CN112501351A

CN112501351A - Nipah virus TaqMan probe fluorescent quantitative PCR kit and application thereof

Info

Publication number: CN112501351A
Application number: CN202011382348.3A
Authority: CN
Inventors: 陈鸿军; 孙彤; 孙竹筠; 陆珂; 苏苌; 李娓
Original assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Current assignee: Shanghai Veteromaru Research Institute Caas China Animal Health And Epidemiology Center Shanghan Branch Center
Priority date: 2020-12-01
Filing date: 2020-12-01
Publication date: 2021-03-16
Anticipated expiration: 2040-12-01
Also published as: CN112501351B

Abstract

The invention provides a fluorescent quantitative PCR kit of Nipah virus TaqMan probe and application thereof, wherein the kit comprises the following primers and probe sequences: a forward primer NiV-qF: 5'-TCTCCCAGAGTCTATCAGTAAGG-3'; a reverse primer NiV-qR: 5'-CCATACCAGTTTCCTCGACATAG-3'; the Probe NiV-Probe is FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ 1. The invention also provides a method for detecting Nipah virus by using the reagent and the in vitro fluorescence PCR, which can quickly and accurately detect the Nipah virus. The fluorescent PCR detection method for the Nipah virus, which is established by the invention, has the advantages of simple and convenient operation, high efficiency, rapidness and specificity; the method is established, the detection of the sample can be completed only about 2 hours, the sensitivity can reach 14.8 copies/mu L, and the blank of detecting the Nipah virus in China is filled.

Description

Nipah virus TaqMan probe fluorescent quantitative PCR kit and application thereof

Technical Field

The invention belongs to the field of biological detection, and particularly relates to a TaqMan probe fluorescent quantitative PCR (qPCR) detection kit established by taking a Nipah virus (NiV) N gene as a target and aiming at Nipah virus cDNA and application thereof.

Background

Nipah virus (NiV) is a enveloped mononegavirale RNA virus, paramyxoviridae, Henry virus, has the characteristics of wide host range and high lethality, is found in Malaysia for the first time in 1998, Nipah virus infection is a natural epidemic disease which is co-infected with human and animals, is outbreaked in Singapore, Malaysia, India and other countries, causes huge economic loss to the pig industry, and is listed as a limited disease list causing serious threat to public health by the world health organization in 2018. The current worldwide outbreak of nipah virus infection, which is derived from the same strain of virus, evolved during transmission due to genetic variation: malaysia strain and Mengla strain Niv-Malaysia (Niv-M) NiV-Bangladesh (NiV-BD). Niv Bengal strain caused more severe pathological changes in organs than Malaysia strain, with a higher mortality rate than Malaysia strain, but only one serotype. The virus safety level is the pathogen of a biological safety level four laboratory (BSL-4), and a common laboratory does not have the virus separation and identification conditions. The Nipah virus can cause serious nervous encephalitis or respiratory diseases of various animals such as human, pig, horse, cat and dog, and the death rate reaches 40-70% if the human is infected with the Nipah virus and cannot be treated symptomatically. Pigs infected with nipah virus exhibit rapid respiration, develop dyspnea and are associated with involuntary cough.

Studies have shown that Fruit bats (Fruit bats) are the natural host of Nipah virus, whose transmission can cross species barriers, infect humans and other mammals by way of viral extravasation, mainly through food-borne pathways and intermediate host infections, and are the main mediator organisms causing human and porcine Nipah virus infections; in addition, pigs eat the residual toxic fruits which are eaten by the fruit bats to cause infection, and people also have infection after contacting the pigs. The infection of nipah virus, which had been outbreaked in singapore, malaysia, caused the patient to have an overly intimate contact with the pig, mainly some workers and slaughterhouse workers working in the pig farm, indicating that pigs are an important intermediate host in the viral transmission pathway, and that in addition, building the pig farm at the border of the bat habitat could also directly lead to the transmission of the virus into the herd. Currently, there are two modes of transmission of nipah virus: the virus is transmitted to pig from wild animals such as Hepialus putrescentiae, and then transmitted to human (Malaysia type); or wild animals are directly transmitted to humans by the moral route (menglara). In addition, investigations have shown that since the range of motion of fruit bats is mainly focused on Plumbum preparatium, Wenlai, India, Indonesia, Laos, Magaska, Myanmar, Nepal, Philippine, Babuya Newcastle, Thailand, Vietnam including China, these countries have no epidemic of Nipah virus, but have found that Nipah virus exists in fruit bats in these areas. Therefore, the countries are still countries with great infection risk, China is a big pig-raising country, and borders countries such as India and Bengal who have been infected by Nipah virus, and since fruit bat distribution exists in south China and islands in the southeast east coast, Nipah virus is likely to be transferred into China through bat, so that prevention and control of the Nipah virus are of great importance.

It is difficult to determine the diagnosis according to epidemiology, clinical symptoms and pathological changes. The frequently encountered diseases of people contacting with sick pigs are mainly encephalitis symptoms, and pathological changes are mainly syncytial formed by vasculitis and vascular endothelial cells, so that the pathological changes can be used as reference basis for diagnosis. Laboratory examinations showed lymphopenia, thrombocytopenia, low blood sodium, and elevated aspartate aminotransferase in liver tissue. The currently used diagnostic methods mainly include: (1) separating, culturing and identifying viruses; (2) detecting the Nipah virus by using a specific antibody and a transmission electron microscope; (3) nuclear magnetic resonance is an effective method for diagnosing sensitivity to Nipah encephalitis; (4) extracting virus genome from the pathological material, and carrying out RT-PCR detection; (5) performing tissue localization of the virus by an immunohistochemical method; (6) restriction nucleic acid sequence analysis was performed on viral genes. At present, effective prevention and treatment measures aiming at the Nipah virus still do not exist, and a specific detection method is established for monitoring and early warning in order to prevent the transmission and infection of the Nipah virus. The biological safety level of the Nipah virus is four grades, the Nipah virus needs to be isolated and cultured in a P4 laboratory, most laboratories do not have the condition, and the fluorescent quantitative PCR is suitable for separating live virus without the need of separating the live virusThe detection of the Nipah virus and other viruses with high biological safety level is not easy to cause biological safety accidents, and is simple, rapid and sensitive. At present, fluorescence RT-PCR and multiplex fluorescence RT-PCR detection of Nipah virus mainly aim at detection of M gene, and N gene is encoding Nipah virus nucleocapsid protein gene, has high conservative property and is suitable for detection of Nipah virus. However, the detection sensitivity of the existing report for detecting the N gene is not clear, the preparation of a reaction system is complex, the reaction system is further optimized by the fluorescent PCR detection method for the N gene cDNA of the Nipah virus developed by the research, and the PCR reaction can be carried out only by adding the reaction premix solution containing the primer probe into the reaction tube and then adding 1 mu L of sample nucleic acid cDNA template, so that the operation time is greatly shortened, and the cross contamination among samples is reduced. The detection method has high sensitivity, and can detect the order of magnitude of 10¹Sample nucleic acid concentration of copies/uL. The total detection time (including nucleic acid extraction) can be completed within 2 h. Compared with the conventional dye method, the fluorescent probe in the fluorescent PCR method has high specificity, does not need dissolution curve analysis after the reaction is finished, and is not easy to generate nonspecific combination. The method can also be used as a simple, convenient, accurate, sensitive and rapid method for verifying and confirming the detection result after the primary screening and identification of the pathogen with the symptoms similar to the Nipah virus.

Disclosure of Invention

The invention aims to provide a fluorescent quantitative PCR detection reagent for Nipah virus, which is designed and synthesized by utilizing an N gene sequence of the Nipah virus.

The reagent comprises specific primers and probes, wherein the reagent comprises a section which has no secondary structure and is highly conserved according to an N (nucleocapsid protein) gene (ID: AJ 627196.1) sequence of Nipah virus, a pair of specific primers and a probe are designed by combining software, primer homology search is carried out by a blast tool on NCBI, 2 pairs of primers and probes are preliminarily screened at 774-905 bp positions, the annealing temperature of the 2 pairs of primers is about 55 ℃, the GC content is 47.8-50%, and the sequences are as follows:

forward primer 1: NiV-qF-1: 5'-TCTCCCAGAGTCTATCAGTAAGG-3' (SEQ ID No. 1)

Reverse primer 1: NiV-qR-1: 5'-CCATACCAGTTTCCTCGACATAG-3' (SEQ ID No. 2)

1, probe 1: NiV-Probe-1 FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ1 (SEQ ID No. 3);

forward primer 2: NiV-qF-2: 5'-GCTAAAGGCAGAGCAGTAGAA-3'

Reverse primer 2: NiV-qR-2: 5'-CTTGTCTCCAACCCGAATCT-3'

And (3) probe: NiV-Probe-2: FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ1

As shown in FIG. 6, the sensitivity of primer 1 is higher than that of primer 2, and the best primers after screening are:

forward primer 1: NiV-qF-1: 5'-TCTCCCAGAGTCTATCAGTAAGG-3' (SEQ ID No. 1)

Reverse primer 1: NiV-qR-1: 5'-CCATACCAGTTTCCTCGACATAG-3' (SEQ ID No. 2)

And (3) probe: NiV-Probe-1 FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ1 (SEQ ID No. 3);

further, the reagent also comprises a positive quality control product, a negative quality control product and a fluorescent quantitative detection reagent which are required by detection;

further, the concentration of the primer and the concentration of the probe are both 5-15 mu M, preferably 10 mu M;

further, the negative quality control material is sterile virus-free nuclease-free double distilled water, and the positive quality control material is 10⁴copies/. mu.L of plasmid containing the fragment of interest.

Furthermore, the invention provides a method for detecting the Nipah virus by using the reagent, which can quickly and accurately detect the Nipah virus. The detection comprises in vivo detection and in vitro detection. In vivo assays include, but are not limited to: detecting biological samples such as blood, digestive juice, tissues and the like; in vitro assays include, but are not limited to: quality detection in biological products such as water samples, foods, feeds and the like.

The reaction system of the method is as follows:

2×AceQ U⁺ probe Master Mix 10. mu.L, upstream/downstream primers (NiV-qF/NiV-qR, 10. mu.M) each 1.6. mu.L, Probe (NiV-Probe, 10. mu.M) 1. mu.L, and templatePlate 1. mu. L, ddH₂O make up to 20. mu.L. The optimized qPCR reaction conditions are as follows: at 37 ℃ for 2 min; 95 ℃ for 5 min; at 95 ℃, 10s, 64 ℃, 30s, 40 cycles;

the method comprises the following steps:

respectively placing 1 mu L of negative control, positive control and sample to be detected in the reaction system for reaction, mixing uniformly, and placing in a fluorescent quantitative PCR instrument, wherein the negative control adopts sterilized double distilled water; detecting by using the PCR parameters;

the result judgment adopts the following mode:

observing a real-time fluorescence curve on a fluorescence quantitative PCR instrument to generate an amplification curve, wherein if the cycle threshold Ct is less than or equal to 35, Nipah virus is contained, and the result is positive; if the amplification curve does not appear, the Nipah virus does not exist, or the Ct value is larger than 35, the result is negative; if the Ct value is larger than 35, but still has a typical amplification curve and good repeatability, the sample to be detected is concentrated and then reacts according to the reaction system, and the judgment is carried out according to the method.

Advantageous effects

In the detection method for Nipah virus cDNA established in the research, a pair of primers and probes for an N (nucleocapsid protein) gene sequence are designed in a Nipah virus complete gene sequence published on NCBI, and the region has high conservative degree and is not easy to generate mutation. Compared with the conventional RT-PCR, the method has the advantages of rapidness, specificity, sensitivity, quantifiability, simultaneous detection of a large number of samples and the like.

The standard curve equation of the fluorescence PCR method established by the invention is as follows: y = -3.27 xX +38.673 correlation coefficient R²=0.996, amplification efficiency Eff (%) =102.196, logarithm of nucleic acid copy number and Ct value of reaction show good linear relation, can amplify minimum copy number to 10¹An amount of nucleic acid of the order of magnitude of (2), when the copy number is 10⁹-10²In order of magnitude, the Ct value is less than 35, which is the optimal detection concentration range of the detection method, and when the copy number is 10¹On the order of magnitude, Ct values > 35, but still have typical amplification curves and good reproducibility. The sensitivity of the fluorescence PCR is 10 times higher than that of the common PCR. The specificity of the primer and the probe is strong, and the primer and the probe cannot be amplifiedThe method is particularly suitable for detecting large-batch samples which have long storage time and can not separate viruses, and can be carried out in a biological safety II-level laboratory.

The method can successfully amplify target products from simulation samples with different dilutions, and 10-fold gradient dilution is carried out after plasmids with the copy number of 109 orders of magnitude are mixed with serum, and 10 can be detected by fluorescence PCR^-5Dilutions of the mock sample were of nipah virus. The coefficient of variation CV of the method is less than 2 percent, which shows that the repeatability and the stability are good. The method has the characteristics of high accuracy, strong sensitivity and good specificity, and can meet the requirements of qualitative and quantitative detection of the Nipah virus in an unknown sample.

Drawings

FIG. 1 qPCR Standard Curve Generation

FIG. 2 TaqMan probe qPCR amplification curve

FIG. 3 NiV qPCR specificity assay

FIG. 4 simulation of NiV qPCR amplification results in samples

FIG. 5 NiV conventional PCR amplification results, wherein M: 1-6 parts of DL 2000 DNA Marker: 10⁰~10^-6Diluting multiple NiV cDNA template; 7. blank control

FIG. 6 Nipah virus TaqMan sensitivity test for primers and probes, wherein A is primer probe set 1; b: primer Probe set 2

Detailed Description

Example 1 establishment of qPCR reaction System

Downloading an N (nucleocapsid protein) gene (ID: AJ 627196.1) sequence of Nipah virus from GenBank, designing a specific primer NiV-qF: 5'-TCTCCCAGAGTCTATCAGTAAGG-3' (SEQ ID No. 1), NiV-qR: 5'-CCATACCAGTTTCCTCGACATAG-3' (SEQ ID No. 2) and a Probe NiV-Probe: FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ1 (SEQ ID No. 3) at 774-905 bp, wherein a target fragment is 132 bp; a recombinant plasmid with the vector pUC57 was synthesized, the concentration was calculated according to the molecular weight and converted to copies/. mu.L, and the template with the calculated copy number was diluted in 10-fold gradient to prepare a standard. The primers, probes and plasmids were synthesized by Shanghai Bioengineering Co., Ltd.

Table 1: primer and probe sequences

AceQ U Per Novozam⁺Probe Master Mix instructions TaqMan qPCR reaction System test reactions: 2 × AceQ U⁺ Probe Master Mix 10. mu.L, NiV-qF (10. mu.M): 0.4. mu.L, NiV-qR (10. mu.M): 0.4. mu.L, NiV-Probe (10. mu.M): 0.2. mu.L, and then 10. mu.L ⁴1 μ L of plasmid copies/. mu.L as template, ddH₂Make up to 20. mu.L of O. The reaction conditions are 37 ℃ and 2 min; 95 ℃ for 5 min; 95 ℃, 10s, 60 ℃, 30s, 40 cycles. The annealing temperature of qPCR reaction is optimized, and gradient annealing temperatures of 52 ℃, 54 ℃, 56 ℃, 58 ℃, 60 ℃, 62 ℃ and 64 ℃ are set. The optimal real-time fluorescent quantitative PCR reaction system component proportion is established by adjusting the primer concentration (0.1-1 mu M) and the probe concentration (0.1-0.5 mu M).

As shown in Table 2, the optimized TaqMan qPCR reaction system is as follows: 2 × AceQ U⁺ Probe Master Mix 10. mu.L, upstream/downstream primers (NiV-qF/NiV-qR, 10. mu.M) each 1.6. mu.L, Probe (NiV-Probe, 10. mu.M) 1. mu.L, template 1. mu. L, ddH₂O make up to 20. mu.L. As shown in table 3, the optimized qPCR reaction conditions were: at 37 ℃ for 2 min; 95 ℃ for 5 min; 95 ℃, 10s, 64 ℃, 30s, 40 cycles. The system and conditions are the optimal detection conditions for the NiV cDNA.

TABLE 2 Ct values at different annealing temperatures

TABLE 3 Ct values at different probe and primer concentrations

The total length of the NiV recombinant plasmid is 4299bp, and the concentration of the detected plasmid is 7 ng/mu L; calculating the copy number of the standard product to be 6.02 according to a formula×10²³ copies/ mol×（7 ng/μL ×10^-9）/ (4299 ×660 g/mol)=1.48×10⁹copies/. mu.L. By ddH₂O10-fold gradient dilution to 1.48X 10¹copies/. mu.L. Taking 1 μ L of diluted standard plasmid as template, amplifying according to optimized qPCR condition, the standard curve is shown in FIG. 1: y = -3.27 XX +38.673 (R)²= 0.996). The amplification efficiency is 102% in the interval of 90% -120%, and the logarithm values and Ct values of different concentration gradient template amounts show good linear relation, which indicates that the qPCR reaction has good amplification efficiency.

Example 2 sensitivity testing of the qPCR reaction System

Carrying out gradient dilution on NiV plasmid according to 10 times of series, carrying out qPCR test according to optimized reaction conditions, and detecting sensitivity; triplicate for each concentration gradient, standard curves were drawn with the resulting Ct values and the reproducibility of the Coefficient of Variation (CV) evaluation method was calculated. The total length of the NiV recombinant plasmid is 4299bp, and the concentration of the detected plasmid is 7 ng/mu L; calculating the copy number of the standard product to be 6.02 multiplied by 10 according to a formula²³ copies/ mol×（7 ng/μL ×10^-9）/ (4299 ×660 g/mol)=1.48×10⁹copies/. mu.L. By ddH₂O10-fold gradient dilution to 1.48X 10¹copies/. mu.L. Taking 1 μ L of diluted standard plasmid as template, amplifying according to optimized qPCR condition, the standard curve is shown in FIG. 1: y = -3.27 XX +38.673 (R)²= 0.996). The amplification efficiency is 102% in the interval of 90% -120%, and the logarithm values and Ct values of different concentration gradient template amounts show good linear relation, which indicates that the qPCR reaction has good amplification efficiency.

Example 3 specific detection of the qPCR reaction System

For common infectious agents DNA or cDNA include: qPCR detection is performed on African Swine Fever Virus (ASFV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), Classical Swine Fever Virus (CSFV), porcine pseudorabies virus (PRV), Porcine Epidemic Diarrhea (PED) and the like to evaluate the specificity of the method.

Different copy number of standard (1.48X 10)⁹~1.48×10⁰copies/. mu.L) was repeated 3 times, and the results of the assay were comparedStatistical analysis was performed to test the reproducibility of the method. The results are shown in Table 4, where the coefficient of variation (CV; ratio of standard deviation to mean) is less than 2%, indicating that the established method is highly reproducible and results are stable. As shown in Table 4 and FIG. 2, the lowest NiV plasmid concentration detectable by the established qPCR detection method for the N gene is 14.8 copies/. mu.L. At present, the fluorescent RT-PCR detection aiming at M gene can detect the concentration of 46 copies/muL (patent number: CN 102559935A) at the lowest, the fluorescent RT-PCR detection aiming at G protein gene can detect 29.32 copies/muL (patent number: CN 105567870A), the sensitivity of the detection is higher than that of the existing detection method, and the detection has practical clinical diagnosis value.

TABLE 4 precision and repeatability of qPCR reactions

Table 4 Accuracy and repeatability of qPCR reaction

As can be seen from fig. 3: african Swine Fever Virus (ASFV), Porcine Reproductive and Respiratory Syndrome Virus (PRRSV), swine fever virus (CSFV), porcine pseudorabies virus (PRV), Porcine Epidemic Diarrhea (PED) and sterile water are all negative, and only NiV generates a fluorescence report signal, which indicates that the detection method has better specificity.

Example 4 clinical assay comparative test

The copy number is 1.48X 10⁹NiV plasmid in copies/μ L was diluted in a 10-fold gradient of healthy pig serum, mimicking the status of nipavirus in pig blood. And (3) taking 200 mu L of virus after gradient dilution, extracting DNA by using a TIANAmp virus genome extraction kit, and taking 1 mu L of virus as a cDNA template to perform a real-time fluorescence quantitative PCR test. DNA was extracted from 200. mu.L of serum diluted in multiple proportions and detected by conventional PCR and qPCR, respectively. As shown in Table 5, a dilution of 10 was detectable by qPCR^-5The concentration of the sample is simulated, but the repeatability is reduced, the Ct value is 37.8 and is more than 35, and a remarkable amplification curve still exists as shown in FIG. 4. The dilution 10 can be detected by conventional PCR^-4The results show that qPCR detection, as shown in FIG. 5The sensitivity is 10 times higher than that of the conventional PCR. In patent CN 105567870A, the established fluorescent quantitative RT-PCR detection method has higher sensitivity and specificity, but does not mention the repeatability and stability of the method. Therefore, the invention establishes a rapid, simple, strong-specificity and high-sensitivity fluorescent quantitative PCR detection system, can rapidly, accurately, specifically, safely and simply detect the Nipah virus from the detected sample within 2 hours, can be used for detecting trace Nipah virus in biological blood, muscle and organ tissue samples, and can also be used for judging the pollution condition in biological products such as water samples, foods, feeds and the like.

TABLE 5 NiV cDNA as template sensitivity test

Table 5. Sensitivity test using NiV cDNA as template

In summary, the disclosure of the present invention is not limited to the above-mentioned embodiments, and persons skilled in the art can easily set forth other embodiments within the technical teaching of the present invention, but such embodiments are included in the scope of the present invention.

Sequence listing

<110> Shanghai animal doctor institute of Chinese academy of agricultural sciences (Shanghai center of Chinese centers of animal health and epidemiology)

Fluorescent quantitative PCR kit for <120> Nipah virus TaqMan probe and application thereof

〈130〉

〈160〉3

〈170〉PatentInversion3.3

〈210〉1

〈211〉23

〈212〉DNA

Forward primer NiV-qF of < 213 >

〈400〉1

TCTCCCAGAGTCTATCAGTAAGG

〈210〉2

〈211〉23

〈212〉DNA

(213) reverse primer NiV-qR

〈400〉2

CCATACCAGTTTCCTCGACATAG

〈210〉3

〈211〉24

〈212〉DNA

NiV-Probe with & lt 213 & gt Probe

〈400〉3

FAM-5’- AGGATCTGCTAAAGGCAGAGCAGT-3’-BHQ1

Fluorescent quantitative PCR (polymerase chain reaction) kit for <120> Nipah virus TaqMan probe and application of fluorescent quantitative PCR kit

<160> 0

<170> SIPOSequenceListing 1.0

Claims

1. A fluorescent quantitative PCR kit of Nipah virus TaqMan probe is characterized in that the kit comprises a specific primer and a probe, and the sequence of the kit is as follows:

forward primer NiV-qF: 5'-TCTCCCAGAGTCTATCAGTAAGG-3' (SEQ ID No. 1)

Reverse primer NiV-qR: 5'-CCATACCAGTTTCCTCGACATAG-3' (SEQ ID No. 2)

Probe NiV-Probe FAM-5'-AGGATCTGCTAAAGGCAGAGCAGT-3' -BHQ1 (SEQ ID No. 3).

2. The fluorescent quantitative PCR kit of Nipah virus TaqMan probe of claim 1, which comprises the combination of the primer and the probe of claim 1, and further comprises a positive quality control substance, a negative quality control substance and a fluorescent quantitative detection reagent required by the detection of the kit.

3. The fluorescent quantitative PCR kit of Nipah virus TaqMan probe according to claim 2, wherein the concentration of the primer and the concentration of the probe are both 5-15 μ M, preferably 10 μ M.

4. The fluorescent quantitative PCR kit of Nipah virus TaqMan probe according to claim 2, wherein the negative quality control substance is physiologicalSaline water, positive quality control product is 10⁴copies/. mu.L of positive plasmid.

5. The kit according to claim 2, wherein the optimal reaction system of the kit is: 2 × AceQ U⁺Probe Master Mix 10. mu.l, 10. mu.M forward primer and reverse primer 1.6. mu.l each, 10. mu.M Probe 1. mu.l, ddH₂O4.8. mu.l, template 1. mu.l.

6. The kit according to claim 2, wherein the optimal reaction conditions of the kit are: at 37 ℃ for 2 min; 95 ℃ for 5 min; 95 ℃, 10s, 64 ℃, 30s, 40 cycles.

7. A method for detecting nipah virus using fluorescent quantitative PCR, comprising the steps of:

1) respectively placing 1 mu L of negative control, positive control and sample to be detected in a reaction system for reaction, mixing uniformly, and placing in a fluorescent quantitative PCR instrument, wherein the negative control adopts sterilized double distilled water;

2) and (5) judging a result: observing a real-time fluorescence curve on a fluorescence quantitative PCR instrument to generate an amplification curve, wherein if the cycle threshold Ct is less than or equal to 35, Nipah virus is contained, and the result is positive; if the amplification curve does not appear, the Nipah virus does not exist, or the Ct value is larger than 35, the result is negative; if the Ct value is more than 35 and an amplification curve appears, concentrating the sample to be detected, then reacting according to the reaction system, and judging according to the method.

8. The method for detecting Nipah virus by using fluorescent quantitative PCR as claimed in claim 7, wherein the reaction system adopts the fluorescent quantitative PCR kit of Nipah virus TaqMan probe as claimed in any one of claims 1 to 6.

9. The method for detecting nipah virus using fluorescent quantitative PCR as claimed in claim 8, wherein the lowest NiV plasmid concentration detectable by the method is 14.8 copies/μ L.

10. Use of the fluorescent quantitative PCR kit of Nipah virus TaqMan probe according to any one of claims 1 to 6 for rapid and accurate detection of Nipah virus, said detection comprising in vivo detection and in vitro detection. In vivo assays include, but are not limited to: detecting biological samples such as blood, digestive juice, tissues and the like; in vitro assays include, but are not limited to: quality detection in biological products such as water samples, foods, feeds and the like.