CN112501287A

CN112501287A - DNA methylation marker of psoriatic arthritis, diagnostic reagent and application thereof

Info

Publication number: CN112501287A
Application number: CN202110051444.8A
Authority: CN
Inventors: 陆前进; 赵明; 苏玉文; 邓敏; 吴海竞
Original assignee: Second Xiangya Hospital of Central South University
Current assignee: Second Xiangya Hospital of Central South University
Priority date: 2021-01-14
Filing date: 2021-01-14
Publication date: 2021-03-16
Anticipated expiration: 2041-01-14
Also published as: CN112501287B

Abstract

The invention discloses a DNA methylation marker of Psoriatic Arthritis (PsA), a diagnostic reagent and application thereof. Includes 6 methylation sites: one or more of chr14:38061326, chr14:38061320, chr9:128585454, chr6:37225002, chr3:101901234 and chr6: 97369501. The invention firstly uses the specific DNA methylation sites as molecular markers to carry out auxiliary screening on patients with psoriatic Arthritis and Rheumatoid Arthritis (RA), and opens up a new way and a new mode for diagnosis in the field. The invention utilizes the whole blood of the patient to detect the DNA methylation sites, achieves the purpose of early diagnosis of PsA, has less needed blood samples, is convenient and easy to develop, and has good application prospect.

Description

DNA methylation marker of psoriatic arthritis, diagnostic reagent and application thereof

Technical Field

The invention belongs to the technical field of medical molecular biology detection, and particularly relates to a diagnostic marker and a diagnostic reagent for psoriatic arthritis and application thereof.

Background

Psoriatic arthritis (PsA) is an inflammatory joint disease associated with psoriasis, with Psoriatic skin rash and resulting in pain, swelling, tenderness, stiffness and dyskinesia of the joints and surrounding soft tissues. Some patients can have sacroiliac arthritis and (or) rachitis, the course of the disease is prolonged, the disease is easy to relapse, and the later stage can be related to ankylosis, which leads to disability. The peak age of the onset of PsA is 35-45 years, with psoriatic lesions appearing earlier than joint inflammation in about 70% of PsA patients, and lesions appearing with joint inflammation in about 15% of patients. Early PsA means that there are no pain symptoms within 1-2 years after the patient is diagnosed, and thus, it is difficult to make an accurate early diagnosis at this time by relying only on clinical symptoms. This part of patients who may develop PsA may develop severe, irreversible joint damage after 1-2 years without early intervention. If early diagnosis can be carried out before severe and irreversible joint damage occurs to a patient with PsA, the early diagnosis has great significance for preventing and treating the PsA and improving the joint symptoms and the life quality of the patient. However, current diagnosis is mainly based on patient history, clinical manifestations and changes in the X-ray articular segment, and there are no biological diagnostic markers for early diagnosis of PsA patients.

In recent years, the research on epigenetic markers is rapidly developed, and a plurality of epigenetic markers such as DNA methylation markers and serum microRNA markers are screened and identified, and the markers have important values for early diagnosis and prognosis judgment of diseases. We have found in earlier studies that patients with psoriasis vulgaris exhibit abnormal epigenetic modifications, and it is readily speculated that the epigenetic modifications play an important role in the development of psoriatic arthritis and psoriasis vulgaris. The results of earlier studies also show that the peripheral blood mononuclear cell nuclear skin lesion sample of the psoriasis vulgaris shows abnormal modification of DNA methylation, abnormal histone modification and abnormally increased expression of non-coding RNA, which all indicate that epigenetic regulation participates in the occurrence and development of the psoriasis vulgaris and can be used as a marker for morbidity or prognosis and reflecting mobility.

Disclosure of Invention

The invention discovers biomarkers for early diagnosis of PsA, wherein the biomarkers comprise 6 CpG sites located in different DNA fragments, and through detecting the methylation level of the 6 CpG sites and carrying out Logistic binary regression and ROC curve analysis in combination, the PsA can be diagnosed early, and meanwhile, Rheumatoid Arthritis (RA) can be distinguished.

The primary object of the present invention is to provide a DNA methylation marker for psoriatic arthritis.

Includes 6 methylation sites: one or more of chr14:38061326, chr14:38061320, chr9:128585454, chr6:37225002, chr3:101901234 and chr6: 97369501.

chr14:38061326 (CpGID: cg 07940072), chr14:38061326, chr14:38061320 are 6 bases apart, chr14:38061320 is a methylation site 6 bases upstream of chr14: 38061326;

chr9:128585454（CpGID: cg15734589）；

chr6:37225002（CpGID: cg12800266）；

chr3:101901234（CpGID: cg12992827）；

chr6:97369501（CpGID: cg24500972）。

the methylation level of 6 CpG sites in psoriatic arthritis patients was significantly reduced compared to healthy controls, but significantly increased compared to rheumatoid arthritis patients.

The second purpose of the invention is to provide the application of the DNA methylation marker for psoriatic arthritis. Namely the use of a product which detects the methylation level of one or more of the 6 methylation sites described above in the manufacture of a formulation for the diagnosis of psoriatic arthritis.

The product obtains the methylation levels of at least 2 CpG sites by analyzing the sequencing results of a plurality of samples, and makes a formula by combining the methylation levels of at least 2 CpG sites to perform binary Logistic regression analysis for detecting the samples to be detected.

Further, preferably, the methylation levels of 4, 5 or 6 methylation sites are obtained, and binary Logistic regression analysis is performed to make a formula for detecting the sample to be detected.

When psoriatic arthritis is compared with rheumatoid arthritis, arthritis symptoms generally appear, but the arthritis cannot be determined, and the following items are selected:

4 CpG sites: chr14:38061326, chr14:38061320, chr3:101901234, chr6: 97369501;

5 CpG sites: chr14:38061326, chr14:38061320, chr9:128585454, chr3:101901234, chr6: 97369501;

6 CpG sites: chr14:38061326, chr14:38061320, chr9:128585454, chr6:37225002, chr3:101901234, chr6: 97369501.

When psoriatic arthritis was compared with healthy controls, and generally used for judgment when no arthritis symptoms appeared, the following were selected:

4 CpG sites: chr14:38061326, chr14:38061320, chr3:101901234, chr6: 97369501;

5 CpG sites: chr14:38061326, chr14:38061320, chr6:37225002, chr3:101901234, chr6: 97369501;

Further, binary Logistic regression analysis was performed in combination with the methylation levels of 6 CpG sites compared to psoriatic arthritis and rheumatoid arthritis to yield the formula Y = -0.854 XA +0.530 XB-0.038 XC-0.012 XD +0.119 XE +0.156 XF-8.344, wherein A, B represents chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y values are more than-0.157, and diagnosing the psoriasis arthritis;

or binary Logistic regression analysis is carried out by combining the methylation levels of 5 CpG sites to obtain the formula Y = -0.850 xA +0.534 xB-0.036 xC +0.117 xE +0.144 xF-8.618, wherein A, B represents chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; and (3) calculating corresponding Y values according to the methylation values of 5 CpG sites of the sample to be detected, wherein the Y values are more than-0.1396, and diagnosing the psoriasis arthritis.

Further, binary Logistic regression analysis was performed in combination with the methylation levels of 6 CpG sites compared to healthy control groups to obtain the formula Y = -0.448 xa-0.04 xb +0.018 xc-0.118 xd-0.08 xe-0.015 xf + 15.892; wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y value is more than 0.4708, and diagnosing the psoriasis arthritis;

or binary Logistic regression analysis is carried out by combining the methylation levels of 5 CpG sites to obtain the formula Y = -0.457 xA-0.032 xB-0.109 xD-0.079 xE +0.007 xF +15.405, wherein A, B represents chr14:38061326 and chr14: 38061320; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; and (3) calculating corresponding Y values according to the methylation values of 5 CpG sites of the sample to be detected, wherein the Y values are more than 0.5402, and diagnosing the psoriasis arthritis.

It is a third object of the present invention to provide an agent for diagnosing psoriatic arthritis comprising a product for detecting the methylation level of at least one of the above 6 methylation sites.

Further, the product comprises PCR reagents and pyrosequencing reagents.

Further, the primer pairs adopted by the PCR reagent are as follows:

primers containing chr14:38061326 and chr14:38061320 sites were amplified:

F1：GGGTGTAGAGTTTAGTAGGAGTT

R1：AATCATAAACCTCTTCCCCTATT

amplifying a primer containing a chr9:128585454 site:

F1：TAGTTGTGGGAAAAGTGGAGAA

R1：CCTCACAAAATCATAACAACTTTTATT

amplifying a primer containing a chr6:37225002 site:

F1：ATGGATTGATATAGGGATTAGATTATTTGA

R1：ATTATTACCCTCCTTTCCTCATTC

amplifying a primer containing a chr3:101901234 site:

F1：GGAGATTAGTTTGGTGAAAATGATAT

R1：ACCTATTAACCCAACCACTAAATT

amplifying a primer containing a chr6:97369501 site:

F1：AGAAATATGGTTTAGTGATTTTTTAATGT

R1：AATTCTTTATTCAATTCCTAATAACTACC。

the methylation site screening of the present invention comprises the following steps.

DNA methylation CpG site screening: whole blood samples of 25 psoriatic arthritis and 19 healthy controls (NC) were subjected to 850k methylation chip assay of whole blood genome to screen out DNA methylation CpG sites with differential expression between psoriatic arthritis and healthy controls, and random forest method was used to further screen out DNA methylation CpG sites with differential expression.

2. Identification of DNA methylation markers: and (3) carrying out pyrosequencing on the screened DNA methylation CpG sites, and carrying out large sample verification on patients with psoriatic arthritis, health control and rheumatoid arthritis to identify the DNA methylation CpG sites for diagnosing PsA. And carrying out ROC curve analysis to obtain values such as specificity and sensitivity of the DNA methylation marker.

The specific experimental steps comprise: (1) extracting the whole genome DNA of peripheral blood of a subject; (2) determining the concentration of the extracted genomic DNA; (3) sulfite-treated genomic DNA; (4) amplifying a DNA fragment to be detected by using a specific PCR primer; (5) detecting the PCR product by agarose gel electrophoresis; (6) carrying out pyrosequencing on the PCR product; (7) analyzing a sequencing result to obtain the methylation level of at least 2 CpG sites, combining the methylation levels of a plurality of CpG sites to perform binary Logistic regression analysis, making a formula to obtain a Y value, and performing ROC curve analysis by using the Y value to obtain AUC, sensitivity and specificity for diagnosing the PsA.

The corresponding Y values for the methylation levels of 6 CpG sites compared to healthy controls are used in the ROC plot for the diagnosis of PsA, see FIG. 4. The methylation levels of 5 CpG sites correspond to a Y value for the ROC plot for PsA diagnosis, see FIG. 5.

The corresponding Y values for the methylation levels of 6 CpG sites compared to rheumatoid arthritis are used in the ROC plot for the diagnosis of PsA, see FIG. 6. The methylation levels of 5 CpG sites correspond to a Y value for the ROC plot for PsA diagnosis, see FIG. 7.

The invention has the beneficial effects that:

the invention firstly utilizes the screened specific DNA methylation sites as molecular markers to carry out auxiliary screening on patients with psoriatic arthritis and rheumatoid arthritis, and opens up a new way and a new mode for diagnosis in the field.

The invention utilizes the whole blood of the patient to detect the DNA methylation sites, achieves the purpose of early diagnosis of PsA, can further distinguish RA patients, has less required blood specimens, is convenient and easy to develop, and has good application prospect.

Drawings

FIG. 1 is a graph showing the results of 17 DNA methylation CpG sites with differential expression between psoriatic arthritis and healthy controls.

FIG. 2 is an agarose gel electrophoresis of 5 pairs of primers designed based on 6 CpG sites for PCR amplification of a DNA fragment of interest.

FIG. 3 is a graph comparing the methylation levels of PsA, NC and RA 6 CpG sites.

FIG. 4 is a ROC plot combining the methylation levels of 6 CpG sites for PsA diagnosis compared to healthy controls.

FIG. 5 is a ROC plot combining the methylation levels of 5 CpG sites for PsA diagnosis compared to healthy controls.

FIG. 6 is a ROC plot combining the methylation levels of 6 CpG sites for PsA diagnosis compared to rheumatoid arthritis.

FIG. 7 is a ROC plot combining the methylation levels of 5 CpG sites for PsA diagnosis compared to rheumatoid arthritis.

FIG. 8 is a ROC plot of the combined diagnosis of PsA at 4, 5, 6 CpG sites, respectively, in PsA patients and healthy control groups.

FIG. 9 is a ROC plot of the combined diagnosis of PsA at 4, 5, 6 CpG sites, respectively, in PsA patients and rheumatoid arthritis patient groups.

Detailed Description

In order to further understand the present invention, the technical solutions in the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Unless otherwise specified, the reagents involved in the examples of the present invention are all commercially available products, and all of them are commercially available.

The cases of PsA incorporated in the present invention are patients with Psoriatic arthritis, either confirmed clinically by dermatologists or rheumatologists, all meet the caspar (clinical criteria for Psoriatic arthritis) criteria, and exclude the incorporation of any of the following: 1. accompanied with rheumatoid arthritis, ankylosing spondylitis 2, with connective tissue diseases such as systemic lupus erythematosus, dermatomyositis 3, with malignant tumor 4, severe liver and kidney function damage 5, severe infection, and immunosuppression.

Examples

First, DNA methylation CpG site screening

Whole blood samples of 25 psoriatic arthritis and 19 healthy controls were subjected to a whole blood genome 850k methylation chip assay, and a batch of DNA methylation CpG sites expressing differences between psoriatic arthritis and healthy controls were initially selected.

Identification of DNA methylation CpG sites

Experiments such as primer design, PCR amplification of target gene bands, pyrosequencing and the like are carried out. The differentially expressed DNA methylated CpG sites are ultimately screened and identified for diagnosis of PsA.

Experimental reagent:

(1) reagent for extracting DNA from whole blood: GeneJET Whole blood genomic DNA purification kit (Thermo Scientific Sammerfei), reagent Cat No. K0782, Lot 00239303

(2) Reagents required for sulfite treatment: DNA Methylation kit (EZ DNA Methylation)^TMKit, Zymo Research), cat # D5002

Add 750. mu.l water and 210. mu.l dilution buffer to each tube of CT transformation reagent, mix and use

Add 96 ml of 100% ethanol to 24ml wash buffer

(3) Reagents required for PCR:

(4) reagents required for pyrosequencing:

。

equipment used in the experiment:

a genome DNA purification column, a collection tube, a pipette gun, a pipette tip head, disposable gloves, a 1.5mL centrifuge tube, a PCR tube, a micro centrifuge, a hybridization furnace and a vortex oscillation instrument; a hybridization oven, a NanoDrop 2000 ultraviolet spectrophotometer, a PCR instrument (eppendorf), an agarose gel electrophoresis instrument, and a real-time quantitative pyrophosphate sequence analyzer (Pyromark Q24).

Experimental procedure

Step 1: extracting the genomic DNA of the peripheral blood of patients with psoriatic arthritis (adopting a commercial whole blood DNA extraction kit):

(1) taking 200 mu l of whole blood to a 1.5ml centrifuge tube, then adding 20 mu l of proteinase K solution, and uniformly mixing by vortex; (2) add 400. mu.l of lysis buffer and vortex and mix well. (3) Incubating in a hybridization oven at 56 deg.C for 10 min; (3) adding 200 mul of absolute ethyl alcohol, turning upside down and mixing evenly; (4) transferring the mixed solution to a centrifugal adsorption column, and centrifuging at 6000g for 1 min; (5) transferring the adsorption column to a new waste liquid pipe; (6) adding 500. mu.l of washing buffer solution 1, 8000g (1000rpm), centrifuging for 1min, and discarding the waste liquid; (6) adding 500 mul washing buffer solution 2, 13000g, centrifuging for 3min, and discarding the waste liquid; (7) 13000g, again for 1min, transfer the adsorption column to a new 1.5ml centrifuge tube; (8) adding 70 μ l elution buffer, standing at room temperature for 2 min; (9) 8000g, centrifuging for 1min, and collecting genome DNA.

Step 2, determining the concentration and purity of the extracted genome DNA;

using a NanoDrop 2000 ultraviolet spectrophotometer from the company Sammerfei (Thermo Scientific), 1. mu.l of DNA sample was aspirated, spotted onto the detection plate, and the concentration of the sample and A260/A280 were read from the instrument. The DNA concentration of the sample to be tested is diluted to 10-25 ng/. mu.l.

Step 3, processing genome DNA by sulfite;

(1) calculating a sampling volume of 200ng of DNA required for sulfite treatment according to the DNA concentration; (2) preparing a CT conversion reagent in dark: vortex 750ul of non-enzyme water and 210 mul of dilution buffer solution, mix evenly and avoid light for 15 min; (3) add 130. mu.l of the conversion reagent to 20. mu.l of the DNA sample and place in a PCR tube. (4) The mixed solution reacts in a PCR instrument: 8min at 98 ℃; 54 ℃ for 60 min. (5) The reaction solution of step (4) and 600. mu.l of the binding buffer were added to a spin column, and the mixture was inverted and mixed several times. (6) 11000g, centrifugating for 30s, and discarding the solution. (7) Add 100. mu.l washing buffer, 11000g, centrifuge for 30s, discard solution. (8) Adding 200 μ l of desulfurization solution, centrifuging at room temperature (20-30 deg.C) for 15-20min, 11000g, and centrifuging for 30 s. (9) Add 200. mu.l washing buffer, 11000g, centrifuge for 1min, discard the solution. (10) Add 200. mu.l of washing buffer, 13000g, centrifuge for 3min, discard the solution. (11) Placing the centrifugal column into a new 1.5ml centrifugal tube, adding 40 mul of eluent, 8000g, centrifuging for 30s, and collecting DNA after sulfite treatment in the centrifugal tube.

Step 4, determining the concentration and purity of the genome DNA treated by the bisulfite;

2. mu.l of DNA sample was aspirated and spotted onto the detection plate using a NanoDrop 2000 ultraviolet spectrophotometer from Thermo Scientific, Inc., and the concentration of the sample and A260/A280 were read from the instrument.

Step 5, PCR amplification of target DNA fragment

Primer sequence for amplifying DNA fragment with 6 CpG sites

Comprises two sites of chr14:38061326 and chr14: 38061320:

f1: GGGTGTAGAGTTTAGTAGGAGTT, see SEQ ID NO. 1;

r1: AATCATAAACCTCTTCCCCTATT, see SEQ ID NO. 2;

pyrosequencing sequence: GAAGTAGTTATTGAAGGATAG, see SEQ ID NO. 3;

amplification of chr9: 128585454:

f1: TAGTTGTGGGAAAAGTGGAGAA, see SEQ ID NO. 4;

r1: CCTCACAAAATCATAACAACTTTTATT, see SEQ ID NO. 5;

pyrosequencing sequence: TGGGAAAAGTGGAGAAA, see SEQ ID NO. 6;

amplification of chr6: 37225002:

f1: ATGGATTGATATAGGGATTAGATTATTTGA, see SEQ ID NO. 7;

r1: ATTATTACCCTCCTTTCCTCATTC, see SEQ ID NO. 8;

pyrosequencing sequence: TTGAATTTTTAATTTATAGTATAAG, see SEQ ID NO. 9;

amplification of chr3: 101901234:

f1: GGAGATTAGTTTGGTGAAAATGATAT, see SEQ ID NO. 10;

r1: ACCTATTAACCCAACCACTAAATT, see SEQ ID NO. 11;

pyrosequencing sequence: AGGTAGTATGTTTAGAATGT, see SEQ ID NO. 12;

amplification of chr6: 97369501:

f1: AGAAATATGGTTTAGTGATTTTTTAATGT, see SEQ ID NO. 13;

r1: AATTCTTTATTCAATTCCTAATAACTACC, see SEQ ID NO. 14;

pyrosequencing sequence: GTTATTATTGGTTTGTGATAGA, see SEQ ID NO. 15.

Step 6 pyrosequencing

1. Agarose bead-immobilized PCR products

Immobilizing biotin-labeled PCR products onto streptavidin-modified coated agarose beads

(1) Gently shaking streptavidin modified coated agarose beads until a homogeneous solution is obtained;

(2) mixing streptavidin-modified coated agarose beads (2. mu.l/sample) with binding buffer (40. mu.l/sample), 18. mu.l of high purity water in one tube; adding the solution into an 8-row pipe;

(3) add 20. mu.l biotin-labeled PCR products to the PCR array tubes (total volume of each well was 80. mu.l);

(4) sealing the row-connecting pipe by using a pore plate strip cover;

(5) continuously shaking the PCR row-pipes by using a shaking mixer at 1400rpm for at least 5-10min (note: agarose beads are precipitated rapidly, so the shaking is stopped and the agarose beads must be used immediately within one minute, i.e., immediately captured);

2. vacuum workstation preparation

(1) The following reagents were prepared: 50ml of 70% ethanol; 40ml of denaturing solution; 50ml of 1' washing buffer; 50ml of high purity water; 70ml of high purity water;

1 × washing buffer preparation: 5 × washing buffer 5ml + high purity water 45 ml;

(2) turning on a vacuum pump, turning on a vacuum switch, and performing a test to determine whether the filter probe works normally;

(3) the permeability of the filter probe was checked with high purity water before each use of the vacuum pump. The centrifuge tube containing the high purity water prepared in advance is inserted into the PCR well, and the filtration probe is lowered into the high purity water, and if the high purity water is evacuated within 20 seconds, the filtration probe is normal and can be used. Otherwise, the filtering probe needs to be replaced;

(4) taking off the vibrated PCR tube, putting the sample into a PCR hole groove, carefully lowering the filter probe into the PCR tube, and staying for 15 seconds; ensure that all solution is aspirated away to capture the microbeads containing the immobilized template (ensure that all liquid in the centrifuge tube is aspirated and all microbeads have been captured to the tip of the filter probe);

(5) moving the vacuum apparatus to a reagent tank 1 containing 70% ethanol, and washing the filtration probe for 5 seconds;

(6) moving the vacuum device to a reagent tank 2 containing a denaturing solution, and washing the filtration probe for 5 seconds;

(7) moving the vacuum apparatus to a reagent tank 3 containing a washing buffer, and washing the filtration probe for 10 seconds;

(8) lifting the vacuum device for 5 seconds beyond the 90-degree vertical line, and discharging liquid from the filter needle;

(9) closing a switch on the vacuum device and placing it in a rest (P) position;

3. DNA single strands were isolated and the samples were released into Pyromark Q24 well plates

(1) Placing a PyroMark Q24 pore plate on a preheated pore plate base, and accurately heating for 2min at 80 ℃;

(2) taking down the pore plate from the pore plate base, and cooling the sample at room temperature (15-25 ℃) for at least 5 min;

preparation of Pyromark Q24 reagent

(1) Opening the PyroMark Q24 kit and taking out the vial containing the enzyme and substrate lyophilized powder, and the test tube containing the nucleotides;

(2) dissolving with high-purity water according to kit specification, and subpackaging enzyme and substrate (the dissolved enzyme and substrate need to be preserved at-20 deg.C, and can be repeatedly frozen and thawed for 3 times at most, and nucleotide can be preserved at 4 deg.C), and all reagents need to be recovered to room temperature for reuse;

(3) adding A, T, G, C enzyme, substrate and nucleotides to the reagent chamber (reagent chamber must be dried before use, up to 30 times) according to the volume calculated by the computer program;

5. run on a real-time quantitative Pyrophosphate Analyzer (Pyromark Q24)

(1) Opening PyroMark Q24 software, clicking new assoy AQ assoy in sequence analyze to input a mutation point sequence, clicking generatepupentalisation, and clicking for storage;

(2) clicking new run insert method 005, clicking grids to be sequenced, and clicking to store the grids to the U disk;

(3) inserting a USB flash disk containing an operating file into a USB port in front of an instrument;

(4) placing the heated orifice plate on an instrument;

(5) placing the label side of the reagent chamber (enzyme, substrate and nucleotide) into the instrument facing itself, opening the well plate holder frame and placing the well plate, and closing the well plate holder frame and the instrument cover;

(6) selecting Run and pressing OK;

(7) after entering Run, selecting a file to be Run according to select;

(8) after the instrument runs and the running file is confirmed to be stored in the USB flash disk, taking out the USB flash disk according to close;

(9) the experimental data were analyzed.

Test results

1.DNA methylation CpG site screening

Whole blood samples from 25 psoriatic arthritis and 19 healthy controls were tested on a whole blood genome 850k methylation chip to screen out 17 DNA methylation CpG sites that express differences between psoriatic arthritis and healthy controls (see FIG. 1), 1. cg08446860, 2.cg16059161, 3. cg 01279, 4. cg20092399, 5. cg11177698, 6. cg16484042, 7.cg141188148, 8.cg27654717, 9. cg07940072, 10. cg 34157589, 11. cg12800266, 12. cg15044533, 13. cg 92827, 14. cg 97037382, 15. cg18271036, 16. cg 22112, 17. cg 2459972.

2. Identification of DNA methylation CpG sites

Experiments such as primer design, PCR amplification of target gene bands, pyrosequencing and the like are carried out. Finally, 6 differentially expressed DNA methylation CpG sites were screened and identified for diagnosis of PsA (5 of them were found in the primary screened DNA methylation CpG sites and 1 was newly found at the time of validation). The 5 methylation sites include: chr14 cg07940072, chr9 cg15734589, chr6 cg12800266, chr3 cg12992827, chr6 cg 2400972; the chr14: cg07940072 corresponds to chr14: 38061326; chr9: cg15734589 corresponds to chr9: 128585454; chr6: cg12800266 corresponds to chr6: 37225002; chr3: cg12992827 corresponds to chr3: 101901234; chr6: cg 2400972 corresponds to chr6: 97369501. The newly found position of 1 CpG site is chr14:38061320, 6 bases upstream of chr14:38061326 (cg 07940072).

As can be seen from fig. 2: after PCR is carried out by using primers of DNA fragments with 6 CpG sites, bright specific target gene bands exist, and the primers have specificity.

FIG. 2a shows chr14: cg07940072, which contains a fragment that amplifies both sites chr14:38061326 and chr14: 38061320.

FIG. 2b shows chr9: cg15734589, containing a fragment that amplifies chr9: 128585454.

FIG. 2c shows chr6: cg12800266, comprising a fragment of amplified chr6: 37225002.

FIG. 2d shows chr3: cg12992827, containing a fragment that amplifies chr3: 101901234.

FIG. 2e shows chr6: cg 2400972, containing an amplified fragment of chr6: 97369501.

FIG. 3 is a comparison of the methylation levels of PsA, NC (healthy control) and RA at the 6 CpG sites, respectively, and it can be seen from FIG. 3 that the methylation level of the 6 CpG sites of PsA is reduced on average compared to NC. The level of methylation at 6 CpG sites is elevated for PsA compared to RA.

FIG. 3a shows the levels of PsA, NC and RA methylation at both the chr14:38061326, chr14:38061320 sites.

FIG. 3b shows the levels of PsA, NC and RA methylation at the chr9:128585454 site.

FIG. 3c shows the levels of PsA, NC and RA methylation at the chr6:37225002 site.

FIG. 3d shows the levels of PsA, NC and RA methylation at the chr3:101901234 site.

FIG. 3e shows the levels of PsA, NC and RA methylation at the chr6:97369501 site.

3. The methylation levels of the above 6 CpG sites were examined in 60 patients with PsA, 60 healthy controls and 60 patients with rheumatoid arthritis using the above method. Combining methylation levels of 6 CpG sites to carry out binary Logistic regression analysis to obtain a formula, calculating a corresponding Y value, and then utilizing an ROC curve to evaluate statistics to calculate the sensitivity and specificity of the Y value corresponding to the methylation levels of the 6 CpG sites in the diagnosis of psoriatic arthritis, wherein the actual value range of the area under the ROC curve (AUC) is 0.5-1, but generally considered as follows: for a diagnostic test, the diagnostic value is low when the area under the ROC curve is between 0.5 and 0.7, the diagnostic value is medium when the area is between 0.7 and 0.9, and the diagnostic value is high when the area is more than 0.9.

Binary Logistic regression analysis was performed in combination with methylation levels of 6 CpG sites for PsA versus healthy controls to give the formula Y = -0.448 xa-0.04 xb +0.018 xc-0.118 xd-0.08 xe-0.015 xf + 15.892; wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site. Based on the methylation values of 6 CpG sites, the corresponding Y values were calculated and compared to healthy controls using ROC curve analysis (FIG. 4); AUC 0.849, 95% CI 0.779-0.918, sensitivity 70%, specificity 88.3%. The results show that the Y value is greater than 0.4708 for PsA patients compared to healthy controls, which can be considered as a diagnosis of PsA. The Y values corresponding to the methylation levels of these 6 CpG sites distinguish PsA patients from healthy controls with 88.3% specificity and 70% sensitivity. Binary Logistic regression analysis was performed in combination with methylation levels of 5 CpG sites to give the formula Y = -0.457 xA-0.032 xB-0.109 xD-0.079 xE +0.007 xF +15.405, where A, B denotes chr14:38061326 and chr14: 38061320; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; based on the methylation values of 5 CpG sites, the corresponding Y values were calculated and compared to healthy controls using ROC curve analysis (FIG. 5); AUC 0.849, 95% CI 0.779-0.920, sensitivity 70%, specificity 91.7%. The results show that the Y value is greater than 0.5402 for the PsA patient compared to the healthy control group, which is considered to be a diagnosis of PsA. The Y values corresponding to the methylation levels of these 5 CpG sites distinguish PsA patients from healthy controls with a specificity of 91.7% and a sensitivity of 70%.

Binary Logistic regression analysis combining methylation levels of 6 CpG sites compared to the rheumatoid arthritis group in PsA gave the formula Y = -0.854 × A +0.530 × B-0.038 × C-0.012 × D +0.119 × E +0.156 × F-8.344, where A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; based on the methylation values of 6 CpG sites, corresponding Y values were calculated, and the AUC:0.851, 95% CI: 0.782-0.921, sensitivity: 85.0%, and specificity: 76.7% were compared with rheumatoid arthritis using ROC curve analysis (FIG. 6). The results show that the Y value is greater than-0.157 in the group of patients with PsA compared to the group of patients with rheumatoid arthritis, and the diagnosis of psoriatic arthritis can be considered. The Y values corresponding to the methylation levels of these 6 CpG sites distinguish patients with PsA from patients with rheumatoid arthritis with a specificity of 76.7% and a sensitivity of 85.0%. Binary Logistic regression analysis was performed in combination with methylation levels of 5 CpG sites to give the formula Y = -0.850 xa +0.534 xb-0.036 xc +0.117 xe +0.144 xf-8.618, where A, B denotes chr14:38061326 and chr14: 38061320; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site. Based on the methylation values of 5 CpG sites, corresponding Y values were calculated, and the AUC:0.851, 95% CI: 0.782-0.921, sensitivity: 85.0%, and specificity: 78.3% were compared with rheumatoid arthritis using ROC curve analysis (FIG. 7). The results show that the Y value is greater than-0.1396 for the PsA patients compared to the rheumatoid arthritis group, and the diagnosis of psoriatic arthritis can be considered. The Y values corresponding to the methylation levels of these 5 CpG sites distinguish patients with PsA from rheumatoid arthritis with a specificity of 78.3% and a sensitivity of 85.0%.

Tables 7 and 8 are a comparison of the diagnostic efficiency of diagnosing PSA in combination with 4, 5, 6 CpG sites.

TABLE 7 comparison of the diagnostic efficiency of the combined diagnosis of PsA at 4, 5, 6 CpG sites, respectively, compared to healthy controls

TABLE 8 comparison of the diagnosis efficiency of PSA with 4, 5, 6 CpG sites in combination diagnosis compared with RA group in PsA and RA groups, respectively

From the above comparison, it was revealed that the AUC, sensitivity and specificity were higher in combination with 5 or 6 CpG sites than in combination with 4 CpG sites, so that 5 or 6 CpG sites were selected for the diagnosis of PsA in combination.

At present, the diagnosis of PsA is challenging mainly according to the medical history and clinical manifestations, and no reliable molecular marker exists in clinical application.

Sequence listing

<110> Xiangya II Hospital of Zhongnan university

<120> DNA methylation marker of psoriatic arthritis, diagnostic reagent and application thereof

<160> 15

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gggtgtagag tttagtagga gtt 23

<210> 2

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

aatcataaac ctcttcccct att 23

<210> 3

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gaagtagtta ttgaaggata g 21

<210> 4

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tagttgtggg aaaagtggag aa 22

<210> 5

<211> 27

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctcacaaaa tcataacaac ttttatt 27

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tgggaaaagt ggagaaa 17

<210> 7

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atggattgat atagggatta gattatttga 30

<210> 8

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

attattaccc tcctttcctc attc 24

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ttgaattttt aatttatagt ataag 25

<210> 10

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ggagattagt ttggtgaaaa tgatat 26

<210> 11

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

acctattaac ccaaccacta aatt 24

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

aggtagtatg tttagaatgt 20

<210> 13

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agaaatatgg tttagtgatt ttttaatgt 29

<210> 14

<211> 29

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aattctttat tcaattccta ataactacc 29

<210> 15

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gttattattg gtttgtgata ga 22

Claims

1. A DNA methylation marker for psoriatic arthritis comprising 6 methylation sites: one or more of chr14:38061326, chr14:38061320, chr9:128585454, chr6:37225002, chr3:101901234 and chr6: 97369501.

2. The DNA methylation marker of psoriatic arthritis according to claim 1, wherein the methylation level of 6 CpG sites in psoriatic arthritis patients is significantly increased compared to rheumatoid arthritis patients.

3. The DNA methylation marker of psoriatic arthritis according to claim 1, wherein the level of methylation at 6 CpG sites in psoriatic arthritis patients is significantly reduced compared to healthy control group.

4. Use of a product for detecting the methylation level of one or more of the 6 methylation sites of claim 1 in the manufacture of a formulation for the diagnosis of psoriatic arthritis.

5. The use of claim 4, wherein the product comprises PCR reagents and pyrosequencing reagents.

6. The use of claim 5, wherein the PCR reagent uses the following primer pairs:

primers containing chr14:38061326 and chr14:38061320 sites were amplified:

F1：GGGTGTAGAGTTTAGTAGGAGTT

R1：AATCATAAACCTCTTCCCCTATT

amplifying a primer containing a chr9:128585454 site:

F1：TAGTTGTGGGAAAAGTGGAGAA

R1：CCTCACAAAATCATAACAACTTTTATT

amplifying a primer containing a chr6:37225002 site:

F1：ATGGATTGATATAGGGATTAGATTATTTGA

R1：ATTATTACCCTCCTTTCCTCATTC

amplifying a primer containing a chr3:101901234 site:

F1：GGAGATTAGTTTGGTGAAAATGATAT

R1：ACCTATTAACCCAACCACTAAATT

amplifying a primer containing a chr6:97369501 site:

F1：AGAAATATGGTTTAGTGATTTTTTAATGT

R1：AATTCTTTATTCAATTCCTAATAACTACC。

7. the use of claim 5, wherein the product is formulated for detection of a test sample by analyzing sequencing results from a plurality of samples to obtain methylation levels of at least 2 CpG sites, and performing a binary Logistic regression analysis in combination with the methylation levels of at least 2 CpG sites.

8. The use according to claim 7, wherein a binary Logistic regression analysis combining the methylation levels of 6 CpG sites compared to rheumatoid arthritis and psoriatic arthritis gives the formula Y = -0.854 xA +0.530 xB-0.038 xC-0.012 xD +0.119 xE +0.156 xF-8.344, wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y values are more than-0.157, and diagnosing the psoriasis arthritis;

9. Use according to claim 7, characterized in that the methylation level of psoriatic arthritis in combination with 6 CpG sites is subjected to a binary Logistic regression analysis compared to healthy controls, yielding the formula Y = -0.448 xA-0.04 xB +0.018 xC-0.118 xD-0.08 xE-0.015 xF + 15.892; wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y value is more than 0.4708, and diagnosing the psoriasis arthritis;

10. An agent for diagnosing psoriatic arthritis comprising a product which detects the level of methylation of at least one of the 6 methylation sites of claim 1.

11. The reagent of claim 10, wherein the product is formulated for detection of a test sample by analyzing sequencing results from a plurality of samples to obtain methylation levels of at least 2 CpG sites and performing a binary Logistic regression analysis in combination with the methylation levels of at least 2 CpG sites.

12. The agent according to claim 11, wherein a binary Logistic regression analysis combining the methylation levels of 6 CpG sites compared to psoriatic arthritis and rheumatoid arthritis gives the formula Y = -0.854 x a +0.530 x B-0.038 x C-0.012 x D +0.119 x E +0.156 x F-8.344, wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y values are more than-0.157, and diagnosing the psoriasis arthritis;

13. The reagent according to claim 11,

binary Logistic regression analysis was performed in combination with the methylation levels of 6 CpG sites compared to healthy controls to give the formula Y = -0.448 xa-0.04 xb +0.018 xc-0.118 xd-0.08 xe-0.015 xf + 15.892; wherein A, B denotes chr14:38061326 and chr14: 38061320; c represents chr9: 128585454; d represents chr6: 37225002; e represents chr3: 101901234; f represents the value of the methylation level at the chr6:97369501 site; calculating corresponding Y values according to the methylation values of 6 CpG sites of the sample to be detected, wherein the Y value is more than 0.4708, and diagnosing the psoriasis arthritis;