) | High-temperature-resistant acid-resistant superoxide dismutase and preparation method and application thereof | |
| CN113637068A (en) | Recombinant I-type humanized collagen C1L5T, and preparation method and application thereof | |
| Huang et al. | Characterization and expression of HLysG2, a basic goose-type lysozyme from the human eye and testis | |
| Liu et al. | Expression and antibacterial activity of hybrid antimicrobial peptide cecropinA-thanatin in Pichia pastoris | |
| CN110592057B (en) | Chimeric lyase ILTphg and polynucleotides encoding same | |
| CN114015698B (en) | Recombinant lactococcus lactis expressing heat shock protein Hsp70 and preparation method and application thereof | |
| CN108486085B (en) | Yersinia pseudotuberculosis antifungal protein and coding gene and application thereof | |
| CN104962566A (en) | Recombinant bacteriocin and preparation method and application thereof | |
| Campos et al. | A general method of protein purification for recombinant unstructured non-acidic proteins | |
| CN107475222B (en) | Genetically engineered heat-resistant human lysozyme | |
| Neshani et al. | Extended-Spectrum antimicrobial activity of the Low cost produced Tilapia Piscidin 4 (TP4) marine antimicrobial peptide | |
| CN110054684B (en) | Acanthopanax migratorius serine protease inhibitor serpin-5, and coding gene and application thereof | |
| CN110105433B (en) | Lactic acid bacteria antibacterial peptide and application of high-efficiency expression and antibacterial and anticancer activity | |
| CN108864273B (en) | Simulated human-derived antibacterial peptide and preparation method thereof | |
| Naveed et al. | Expression of BSN314 lysozyme genes in Escherichia coli BL21: a study to demonstrate microbicidal and disintegarting potential of the cloned lysozyme | |
| CN104342409B (en) | Recombinate the preparation method of ginseng superoxide dismutase | |
| CN111269296B (en) | nLsA protein, structural gene thereof and application thereof | |
| JP3127298B2 (en) | Methods for isolating and expressing genes encoding streptokinase, resulting nucleotide sequences, recombinant DNA and transformed microorganisms | |
| CN111434693B (en) | Antioxidant fusion protein and application thereof | |
| CN104911155B (en) | Using the heat-resistant of genetic engineering transformation against SOD and its encoding gene and application | |
| CN114990098B (en) | Preparation method and application of lyase, encoding gene, composition and bacteriostatic agent | |
| JP2000175698A (en) | Pyranose oxidase-containing reagent for measuring pyranose |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB03 | Change of inventor or designer information | ||
| CB03 | Change of inventor or designer information |
Inventor after: Yang Chunyu Inventor after: Dong Xueqian Inventor after: Li Shannan Inventor before: Dong Xueqian Inventor before: Yang Chunyu Inventor before: Li Shannan |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |