CN112501309A - Identification method of Rugao yellow chicken - Google Patents
Identification method of Rugao yellow chicken Download PDFInfo
- Publication number
- CN112501309A CN112501309A CN202011417130.7A CN202011417130A CN112501309A CN 112501309 A CN112501309 A CN 112501309A CN 202011417130 A CN202011417130 A CN 202011417130A CN 112501309 A CN112501309 A CN 112501309A
- Authority
- CN
- China
- Prior art keywords
- gene
- chromosome
- detecting
- yellow chicken
- genotype
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 241000287828 Gallus gallus Species 0.000 title claims abstract description 99
- 238000000034 method Methods 0.000 title claims abstract description 28
- 235000013330 chicken meat Nutrition 0.000 claims description 97
- 210000000349 chromosome Anatomy 0.000 claims description 57
- 108020004414 DNA Proteins 0.000 claims description 42
- 239000003550 marker Substances 0.000 claims description 42
- 102000053602 DNA Human genes 0.000 claims description 40
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 40
- 101100368725 Bacillus subtilis (strain 168) tagF gene Proteins 0.000 claims description 9
- 101100545272 Caenorhabditis elegans zif-1 gene Proteins 0.000 claims description 9
- 108090000623 proteins and genes Proteins 0.000 claims description 8
- 101000867860 Homo sapiens Carbonic anhydrase 13 Proteins 0.000 claims description 5
- 230000002068 genetic effect Effects 0.000 claims description 5
- 108020005345 3' Untranslated Regions Proteins 0.000 claims description 4
- 101100428022 Arabidopsis thaliana UTR3 gene Proteins 0.000 claims description 4
- 101150089281 CINP gene Proteins 0.000 claims description 4
- 101000942095 Homo sapiens Cysteine-rich motor neuron 1 protein Proteins 0.000 claims description 4
- 101100288053 Homo sapiens KIF13A gene Proteins 0.000 claims description 4
- 101001069757 Homo sapiens Prospero homeobox protein 2 Proteins 0.000 claims description 4
- 101000628529 Homo sapiens Sulfotransferase 6B1 Proteins 0.000 claims description 4
- 101150105945 KIF13A gene Proteins 0.000 claims description 4
- 108091026898 Leader sequence (mRNA) Proteins 0.000 claims description 4
- 101150114032 PRRC1 gene Proteins 0.000 claims description 4
- 102100033878 Prospero homeobox protein 2 Human genes 0.000 claims description 4
- 108091006972 SLC35F3 Proteins 0.000 claims description 4
- 108091006657 SLC9A6 Proteins 0.000 claims description 4
- 101100453133 Saccharomyces cerevisiae (strain ATCC 204508 / S288c) ISY1 gene Proteins 0.000 claims description 4
- 101150070069 TNNI3K gene Proteins 0.000 claims description 4
- 101150039504 6 gene Proteins 0.000 claims description 3
- 108010072135 Cell Adhesion Molecule-1 Proteins 0.000 claims description 3
- 101000713904 Homo sapiens Activated RNA polymerase II transcriptional coactivator p15 Proteins 0.000 claims description 3
- 101000867036 Homo sapiens High mobility group protein 20A Proteins 0.000 claims description 3
- 101000981680 Homo sapiens Leucine-rich repeat and immunoglobulin-like domain-containing nogo receptor-interacting protein 1 Proteins 0.000 claims description 3
- 101000759172 Homo sapiens Zinc finger RNA-binding protein 2 Proteins 0.000 claims description 3
- 101150053662 THOP1 gene Proteins 0.000 claims description 3
- 235000020338 yellow tea Nutrition 0.000 abstract description 8
- 244000144977 poultry Species 0.000 abstract description 2
- 238000001514 detection method Methods 0.000 description 5
- 238000000137 annealing Methods 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 235000013601 eggs Nutrition 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 2
- 230000003321 amplification Effects 0.000 description 2
- 238000004925 denaturation Methods 0.000 description 2
- 230000036425 denaturation Effects 0.000 description 2
- 239000012634 fragment Substances 0.000 description 2
- 235000013372 meat Nutrition 0.000 description 2
- 238000012986 modification Methods 0.000 description 2
- 230000004048 modification Effects 0.000 description 2
- 238000003199 nucleic acid amplification method Methods 0.000 description 2
- 238000006467 substitution reaction Methods 0.000 description 2
- 229920000936 Agarose Polymers 0.000 description 1
- 244000025254 Cannabis sativa Species 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 101000748856 Homo sapiens Coronin-1C Proteins 0.000 description 1
- 101001024703 Homo sapiens Nck-associated protein 5 Proteins 0.000 description 1
- 101000603239 Homo sapiens Neuroligin-1 Proteins 0.000 description 1
- 101000997283 Homo sapiens Potassium voltage-gated channel subfamily C member 1 Proteins 0.000 description 1
- 101001076728 Homo sapiens RNA-binding protein 34 Proteins 0.000 description 1
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 238000005251 capillar electrophoresis Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 238000001962 electrophoresis Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000003205 genotyping method Methods 0.000 description 1
- 244000144972 livestock Species 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013594 poultry meat Nutrition 0.000 description 1
- 238000012797 qualification Methods 0.000 description 1
- 238000012216 screening Methods 0.000 description 1
- 238000012163 sequencing technique Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for identifying a poultry variety, in particular to a method for identifying Rugao yellow chicken. The method disclosed by the invention is used for identifying based on the Rugao yellow-tea specific INDEL locus and the specific SNP locus, the specific loci have high Rugao yellow-tea identification rate, and the identification is carried out based on one or more specific loci, so that the accuracy is high, and the result is more reliable.
Description
Technical Field
The invention relates to a method for identifying a poultry variety, in particular to a method for identifying Rugao yellow chicken.
Background
Rugao yellow chicken is named after the place of birth, and the central region of birth is in the Satsu Rugao market. The chicken is a geographical mark product of agricultural products in China, and is listed as a national-grade livestock genetic resource in 2009. Rugao yellow chicken belongs to local chicken breeds with meat and eggs, and both meat and eggs are superior and are mainly used for producing grass eggs and high-quality chicken. Since the 70's of the 20 th century, Rugao yellow chickens have been introduced and raised by more than 60 places and counties in more than 20 provinces and cities in China, such as Jiangsu, Zhejiang, Shanghai, Anhui, Fujian, Jiangxi, Hunan, Hubei, Hongkao and Australia, and have responded well. In the process of popularization, the phenomenon that the hybrid or the similar variety of appearance is adopted to serve as the Rugao yellow chicken often occurs.
However, no method for effectively identifying Rugao yellow chicken varieties exists at present.
Disclosure of Invention
The invention mainly aims to provide a Rugao yellow chicken identification method, which is based on Rugao yellow chicken specific INDEL loci and specific SNP loci for identification, wherein the specific loci have high Rugao yellow chicken identification rate, and are based on one or more specific loci for identification, so that the accuracy is high and the result is more reliable.
In order to achieve the purpose, the invention adopts the following technical scheme:
a method for identifying Rugao yellow chicken comprises the following specific INDEL loci:
RG _ tag2 is located at chromosome 2 122672840, between gene CA13 and gene CA3A, and the Rugao yellow chicken genotype is inserted with a sequence: ATTT// ATTT.
Further, the method also comprises the step of identifying any one or more specific SNP sites:
RG _ tag1 is located at chromosome 2 60449199, the 2 nd intron of KIF13A gene, and the genotype of Rugao yellow chicken is CC;
RG _ tag3 is located at chromosome 3 33169622, between gene CRIM1 and gene SULT6B1, and the genotype of Rugao yellow chicken is AA;
RG _ tag4 is located at chromosome 3 38660504, the 2 nd intron of SLC35F3 gene, and the genotype of Rugao yellow chicken is GG;
the RG _ tag5 is located on chromosome 4 4196467, the 5 'UTR region of the gene FHL1 and the 3' UTR region of the gene SLC9A6, and the Rugao yellow chicken genotype is GG;
RG _ tag6 is located at chromosome 5 38292725, and the gene UTR3 region of PROX2 has a Rugao yellow chicken genotype of TT;
RG _ tag7 is located at chromosome 49784217 No. 5, the 2 nd intron of CINP gene is CC of Rugao yellow chicken genotype;
RG _ tag8 is located at chromosome 29949231 No. 8, the 3 rd intron of TNNI3K gene is CC of Rugao yellow chicken genotype;
RG _ tag9 is located at chromosome 3397646 No. 10, between gene LINGO1 and gene HMG20A, and the Rugao yellow chicken genotype is GG;
RG _ tag10 is located at chromosome 4938416 No. 24, between gene CADM1 and gene LOC770165, and the Rugao yellow chicken genotype is GG;
RG _ tag11 is located at chromosome 3340013 No. 28, the 2 nd intron of THOP1 gene has a genotype of CC for Rugao yellow chicken;
RG _ tag12 is located at chromosome 9794706 of Z, between gene ZFR2 and gene SUB1, and the Rugao yellow chicken genotype is TT;
RG _ tag13 is located at chromosome 19199901, the 12 th intron of ZSQIM 6 gene, the genotype of Rugao yellow chicken is AA;
RG _ tag14 is located on chromosome 56669873 of Z, and the 2 nd intron of PRRC1 gene has the genotype of Rugao yellow chicken TT.
Further, primers RG _ P2f and RG _ P2r used for detecting the RG _ tag2 site:
RG_P2f：GAACTCCTCCATCCTCCT；
RG_P2r：AGCAGAATCCAGCACATC。
further, the following specific SNP sites were identified: RG _ tag1, RG _ tag3, RG _ tag4, RG _ tag5, RG _ tag6, RG _ tag7, RG _ tag8, RG _ tag 14.
Further, primers for detecting the following specific SNP sites are as follows:
the primers used for detecting the marker RG _ tag1 are two single-stranded DNAs shown as RG _ P1f and RG _ P1 r:
RG_P1f：CTGCTATATTCCTTGCTTGTG；
RG_P1r：ATGGTCTTACTGTACTTCTGAG；
the primers used for detecting the marker RG _ tag3 are two single-stranded DNAs shown as RG _ P3f and RG _ P3 r:
RG_P3f：CAGAGCCTACAGAGTTAGAG；
RG_P3r：CAAGGTGGAGGATGACATT；
the primers used for detecting the marker RG _ tag4 are two single-stranded DNAs shown as RG _ P4f and RG _ P4 r:
RG_P4f：TGGTGTCACTTGGTTAGC；
RG_P4r：GGTCGCATTATACTTCCTATG；
the primers used for detecting the marker RG _ tag5 are two single-stranded DNAs shown as RG _ P5f and RG _ P5 r:
RG_P5f：CAGTCACGGCTCAATTAGTA；
RG_P5r：ACGACAACTCAATTCACAGA；
the primers used for detecting the marker RG _ tag6 are two single-stranded DNAs shown as RG _ P6f and RG _ P6 r:
RG_P6f：GACGCAATGGAGACAGAG；
RG_P6r：TATAGACAGACCGCAGAGA；
the primers used for detecting the marker RG _ tag7 are two single-stranded DNAs shown as RG _ P7f and RG _ P7 r:
RG_P7f：TGGCACAACTTGATGATGA；
RG_P7r：CACTGTTATACCTTCTTCTGTC；
the primers used for detecting the marker RG _ tag8 are two single-stranded DNAs shown as RG _ P8f and RG _ P8 r:
RG_P8f：GATCAGTTGGCTGTTCAC；
RG_P8r：CATTACCGTGCTTGACTTAT；
the primers used for detecting the marker RG _ tag9 are two single-stranded DNAs shown as RG _ P9f and RG _ P9 r:
RG_P9f：AGTCTGCTGAGTGCTGTA；
RG_P9r：AGGAATGCTGTCATCTGAAT；
the primers used for detecting the marker RG _ tag10 are two single-stranded DNAs shown as RG _ P10f and RG _ P10 r:
RG_P10f：ATGGATGGCGAAGAGGTA；
RG_P10r：GGTATGAGGCTGTAATGGTA；
the primers used for detecting the marker RG _ tag11 are two single-stranded DNAs shown as RG _ P11f and RG _ P11 r:
RG_P11f：CAGTGGTAGCAAGGAATGT；
RG_P11r：AGCAGGTCTGTGTTAAGTG；
the primers used for detecting the marker RG _ tag12 are two single-stranded DNAs shown as RG _ P12f and RG _ P12 r:
RG_P12f：CACCACCACAACTACACA；
RG_P12r：TAACTGCCTGAGAAGACTG；
the primers used for detecting the marker RG _ tag13 are two single-stranded DNAs shown as RG _ P13f and RG _ P13 r:
RG_P13f：CCTTGTTGTTGTTGTTGTTG；
RG_P13r：TGCTTGAAGTATGTCTGGAA；
the primers used for detecting the marker RG _ tag14 are two single-stranded DNAs shown as RG _ P14f and RG _ P14 r:
RG_P14f：TAGAATTGCTCAGGTTGGAA；
RG_P14r：GTGCTTACTAATCAGGATACTC。
the invention also provides a primer combination which comprises the primers RG _ P2f and RG _ P2 r.
Further, the primer combination also comprises one or more of the primers in the pair RG _ P1f and RG _ P1r, RG _ P3f and RG _ P3r, RG _ P4f and RG _ P4r, RG _ P5f and RG _ P5r, RG _ P6f and RG _ P6r, RG _ P7f and RG _ P7r, RG _ P8f and RG _ P8r, RG _ P9f and RG _ P9r, RG _ P10f and RG _ P10r, RG _ P11f and RG _ P11r, RG _ P12f and RG _ P12r, RG _ P13f and RG _ P13r, RG _ P14f and RG _ P14 r.
The invention also provides application of the primer combination in detection of specific genetic sites of chickens and identification of Rugao yellow chicken varieties.
The invention also provides a kit comprising the primer combination.
Compared with the prior art, the invention has the following beneficial effects:
the invention provides a specific INDEL locus which can be effectively used for Rugao yellow chicken variety identification, and through detection, the identification rate of the locus on Rugao yellow chicken is up to 100%.
In order to further improve the accuracy of Rugao yellow chicken variety identification, the invention also provides a plurality of specific SNP sites, and the SNP sites also have higher identification rate on Rugao yellow chicken, so that the invention uses the specific INDEL sites to assist the plurality of SNP sites to identify Rugao yellow chicken, the accuracy is higher, and the identification result is more reliable. The invention provides an accurate and reliable method for identifying Rugao yellow chicken, and is suitable for popularization and application.
Detailed Description
It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of the stated features, steps, operations, and/or combinations thereof, unless the context clearly indicates otherwise.
In order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.
Example 1 identification method of Rugao yellow chicken
The method comprises the following steps: comprising identifying the following specific INDEL loci:
RG _ tag2 is located at chromosome 2 122672840, between gene CA13 and gene CA3A, and the Rugao yellow chicken genotype is inserted with a sequence: ATTT// ATTT.
The base sequences of the primers RG _ P2f and RG _ P2r used for detecting the RG _ tag2 site are shown in the following table 1.
Example 2 identification method of Rugao yellow chicken
The method comprises the following steps: the method comprises the following steps of identifying the following specific INDEL loci and SNP loci:
RG _ tag2 is located at chromosome 2 122672840, between gene CA13 and gene CA3A, and the Rugao yellow chicken genotype is inserted with a sequence: ATTT// ATTT;
RG _ tag1 is located at chromosome 2 60449199, the 2 nd intron of KIF13A gene, and the genotype of Rugao yellow chicken is CC;
RG _ tag3 is located at chromosome 3 33169622, between gene CRIM1 and gene SULT6B1, and the genotype of Rugao yellow chicken is AA;
RG _ tag4 is located at chromosome 3 38660504, the 2 nd intron of SLC35F3 gene, and the genotype of Rugao yellow chicken is GG;
the RG _ tag5 is located on chromosome 4 4196467, the 5 'UTR region of the gene FHL1 and the 3' UTR region of the gene SLC9A6, and the Rugao yellow chicken genotype is GG;
RG _ tag6 is located at chromosome 5 38292725, and the gene UTR3 region of PROX2 has a Rugao yellow chicken genotype of TT;
RG _ tag7 is located at chromosome 49784217 No. 5, the 2 nd intron of CINP gene is CC of Rugao yellow chicken genotype;
RG _ tag8 is located at chromosome 29949231 No. 8, the 3 rd intron of TNNI3K gene is CC of Rugao yellow chicken genotype;
RG _ tag9 is located at chromosome 3397646 No. 10, between gene LINGO1 and gene HMG20A, and the Rugao yellow chicken genotype is GG;
RG _ tag10 is located at chromosome 4938416 No. 24, between gene CADM1 and gene LOC770165, and the Rugao yellow chicken genotype is GG;
RG _ tag11 is located at chromosome 3340013 No. 28, the 2 nd intron of THOP1 gene has a genotype of CC for Rugao yellow chicken;
RG _ tag12 is located at chromosome 9794706 of Z, between gene ZFR2 and gene SUB1, and the Rugao yellow chicken genotype is TT;
RG _ tag13 is located at chromosome 19199901, the 12 th intron of ZSQIM 6 gene, the genotype of Rugao yellow chicken is AA;
RG _ tag14 is located on chromosome 56669873 of Z, and the 2 nd intron of PRRC1 gene has the genotype of Rugao yellow chicken TT.
The primers for detecting the specific SNP sites are as follows:
primers for detecting the marker RG _ tag1 are two single-stranded DNAs shown as RG _ P1f and RG _ P1 r;
two single-stranded DNAs shown as primers RG _ P2f and RG _ P2r used for detecting the RG _ tag2 site;
primers for detecting the marker RG _ tag3 are two single-stranded DNAs shown as RG _ P3f and RG _ P3 r;
primers for detecting the marker RG _ tag4 are two single-stranded DNAs shown as RG _ P4f and RG _ P4 r;
primers for detecting the marker RG _ tag5 are two single-stranded DNAs shown as RG _ P5f and RG _ P5 r;
primers for detecting the marker RG _ tag6 are two single-stranded DNAs shown as RG _ P6f and RG _ P6 r;
primers for detecting the marker RG _ tag7 are two single-stranded DNAs shown as RG _ P7f and RG _ P7 r;
primers for detecting the marker RG _ tag8 are two single-stranded DNAs shown as RG _ P8f and RG _ P8 r;
primers for detecting the marker RG _ tag9 are two single-stranded DNAs shown as RG _ P9f and RG _ P9 r;
primers for detecting the marker RG _ tag10 are two single-stranded DNAs shown as RG _ P10f and RG _ P10 r;
primers for detecting the marker RG _ tag11 are two single-stranded DNAs shown as RG _ P11f and RG _ P11 r;
primers for detecting the marker RG _ tag12 are two single-stranded DNAs shown as RG _ P12f and RG _ P12 r;
primers for detecting the marker RG _ tag13 are two single-stranded DNAs shown as RG _ P13f and RG _ P13 r;
the primers used for detecting the marker RG _ tag14 are two single-stranded DNAs shown as RG _ P14f and RG _ P14r
The primer sequences, the lengths of the amplified fragments, and the annealing temperatures are shown in Table 1 below.
TABLE 1 amplification primers for detecting Rugao yellow chicken variety specificity markers
Example 3 identification method of Rugao yellow chicken
The method comprises the following steps: the method comprises the following steps of identifying the following specific INDEL loci and SNP loci:
RG _ tag2 is located at chromosome 2 122672840, between gene CA13 and gene CA3A, and the Rugao yellow chicken genotype is inserted with a sequence: ATTT// ATTT;
RG _ tag1 is located at chromosome 2 60449199, the 2 nd intron of KIF13A gene, and the genotype of Rugao yellow chicken is CC;
RG _ tag3 is located at chromosome 3 33169622, between gene CRIM1 and gene SULT6B1, and the genotype of Rugao yellow chicken is AA;
RG _ tag4 is located at chromosome 3 38660504, the 2 nd intron of SLC35F3 gene, and the genotype of Rugao yellow chicken is GG;
the RG _ tag5 is located on chromosome 4 4196467, the 5 'UTR region of the gene FHL1 and the 3' UTR region of the gene SLC9A6, and the Rugao yellow chicken genotype is GG;
RG _ tag6 is located at chromosome 5 38292725, and the gene UTR3 region of PROX2 has a Rugao yellow chicken genotype of TT;
RG _ tag7 is located at chromosome 49784217 No. 5, the 2 nd intron of CINP gene is CC of Rugao yellow chicken genotype;
RG _ tag8 is located at chromosome 29949231 No. 8, the 3 rd intron of TNNI3K gene is CC of Rugao yellow chicken genotype;
RG _ tag14 is located on chromosome 56669873 of Z, and the 2 nd intron of PRRC1 gene has the genotype of Rugao yellow chicken TT.
Example 4A primer combination
The primer combination comprises: the primer pairs shown by RG _ P1f and RG _ P1r, RG _ P2f and RG _ P2r, RG _ P3f and RG _ P3r, RG _ P4f and RG _ P4r, RG _ P5f and RG _ P5r, RG _ P6f and RG _ P6r, RG _ P7f and RG _ P7r, RG _ P8f and RG _ P8r, RG _ P9f and RG _ P9r, RG _ P10f and RG _ P10r, RG _ P11f and RG _ P11r, RG _ P12f and RG _ P12r, RG _ P13f and RG _ P13r, RG _ P14f and RG _ P14 r.
The primer combination is used for detecting the Rugao yellow-tea specific genetic locus and identifying the Rugao yellow-tea variety, or is used for preparing a kit for identifying the Rugao yellow-tea.
Example 5A primer combination
The primer combination comprises: the primer pairs shown in RG _ P1f and RG _ P1r, RG _ P2f and RG _ P2r, RG _ P3f and RG _ P3r, RG _ P4f and RG _ P4r, RG _ P5f and RG _ P5r, RG _ P6f and RG _ P6r, RG _ P7f and RG _ P7r, RG _ P8f and RG _ P8r, RG _ P14f and RG _ P14 r.
The primer combination is used for detecting the Rugao yellow-tea specific genetic locus and identifying the Rugao yellow-tea variety, or is used for preparing a kit for identifying the Rugao yellow-tea.
Examples of the experiments
The 14 markers are used for identifying 20 Rugao yellow chicken blood samples and 360 Rugao yellow chicken blood samples. The specific operation steps are as follows:
380 parts of blood sample genome DNA is extracted by a CTAB method, and PCR amplification is carried out after the qualification of ultraviolet spectrophotometer detection and agarose electrophoresis detection.
And (3) PCR amplification process:
1) reaction system 10 mul system including identification material DNA template 50ng, forward and reverse primers lOng,5 mul 2
power Taq MasterMix, and the rest volume is complemented by ultrapure water;
2) the reaction program comprises the steps of firstly carrying out denaturation at 94 ℃ for 30s, annealing at 51.0-56.1 ℃ for 30s and extending at 72 ℃ for 30s for 5 cycles; then denaturation at 94 ℃ for 30s, annealing at 51.0-56.1 ℃ for 30s, and extension at 72 ℃ for 30s for 30 cycles; extending for 5min at 72 ℃, and storing at 4 ℃.
The amplified product is sent to a sequencing company for DNA sequence polymorphism detection. For INDELs markers, capillary electrophoresis was also chosen to detect fragment amplification length as a basis for genotyping. The identification rate of each specific site is shown in Table 2 below.
TABLE 2 identification rate of Rugao yellow chicken variety specificity marker
As can be seen from Table 2, the identification rate of the specific marker locus to Rugao yellow chicken is 85% or more, and the specific marker locus can be effectively used for identifying Rugao yellow chicken. And other specific sites obtained by screening, such as Tag3_3, Tag5_2, Tag7_1, Tag9_2 and Tag15_1, are eliminated due to low actual identification rate of the Rugao yellow chicken.
The specific position information of Tag3_3, Tag5_2, Tag7_1, Tag9_2 and Tag15_1 is as follows:
tag3_3 is located on a chicken No. 3 chromosome at a physical position 38286930, the 10 th intron of the gene RBM34 is AA, and the Rugao yellow chicken genotype is AA;
tag5_2 is located on chicken No. 5 chromosome 12426305, the 1 st intron of gene KCNC1, and the genotype of Rugao yellow chicken is TT;
tag7_1 is located on chicken chromosome 7 at the physical position 29865600, the 2 nd intron of the gene NCKAP5 is the Rugao yellow chicken genotype TT;
tag9_2 is located on a chicken No. 9 chromosome 19078417, the gene NLGN1 the 5 th intron, and the Rugao yellow chicken genotype is CC;
tag15_1 is located on chicken No. 15 chromosome 6864614, and the 8 th intron of the gene CORO1C is of the AA genotype of Rugao yellow chicken.
The primers used for detecting Tag3_3, Tag5_2, Tag7_1, Tag9_2 and Tag15_1 are shown in Table 3 below.
TABLE 3
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.
Claims (9)
1. The method for identifying Rugao yellow chicken is characterized by comprising the following steps of identifying the following specific INDEL loci:
RG _ tag2 is located at chromosome 2 122672840, between gene CA13 and gene CA3A, and the Rugao yellow chicken genotype is inserted with a sequence: ATTT// ATTT.
2. The method of claim 1, further comprising identifying specific SNP sites selected from any one or more of:
RG _ tag1 is located at chromosome 2 60449199, the 2 nd intron of KIF13A gene, and the genotype of Rugao yellow chicken is CC;
RG _ tag3 is located at chromosome 3 33169622, between gene CRIM1 and gene SULT6B1, and the genotype of Rugao yellow chicken is AA;
RG _ tag4 is located at chromosome 3 38660504, the 2 nd intron of SLC35F3 gene, and the genotype of Rugao yellow chicken is GG;
the RG _ tag5 is located on chromosome 4 4196467, the 5 'UTR region of the gene FHL1 and the 3' UTR region of the gene SLC9A6, and the Rugao yellow chicken genotype is GG;
RG _ tag6 is located at chromosome 5 38292725, and the gene UTR3 region of PROX2 has a Rugao yellow chicken genotype of TT;
RG _ tag7 is located at chromosome 49784217 No. 5, the 2 nd intron of CINP gene is CC of Rugao yellow chicken genotype;
RG _ tag8 is located at chromosome 29949231 No. 8, the 3 rd intron of TNNI3K gene is CC of Rugao yellow chicken genotype;
RG _ tag9 is located at chromosome 3397646 No. 10, between gene LINGO1 and gene HMG20A, and the Rugao yellow chicken genotype is GG;
RG _ tag10 is located at chromosome 4938416 No. 24, between gene CADM1 and gene LOC770165, and the Rugao yellow chicken genotype is GG;
RG _ tag11 is located at chromosome 3340013 No. 28, the 2 nd intron of THOP1 gene has a genotype of CC for Rugao yellow chicken;
RG _ tag12 is located at chromosome 9794706 of Z, between gene ZFR2 and gene SUB1, and the Rugao yellow chicken genotype is TT;
RG _ tag13 is located at chromosome 19199901, the 12 th intron of ZSQIM 6 gene, the genotype of Rugao yellow chicken is AA;
RG _ tag14 is located on chromosome 56669873 of Z, and the 2 nd intron of PRRC1 gene has the genotype of Rugao yellow chicken TT.
3. The method of claim 1, wherein the primers RG _ P2f and RG _ P2r used to identify the RG _ tag2 site:
RG_P2f：GAACTCCTCCATCCTCCT；
RG_P2r：AGCAGAATCCAGCACATC。
4. the method of claim 2, wherein the following specific SNP sites are identified: RG _ tag1, RG _ tag3, RG _ tag4, RG _ tag5, RG _ tag6, RG _ tag7, RG _ tag8, RG _ tag 14.
5. The method of claim 2, wherein the primers for detecting the following specific SNP sites are:
the primers used for detecting the marker RG _ tag1 are two single-stranded DNAs shown as RG _ P1f and RG _ P1 r:
RG_P1f：CTGCTATATTCCTTGCTTGTG；
RG_P1r：ATGGTCTTACTGTACTTCTGAG；
the primers used for detecting the marker RG _ tag3 are two single-stranded DNAs shown as RG _ P3f and RG _ P3 r:
RG_P3f：CAGAGCCTACAGAGTTAGAG；
RG_P3r：CAAGGTGGAGGATGACATT；
the primers used for detecting the marker RG _ tag4 are two single-stranded DNAs shown as RG _ P4f and RG _ P4 r:
RG_P4f：TGGTGTCACTTGGTTAGC；
RG_P4r：GGTCGCATTATACTTCCTATG；
the primers used for detecting the marker RG _ tag5 are two single-stranded DNAs shown as RG _ P5f and RG _ P5 r:
RG_P5f：CAGTCACGGCTCAATTAGTA；
RG_P5r：ACGACAACTCAATTCACAGA；
the primers used for detecting the marker RG _ tag6 are two single-stranded DNAs shown as RG _ P6f and RG _ P6 r:
RG_P6f：GACGCAATGGAGACAGAG；
RG_P6r：TATAGACAGACCGCAGAGA；
the primers used for detecting the marker RG _ tag7 are two single-stranded DNAs shown as RG _ P7f and RG _ P7 r:
RG_P7f：TGGCACAACTTGATGATGA；
RG_P7r：CACTGTTATACCTTCTTCTGTC；
the primers used for detecting the marker RG _ tag8 are two single-stranded DNAs shown as RG _ P8f and RG _ P8 r:
RG_P8f：GATCAGTTGGCTGTTCAC；
RG_P8r：CATTACCGTGCTTGACTTAT；
the primers used for detecting the marker RG _ tag9 are two single-stranded DNAs shown as RG _ P9f and RG _ P9 r:
RG_P9f：AGTCTGCTGAGTGCTGTA；
RG_P9r：AGGAATGCTGTCATCTGAAT；
the primers used for detecting the marker RG _ tag10 are two single-stranded DNAs shown as RG _ P10f and RG _ P10 r:
RG_P10f：ATGGATGGCGAAGAGGTA；
RG_P10r：GGTATGAGGCTGTAATGGTA；
the primers used for detecting the marker RG _ tag11 are two single-stranded DNAs shown as RG _ P11f and RG _ P11 r:
RG_P11f：CAGTGGTAGCAAGGAATGT；
RG_P11r：AGCAGGTCTGTGTTAAGTG；
the primers used for detecting the marker RG _ tag12 are two single-stranded DNAs shown as RG _ P12f and RG _ P12 r:
RG_P12f：CACCACCACAACTACACA；
RG_P12r：TAACTGCCTGAGAAGACTG；
the primers used for detecting the marker RG _ tag13 are two single-stranded DNAs shown as RG _ P13f and RG _ P13 r:
RG_P13f：CCTTGTTGTTGTTGTTGTTG；
RG_P13r：TGCTTGAAGTATGTCTGGAA；
the primers used for detecting the marker RG _ tag14 are two single-stranded DNAs shown as RG _ P14f and RG _ P14 r:
RG_P14f：TAGAATTGCTCAGGTTGGAA；
RG_P14r：GTGCTTACTAATCAGGATACTC。
6. a primer combination comprising the primers RG _ P2f and RG _ P2 r.
7. The primer combination of claim 6, further comprising one or more of the pair of primers RG _ P1f and RG _ P1r, RG _ P3f and RG _ P3r, RG _ P4f and RG _ P4r, RG _ P5f and RG _ P5r, RG _ P6f and RG _ P6r, RG _ P7f and RG _ P7r, RG _ P8f and RG _ P8r, RG _ P9f and RG _ P9r, RG _ P10f and RG _ P10r, RG _ P11f and RG _ P11r, RG _ P12f and RG _ P12r, RG _ P13r and RG _ P13r, and RG _ P14 r.
8. Use of the primer combination according to claim 6 or 7 for detecting specific genetic loci of chickens and for identifying Rugao yellow chicken varieties.
9. A kit comprising the primer combination of claim 6 or 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011417130.7A CN112501309A (en) | 2020-12-04 | 2020-12-04 | Identification method of Rugao yellow chicken |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011417130.7A CN112501309A (en) | 2020-12-04 | 2020-12-04 | Identification method of Rugao yellow chicken |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112501309A true CN112501309A (en) | 2021-03-16 |
Family
ID=74970366
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011417130.7A Pending CN112501309A (en) | 2020-12-04 | 2020-12-04 | Identification method of Rugao yellow chicken |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112501309A (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
-
2020
- 2020-12-04 CN CN202011417130.7A patent/CN112501309A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111225986A (en) * | 2017-10-10 | 2020-06-02 | 中国农业科学院北京畜牧兽医研究所 | Chicken whole genome SNP chip and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| YIYUAN YAN等: "Genome-Wide Characterization of Insertion and Deletion Variation in Chicken Using Next Generation Sequencing", PLOS ONE, vol. 9, no. 8, pages 1 - 11 * |
| 陈博雯;郑圣晗;张莘;王统苗;王志秀;张扬;陈国宏;常国斌;: "不同鸡种BF1基因SNP和Indel比对分析", 江苏农业学报, no. 05, pages 133 - 140 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107201409B (en) | SNP marker combination for tracing and identifying beef cattle individual and meat product and application thereof | |
| CN106947816B (en) | Microsatellite fluorescent multiplex PCR (polymerase chain reaction) method for parent-child identification of epinephelus coioides | |
| CN108384859B (en) | SNP (Single nucleotide polymorphism) marker related to tail type character of fat-tail sheep and application | |
| US11542562B2 (en) | Single nucleotide polymorphism marker related to Chinese horse short stature trait and use thereof | |
| CN104131092B (en) | A kind of many SNP authentication method based on high-resolution melting curve | |
| CN111850161B (en) | Sand-melt aegilops 7SshChromosome specific molecular marker and application thereof | |
| AU2020104123A4 (en) | An SNP Molecular Marker for Screening and/or Detecting Bovine Cell Viability | |
| de Miguel et al. | Annotated genetic linkage maps of Pinus pinaster Ait. from a Central Spain population using microsatellite and gene based markers | |
| CN112501309A (en) | Identification method of Rugao yellow chicken | |
| CN114480718B (en) | Primer group and detection kit for rice high temperature resistant genotyping based on KASP technology and application of primer group and detection kit | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN112430681B (en) | Molecular marker for identifying wheat plant height and yield traits and application thereof | |
| CN113151486A (en) | Method for identifying Longsheng chicken based on specific genetic locus | |
| CN110669867B (en) | Method for identifying or assisting in identifying whether gastrodia elata to be detected is red gastrodia elata, gastrodia elata glauca or hybrid gastrodia elata glauca | |
| KR101508689B1 (en) | Markers for origin discrimination of the northern mauxia shrimp(Acetes chinensis) | |
| CN108570509B (en) | Detection method of EC16SNP marker of exopalaemon carinicauda | |
| CN107574167B (en) | Hyriopsis cumingii microsatellite marker and application thereof | |
| CN112481389A (en) | Molecular marker primer combination for identifying shou Guang chicken species and identification method | |
| CN112725461A (en) | Method for identifying Langshan chicken species based on INDELs specific locus | |
| CN112522421A (en) | Method for identifying Taihu chicken by using molecular marker | |
| CN105238778A (en) | Snp marker and application thereof | |
| CN112458185B (en) | Chip, primer combination, kit and method for identifying chickens coming from avionics | |
| KR101801019B1 (en) | Single nucleotide polymorphism marker for discerning leaf blight-resistant lily cultivar based on 60s ribosomal gene and uses thereof | |
| CN112430671A (en) | Specific INDELs locus of Xianju chicken as well as detection primer and application thereof | |
| CN113151485A (en) | Chip, primer combination, kit and identification method for identifying Jining whooping chicken |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20210419 Address after: 225125 Jiangsu province Hanjiang District of Yangzhou city CHANGJEI Road No. 58 Applicant after: JIANGSU INSTITUTE OF POULTRY SCIENCES Applicant after: Xueyi Technology (Chengdu) Co.,Ltd. Address before: 225125 Jiangsu province Hanjiang District of Yangzhou city CHANGJEI Road No. 58 Applicant before: JIANGSU INSTITUTE OF POULTRY SCIENCES |
|
| TA01 | Transfer of patent application right | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20211119 Address after: 225125 No. 58, Cang Jie Road, Hanjiang District, Yangzhou, Jiangsu Applicant after: JIANGSU INSTITUTE OF POULTRY SCIENCES Address before: 225125 No. 58, Cang Jie Road, Hanjiang District, Yangzhou, Jiangsu Applicant before: JIANGSU INSTITUTE OF POULTRY SCIENCES Applicant before: Xueyi Technology (Chengdu) Co., Ltd |