CN112501223B - Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile - Google Patents
Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile Download PDFInfo
- Publication number
- CN112501223B CN112501223B CN202011319743.7A CN202011319743A CN112501223B CN 112501223 B CN112501223 B CN 112501223B CN 202011319743 A CN202011319743 A CN 202011319743A CN 112501223 B CN112501223 B CN 112501223B
- Authority
- CN
- China
- Prior art keywords
- reaction
- whole
- cell catalyst
- acetaldehyde
- solution
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
- C12P17/02—Oxygen as only ring hetero atoms
- C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/584—Recycling of catalysts
Abstract
The invention relates to a method for preparing 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, which takes acetaldehyde and chloroacetaldehyde as raw materials, and prepares the 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile in one step under the action of a whole-cell catalyst, solves the problems of complex synthetic route, higher cost, easy enzyme inactivation and the like in the prior art, and has the advantages of simple synthetic step, low raw material cost, high yield and purity, mild reaction conditions, environmental protection and wide application prospect.
Description
Technical Field
The invention belongs to the technical field of biological pharmacy, and particularly relates to a method for preparing 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile.
Background
Statins are inhibitors of 3-hydroxy-3-methylglutaryl coenzyme a (hmgcoa) reductase and are one of the prominent successful cases of modern pharmaceutical chemistry. In addition to their cholesterol-lowering ability, they have been found to have a number of other beneficial effects. Statins consist of chiral diol side chains appended to a cyclic fragment. Statins, originally discovered as microbial metabolites, have rapidly evolved into more potent synthetic analogs through partial modifications of their structure. Fully synthetic derivatives are often referred to as super statins. Since the side chain is an important component of all statins, there has been a great deal of research into the efficient construction of the side chain and the integration of the final structure.
The compound 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile is an important chiral intermediate for side chain synthesis, the precursor of the compound is prepared by DERA enzyme catalysis in a preparation route, Greenberg takes acetaldehyde, chloroacetaldehyde or cyanoacetaldehyde as a substrate, and the compound precursor is prepared by the DERA enzyme catalysis, the synthesis route is shown as follows, the catalytic efficiency of the enzyme reaches the standard of production (WO2004027075), the DERA enzyme is further characterized by professor in Zhejiang industry (Microbiol Biotechnol (2013)40:29-39), and the result shows that the catalytic efficiency of the enzyme is high, but the enzyme is easily affected by aldehyde to cause enzyme inactivation.
The research on DERA enzyme and Gcd enzyme catalyzing oxidation reaction is carried out by the university of Lubuyana college of pharmacy P.Mrak subject group, and the synthetic route is as follows: by coupling an oxidation reaction with a respiratory chain and introducing a metabolic engineering mechanism, an acetal reaction and an oxidation reaction are carried out by taking escherichia coli as engineering bacteria through whole cells, DERA enzyme and Gcd enzyme sequences participating in the reaction are optimized to obtain enzyme activity with production significance, ee value of a product catalyzed by the DERA enzyme reaches 99.9%, and the product is applied for patents by the Qianqi pharmacy (WO2008119810 and WO200909270), but the production cost is increased by step-by-step reaction.
In the prior art, the preparation of a compound 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile takes acetaldehyde and chloroacetaldehyde as starting raw materials, a two-step enzymatic one-step chemical method is needed, the process is complicated, and the yield is low; and acetaldehyde and cyanoacetaldehyde are used as initial raw materials, so that the cost of the raw materials is increased, the intermediate chemical method pollutes the environment, and the sewage treatment capacity is increased.
Disclosure of Invention
The invention aims to prepare 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile in one step under the action of bacteria for immobilized expression of aldolase DERA, dehydrogenase ADH and nitrile invertase as catalysts on the basis of the prior art, solves the problems of complex synthetic route, higher cost or easy enzyme inactivation and the like in the prior art, and has the advantages of simple synthetic steps, low raw material cost, high yield and purity, mild reaction conditions, environmental protection and wide application prospect.
The technical scheme of the invention is as follows:
a method for preparing 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile is characterized in that acetaldehyde and chloroacetaldehyde are used as raw materials, an aldolization reaction, an oxidation reaction and a cyanidation reaction are carried out at 20-40 ℃ in the presence of a whole-cell catalyst and NaCN, and a compound shown in a formula I is prepared in one step, wherein the whole-cell catalyst is a bacterium for immobilized expression of aldolase DERA, dehydrogenase ADH and nitrile invertase; the synthetic route for this reaction is as follows:
the invention uses aldolase DERA, dehydrogenase ADH and nitrile invertase in the form of whole-cell catalyst to catalyze acetaldehyde and chloroacetaldehyde to carry out aldolization, oxidation and cyanidation, thus preparing the compound shown in formula I in one step. The whole-cell catalyst is a bacterium which can be immobilized to express aldolase DERA, dehydrogenase ADH and nitrile invertase, and the bacterium can be, but is not limited to, Escherichia coli, Bacillus subtilis or yeast. For example, E.coli, in particular recombinant E.coli with the accession number DAC 0-003.
In a preferred embodiment, the aldolase DERA is carried out with the amino acid sequence SEQ ID NO.1, as follows: SEQ ID NO. 1:
in a preferred embodiment, the oxidation reaction is carried out with the dehydrogenase ADH having the amino acid sequence SEQ ID NO.1, as shown in detail below: SEQ ID NO. 2:
in a preferred embodiment, the cyanation reaction is carried out with the nucleotide sequence of nitrile invertase shown in SEQ ID NO.3, as follows: SEQ ID NO. 3:
in a preferable scheme, acetaldehyde and chloroacetaldehyde are used as raw materials, and when the compound shown in the formula I is prepared in the next step under the action of a whole-cell catalyst, the reaction temperature is 30-35 ℃. For example, 30 ℃ or 35 ℃.
For the present invention, aldolase DERA, dehydrogenase ADH and nitrile invertase are applied to the preparation of the compound represented by formula I in the form of whole-cell catalyst, wherein the immobilization method of the whole-cell catalyst is adsorption method or embedding method, and can be, but not limited to, calcium alginate embedding method or hydrogel embedding method. For example, recombinant Escherichia coli, numbered DAC0-003, is inoculated in LB liquid medium, after the culture is finished, the thalli are collected by centrifugation, UV irradiation is carried out to form colloid in the presence of DA-F127 and Irgacure2959, and the obtained colloid is cut into blocks to obtain immobilized cells, namely the whole cell catalyst mentioned in the invention.
The recombinant Escherichia coli is numbered DAC0-003, and the specific preparation method is as follows:
(1) f, R primer is designed and synthesized, EcoR I and Hind III enzyme cutting sites are added,
F:CCCAAGCTT ATGAATATTGCTAAAATGATAGATCATA
R:GGAATTCCTAGCTAGCGGATCCCTCTGGCATG
(2) the whole gene sequence was designed and synthesized to construct pUC57-Bind plasmid.
(3) Genes containing EcoR I and Hind III cleavage sites were amplified by PCR using as a template pUC57-Bind plasmid constructed by general-purpose whole-gene synthesis. The PCR conditions were: at 98 deg.C for 5min, at 95 deg.C for 30s, at 57 deg.C for 30s, at 72 deg.C for 90s, for 36 cycles.
PCR amplification System: 1.5 mu L of template, 1.5 mu L of upstream primer and downstream primer, 20.5 mu L of sterilized double distilled water, 25 mu L of PrimerSTAR Mix, electrophoresis test after PCR and gel cutting recovery, purchasing the commercial plasmid pRSF-Duet, carrying out enzyme digestion on the target fragment and PRSF-Duet by EcoR I and Hind III, and purifying and recovering the enzyme-digested product by a gel recovery kit (electrophoresis test and concentration of the recovered product). Connecting a target gene Bing with a vector PRSF-Duet, wherein the connection system comprises the following components: mu.L of the target gene, 2. mu.L of the vector PRSF-Duet, 2. mu.L of Buffer, 1. mu.L of ligase, and 16h of ligation. The constructed vector is introduced into E.coli BL21(DE3) by a transformation technology, is coated on an LB plate containing kanamycin, is put into an incubator at 37 ℃ overnight, and single colonies grown out are subjected to plasmid extraction and sequencing to finally obtain the recombinant engineering bacterium DAC0-003 containing the esterase gene.
According to the invention, acetaldehyde and chloroacetaldehyde are used as raw materials to perform an acetalation reaction, an oxidation reaction and a cyanidation reaction under the action of a whole-cell catalyst and NaCN to prepare the compound shown in the formula I in one step, wherein the coenzyme in the oxidation reaction is NADH, and the circulation route of the coenzyme is as follows:
the invention discloses a one-step method for preparing a compound shown as a formula I, which can comprise the following steps:
(1) inoculating escherichia coli, numbered DAC0-003, into an LB liquid culture medium, and after the culture is finished, centrifugally collecting thalli to prepare a thalli suspension;
(2) preparation of DA-F127: dissolving F127 in tetrahydrofuran, adding triethylamine, uniformly mixing, adding acryloyl chloride into the obtained mixed solution, and carrying out chemical reaction at the temperature of 0-30 ℃ to prepare a product DA-F127;
(3) uniformly mixing DA-F127 and Irgacure2959 prepared in the step (2) and the thallus suspension prepared in the step (1), irradiating UV to form colloid, and cutting the obtained colloid into blocks to obtain a whole-cell catalyst;
(4) acetaldehyde, chloroacetaldehyde, NaCN and dH in the presence of the whole-cell catalyst prepared in step (3) and NAD + 2 And O, carrying out an acetalation reaction, an oxidation reaction and a cyanidation reaction at the temperature of 20-40 ℃ to prepare the compound shown in the formula I in one step.
In step (2), the F127 referred to herein is poloxamer, under the trade name pluronic.
In a preferable embodiment, in the step (3), the mass ratio of DA-F127, Irgacure2959 and the bacteria in the bacteria suspension is 1: 0.8-1.2: 0.5-2.5, preferably 1:1: 0.8-2.0, and more preferably 1:1: 1.2.
Further, in the step (3), the DA-F127 prepared in the step (2) is dissolved in a PB buffer solution, Irgacure2959 is dissolved in DMSO, the obtained DA-F127 solution and Irgacure2959 solution are uniformly mixed with the thallus suspension prepared in the step (1), then UV irradiation is carried out to form colloid, and the obtained colloid is cut into blocks to obtain immobilized cells, namely the whole cell catalyst. Preferably, the concentration of the PB buffer mentioned herein is 0.1M and the pH is 7.0.
When DA-F127 is dissolved in PB buffer solution to prepare DA-F127 solution, the concentration of DA-F127 can be adjusted as required, for example, the concentration is 0.1-0.3 g/ml, preferably 0.125g/ml, and the specific preparation method is as follows: 1g DA-F127 was dissolved in 8mL PB buffer (0.1M, pH 7.0).
When the Irgacure2959 is dissolved in DMSO to prepare an Irgacure2959 solution, the concentration of the Irgacure2959 can be adjusted as needed, for example, the concentration is 0.1 to 0.5g/ml, preferably 0.3g/ml, and the specific preparation method is as follows: 1g of Irgacure2959 was dissolved in 3mL of DMSO.
In a preferred embodiment, in step (3), the concentration of the cells in the cell suspension may be, but is not limited to, 0.01 to 0.1g/ml, and specifically may be 0.01g/ml, 0.02g/ml, 0.03g/ml, 0.04g/ml, 0.05g/ml, 0.06g/ml, 0.07g/ml, 0.08g/ml, 0.09g/ml, or 0.1 g/ml.
When UV is irradiated to gel, the gel forming time can be 2-10 minutes, and preferably 3-9 minutes; may be, but is not limited to, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, or 10 minutes.
For the present invention, in the step (4), the mass ratio of the whole-cell catalyst, NAD + and acetaldehyde is 49000 to 51000:3:4900 to 5100, preferably 50000:3: 5000.
In a preferable scheme, in the step (4), the mass ratio of acetaldehyde to chloroacetaldehyde to NaCN is 1: 0.3-0.7: 0.2-0.6, and is preferably 1:0.5: 0.4.
In a preferred embodiment, the present invention provides a process for the preparation of 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile comprising the following more detailed steps:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: and F127 and tetrahydrofuran are added into an erlenmeyer flask, after the tetrahydrofuran and the tetrahydrofuran are completely dissolved, anhydrous magnesium sulfate is added to remove water in the mixed solution, the erlenmeyer flask is placed at the temperature of 20-40 ℃ for one day, and the magnesium sulfate in the mixed solution is removed through filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding triethylamine, uniformly mixing, adding a tetrahydrofuran solution of acryloyl chloride with the volume fraction of 10-12% by using an injector, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Uniformly mixing DA-F127, Irgacure2959 and the thallus suspension prepared in the step (1), irradiating the mixture to form colloid by UV, and cutting the obtained colloid into blocks to obtain the whole-cell catalyst.
(4) Adding the whole-cell catalyst prepared in the step (3) into a reaction kettle, and then adding ddH 2 O, NAD + and NaCN, after being mixed uniformly, adding acetaldehyde and chloroacetaldehyde into the mixture to be mixed uniformly, carrying out an acetal reaction, an oxidation reaction and a cyanidation reaction at 30-35 ℃, after the reaction is finished, separating out a whole-cell catalyst, extracting the filtrate with ethyl acetate, and carrying out reduced pressure distillation to obtain the target compound 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile.
By adopting the technical scheme of the invention, the advantages are as follows:
according to the invention, acetaldehyde and chloroacetaldehyde are used as raw materials, and 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile is prepared in one step under the action of a whole-cell catalyst, so that the problems of complex synthetic route, high cost, easy enzyme inactivation and the like in the prior art are solved, and the method has the advantages of simple synthetic steps, low raw material cost, high yield and purity, mild reaction conditions, environmental friendliness and wide application prospect.
Detailed Description
The preparation process of the present invention is further illustrated by the following examples, which are not intended to limit the invention in any way.
Example 1:
the recombinant Escherichia coli is constructed with the number of DAC0-003, and the preparation method comprises the following steps:
(1) f, R primer is designed and synthesized, EcoR I and Hind III enzyme cutting sites are added,
F:CCCAAGCTT ATGAATATTGCTAAAATGATAGATCATA
R:GGAATTCCTAGCTAGCGGATCCCTCTGGCATG
(2) the whole gene sequence is designed and synthesized to construct pUC57-Bind plasmid, and the sequence is as follows:
(3) genes containing EcoR I and Hind III cleavage sites were amplified by PCR using as a template pUC57-Bind plasmid constructed by general-purpose whole-gene synthesis. The PCR conditions were: at 98 deg.C for 5min, at 95 deg.C for 30s, at 57 deg.C for 30s, at 72 deg.C for 90s, for 36 cycles.
PCR amplification System: 1.5 mu L of template, 1.5 mu L of upstream primer and downstream primer, 20.5 mu L of sterilized double distilled water, 25 mu L of PrimerSTAR Mix, electrophoresis test after PCR and gel cutting recovery, purchasing the commercial plasmid pRSF-Duet, carrying out enzyme digestion on the target fragment and PRSF-Duet by EcoR I and Hind III, and purifying and recovering the enzyme-digested product by a gel recovery kit (electrophoresis test and concentration of the recovered product). Connecting a target gene Bing with a vector PRSF-Duet, wherein the connection system comprises the following components: mu.L of the target gene, 2. mu.L of the vector PRSF-Duet, 2. mu.L of Buffer, 1. mu.L of ligase, and 16h of ligation. The constructed vector is introduced into E.coli BL21(DE3) by a transformation technology, is coated on an LB plate containing kanamycin, is put into an incubator at 37 ℃ overnight, and single colonies grown out are subjected to plasmid extraction and sequencing to finally obtain the recombinant engineering bacterium DAC0-003 containing the esterase gene.
Example 2:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of tetrahydrofuran solution with 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.06g/ml, irradiating UV for 3min to gelatinize, and cutting the obtained colloid into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN, and after uniformly mixing, carrying out an acetalization reaction, an oxidation reaction and a cyanidation reaction in sequence at 30-35 ℃, wherein the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 63 percent, and the purity is 98 percent.
Example 3:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of tetrahydrofuran solution with 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.06g/ml, irradiating UV for 6min to gelatinize, and cutting the obtained colloid into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN, and after uniformly mixing, carrying out an acetalization reaction, an oxidation reaction and a cyanidation reaction in sequence at 30-35 ℃, wherein the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 80% and the purity is 99.2%.
Example 4:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of tetrahydrofuran solution with 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.06g/ml, irradiating UV for 9min to form gel, and cutting the obtained gel into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN, and after uniformly mixing, carrying out an acetalization reaction, an oxidation reaction and a cyanidation reaction in sequence at 30-35 ℃, wherein the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 69% and the purity is 97.5%.
Example 5:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of tetrahydrofuran solution with 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.04g/ml, irradiating UV for 6min to gelatinize, and cutting the obtained colloid into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN, and after uniformly mixing, carrying out an acetalization reaction, an oxidation reaction and a cyanidation reaction in sequence at 30-35 ℃, wherein the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 71 percent, and the purity is 96.6 percent.
Example 6:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice-water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of tetrahydrofuran solution with 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting at 0 ℃ for 1h, continuing to react at 30 ℃ for 24h, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.08g/ml, irradiating UV for 6min to gelatinize, and cutting the obtained colloid into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + After 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN are uniformly mixed, an acetalization reaction, an oxidation reaction and a cyanidation reaction are sequentially carried out at the temperature of 30-35 ℃, and the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 84 percent, and the purity is 98.9 percent.
Example 7:
(1) escherichia coli, numbered DAC0-003, was inoculated into LB liquid medium, and after completion of the culture, the cells were collected by centrifugation to prepare a cell suspension.
(2) Preparation of DA-F127: 3g F127 and 10ml of tetrahydrofuran were weighed respectively and added to a 50ml Erlenmeyer flask, after complete dissolution, 2g of anhydrous magnesium sulfate was added to remove water in the mixed solution, and after standing at 20 to 40 ℃ for one day, magnesium sulfate in the mixed solution was removed by filtration. And (3) placing the filtered mixed solution containing F127 in an ice water bath at 0 ℃, adding 300 mu l of triethylamine, uniformly mixing, adding 3mL of a tetrahydrofuran solution containing 10.4% of acryloyl chloride by volume fraction by using a syringe, and then sealing. After reacting for 1h at 0 ℃, continuing to react for 24h at 30 ℃, centrifuging to remove precipitate, and removing THF by rotary evaporation to obtain the product DA-F127.
(3) Dissolving DA-F127 prepared in the step (2) in a PB buffer solution to prepare a DA-F127 solution (1g of DA-F127 is dissolved in 8ml of 0.1M PB buffer solution with the pH value of 7.0), dissolving Irgacure2959 in DMSO to prepare an Irgacure2959 solution (1g of Irgacure2959 is dissolved in 3ml of DMSO), uniformly mixing the obtained DA-F127 solution, the obtained Irgacure2959 solution and 20ml of the bacterial suspension prepared in the step (1) at 0.1g/ml, irradiating UV for 6min to gelatinize, and cutting the obtained colloid into blocks to obtain immobilized cells, namely the whole cell catalyst.
(4) 50g of immobilized cells were added to a reaction vessel, and 1L of ddH was added 2 O，3mg NAD + 5g of acetaldehyde, 2.5g of chloroacetaldehyde and 2g of NaCN, and after uniformly mixing, carrying out an acetalization reaction, an oxidation reaction and a cyanidation reaction in sequence at 30-35 ℃, wherein the reaction time is 30 hours. After the reaction is finished, separating out the immobilized cells, extracting twice with 50mLEA (50 mL is used for each extraction), adding 10.0g of anhydrous sodium sulfate, drying, filtering, and concentrating under reduced pressure to obtain the compound shown in the formula I, namely 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile, wherein the yield is 76% and the purity is 95.2%.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: modifications of the technical solutions described in the foregoing embodiments are still possible, or some technical features may be equivalently replaced; and the modifications or the substitutions do not make the essence of the corresponding technical solutions depart from the scope of the technical solutions of the embodiments of the present invention.
Sequence listing
<110> Jiangsu alpha pharmaceutical Co., Ltd
<120> Process for the preparation of 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 665
<211> DNA
<213> Escherichia coli
<400> 1
atgaatattg ctaaaatgat agatcatacc ctactaaagc cagaggctac agagcaacaa 60
attgttcaac tgtgtactga agccaagcag tacggttttg ccgctgtctg tgttaacccc 120
acttgggtta agacagctgc cagggaatta tctggtaccg acgttagagt gtgtactgta 180
atcggatttc cattaggggc cactacgcca gaaaccaagg cttttgagac gacaaacgct 240
atagaaaacg gtgctcgtga agtagatatg gtcattaata taggtgcatt gaaatcaggt 300
caagacgaat tggtcgaacg agatattcgt gccgtcgtcg aagctgccgc aggacgagcc 360
ttggttaagg tcatagtaga aaccgctttg ctaacagatg aggagaaggt cagagcatgt 420
cagctagctg taaaagctgg agcagactat gtgaagacta gtacaggatt ttcaggtgga 480
ggtgctacag ttgaggacgt tgcccttatg agaaaaactg ttggagatag agctggcgtc 540
aaggcatctg gtggtgttcg tgactggaaa accgctgagg ccatgattaa tgctggcgct 600
actcgtattg gtacttcctc cggagtggct atcgtcactg gcggtaccgg gcgtgctgac 660
actga 665
<210> 2
<211> 1128
<211> DNA
<213> Escherichia coli
<400> 2
atgagcaccg caggtaaagt gattaaatgt aaagcagcag ttctgtggga agagaaaaaa 60
ccgtttagca ttgaagaagt tgaagttgca ccgcctaaag cacatgaagt tcgcattaaa 120
atggttgcca ccggtatttg tcgtagtgat gatcatgttg ttagcggcac cctggttaca 180
ccgctgccgg ttattgcagg tcatgaagca gcaggtattg ttgaaagcat tggtgaaggt 240
gttaccaccg ttcgtccggg tgataaagtt attccgctgt ttacaccgca gtgtggtaaa 300
tgtcgtgttt gtaaacatcc ggaaggtaac ttttgcctga aaaatgatct gagcatgcct 360
cgtggcacca tgcaggatgg caccagccgt tttacctgtc gtggtaaacc gattcatcat 420
tttctgggca ccagcacctt tagccagtat accgttgttg atgaaattag cgtggccaaa 480
attgatgcag caagtccgct ggaaaaagtt tgtctgattg gttgtggttt tagcaccggt 540
tatggtagcg cagttaaagt tgccaaagtt acccagggta gcacctgtgc agtttttggt 600
ttaggtggtg ttggtctgag cgttattatg ggttgcaaag cagccggtgc agcacgtatt 660
attggtgttg atattaacaa agataaattt gcgaaagcca aagaggttgg cgcaaccgaa 720
tgtgttaatc cgcaggatta caaaaaaccg atccaagagg ttctgaccga aatgagcaat 780
ggtggtgtgg attttagctt tgaagttatt ggtcgtctgg ataccatggt taccgcactg 840
agctgttgtc aagaggcata tggtgttagc gttattgttg gtgttccgcc tgatagccag 900
aatctgagta tgaatccgat gctgctgctg agcggtcgta cctggaaagg tgccattttt 960
ggtggtttta aaagcaaaga tagcgtgccg aaactggttg cagattttat ggcgaaaaaa 1020
ttcgcactgg acccgctgat tacccatgtt ctgccgtttg aaaaaatcaa cgaaggtttt 1080
gatctgctgc gtagcggtga aagtattcgt accattctga ccttttaa 1128
<210> 3
<211> 777
<211> DNA
<213> Escherichia coli
<400> 3
atgagcactg caattgtgac aaacgtgaag cattttggcg gcatgggtag cgcgctgaaa 60
ctgagcgagg cgggtcacac ggtggcctgt cacgatgaaa gctttaaaca tcaggacgag 120
ctggaagctt ttgccgaaac ctatcctcag ctgattccta tcagcgaaca ggagccggtt 180
gaactgatag aggccgtgaa cagcgcactg ggtcatgtgg acattctggt gagcaatgat 240
atagctccgg ttgaatggcg tccgatagac gaatacactg ttgaagatta ccgtgatatg 300
attgaagcgc tgcagattaa accatttgcg ctggctaatg cggttgctac tcagatgaaa 360
cgccgcaaaa gcggtcatat tatttttatc acgagcgctg cgagctttgg tccttggaaa 420
gaactgagca catacgcgag cgcacgcgct ggcaccagcg cactggcaaa tgccctgagc 480
aaagagctgg gtgaatataa catcccagtt tttgcaatcg cacctaatgc agtggatagc 540
ggcgatagcc cgtactatta tccaagcgaa ccttggaaaa tcagcccgga gcacgttgca 600
tgggttcgca agtatacggc cctgcaacgt ctgggcacac aaaaggaact gggtgaactg 660
gttaccttcc tggccagcgg cagctgcgat tatctgaccg gccaagtgtt ccgtttcgcc 720
ggtggtttcc cggttgtgga gcgttggccg ggcatgccag agggatccgc tagctag 777
Claims (15)
1. The method for preparing 2- ((2S, 4S) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) acetonitrile is characterized in that acetaldehyde and chloroacetaldehyde are used as raw materials, and an acetal reaction, an oxidation reaction and a cyanidation reaction are carried out at 20-40 ℃ in the presence of a whole-cell catalyst and NaCN to prepare a compound shown in a formula I in one step, wherein the whole-cell catalyst is a bacterium for immobilizing and expressing aldolase DERA, dehydrogenase ADH and nitrile invertase; the synthetic route for this reaction is as follows:
wherein the nucleotide sequence of the aldolase DERA is shown as SEQ ID NO.1, and the nucleotide sequence of the dehydrogenase ADH is shown as SEQ ID NO. 2; the nucleotide sequence of the nitrile invertase is shown in SEQ ID NO. 3.
2. The method of claim 1, wherein the bacterium is Escherichia coli or Bacillus subtilis.
3. The method of claim 2, wherein the bacterium is Escherichia coli.
4. The method according to claim 2, wherein the reaction temperature is 30 to 35 ℃.
5. The method according to claim 2, wherein the whole-cell catalyst is immobilized by an entrapment method.
6. The method according to claim 5, wherein the whole-cell catalyst is immobilized by calcium alginate or hydrogel encapsulation.
7. The method of claim 1, wherein the coenzyme in the oxidation reaction is NADH and the coenzyme is recycled as follows:
8. method according to any one of claims 2 to 6, characterized in that it comprises the following steps:
(1) inoculating escherichia coli into an LB liquid culture medium, and after the culture is finished, centrifugally collecting thalli to prepare a thalli suspension;
(2) preparation of DA-F127: dissolving F127 in tetrahydrofuran, adding triethylamine, uniformly mixing, adding acryloyl chloride into the obtained mixed solution, and carrying out chemical reaction at the temperature of 0-30 ℃ to prepare a product DA-F127;
(3) uniformly mixing DA-F127 and Irgacure2959 prepared in the step (2) and the thallus suspension prepared in the step (1), irradiating UV to form colloid, and cutting the obtained colloid into blocks to obtain a whole-cell catalyst;
(4) acetaldehyde, chloroacetaldehyde, NaCN and dH in the presence of the whole-cell catalyst prepared in step (3) and NAD + 2 And O, carrying out an acetalation reaction, an oxidation reaction and a cyanidation reaction at the temperature of 30-35 ℃ to prepare the compound shown in the formula I in one step.
9. The method according to claim 8, wherein in the step (3), the mass ratio of DA-F127, Irgacure2959 to the cells in the cell suspension is 1:0.8 to 1.2:0.5 to 2.5.
10. The method according to claim 9, wherein in the step (3), the mass ratio of DA-F127, Irgacure2959 to the cells in the cell suspension is 1:1: 0.8-2.0.
11. The method according to claim 9, wherein in the step (3), the mass ratio of DA-F127, Irgacure2959 to the cells in the cell suspension is 1:1: 1.2.
12. The method according to claim 9, 10 or 11, wherein in the step (3), the DA-F127 prepared in the step (2) is dissolved in a PB buffer solution, the Irgacure2959 is dissolved in DMSO, and the obtained DA-F127 solution and the Irgacure2959 solution are uniformly mixed with the bacterial suspension prepared in the step (1).
13. The method of claim 12, wherein the PB buffer has a concentration of 0.1M and a pH of 7.0.
14. The method according to claim 8, wherein in the step (4), the mass ratio of the acetaldehyde to the chloroacetaldehyde to the NaCN is 1:0.3 to 0.7:0.2 to 0.6; the mass ratio of the whole-cell catalyst to the NAD + to the acetaldehyde is 49000-51000: 3: 4900-5100.
15. The method as claimed in claim 14, wherein in the step (4), the mass ratio between acetaldehyde, chloroacetaldehyde and NaCN is 1:0.5: 0.4; the mass ratio of the whole-cell catalyst to the NAD + to the acetaldehyde is 45000: 3: 5000.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011319743.7A CN112501223B (en) | 2020-11-23 | 2020-11-23 | Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011319743.7A CN112501223B (en) | 2020-11-23 | 2020-11-23 | Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112501223A CN112501223A (en) | 2021-03-16 |
| CN112501223B true CN112501223B (en) | 2022-08-12 |
Family
ID=74959425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011319743.7A Active CN112501223B (en) | 2020-11-23 | 2020-11-23 | Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112501223B (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004027075A2 (en) * | 2002-09-20 | 2004-04-01 | Diversa Corporation | Chemoenzymatic methods for the synthesis of statins and stain intermediates |
| CN1780826A (en) * | 2003-05-02 | 2006-05-31 | 帝斯曼知识产权资产管理有限公司 | Process for the preparation of (4-hydroxy-6-oxo-tetrahydropyran-2-yl) acetonitrile and derivatives thereof |
| WO2007137816A1 (en) * | 2006-05-30 | 2007-12-06 | Dsm Ip Assets B.V. | Process for the preparation of epoxide intermediates for pharmaceutical compounds such as statins |
| CN101952453A (en) * | 2008-01-23 | 2011-01-19 | 力奇制药公司 | ((2S,4R)-4,6-dihydroxytetrahydro-2H-pyran-2-yl)methyl carboxylate and process for the production thereof |
| CN104388488A (en) * | 2014-10-28 | 2015-03-04 | 尚科生物医药（上海）有限公司 | Preparation of (3R,5R)-6-cyan-3,5-dihydroxy ter-butyl caproate employing immobilized whole-cell catalysis |
| CA3020916A1 (en) * | 2016-04-16 | 2017-10-19 | Zymtronix Catalytic Systems, Inc. | Magnetic macroporous polymeric hybrid scaffolds for immobilizing bionanocatalysts |
-
2020
- 2020-11-23 CN CN202011319743.7A patent/CN112501223B/en active Active
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2004027075A2 (en) * | 2002-09-20 | 2004-04-01 | Diversa Corporation | Chemoenzymatic methods for the synthesis of statins and stain intermediates |
| CN1780826A (en) * | 2003-05-02 | 2006-05-31 | 帝斯曼知识产权资产管理有限公司 | Process for the preparation of (4-hydroxy-6-oxo-tetrahydropyran-2-yl) acetonitrile and derivatives thereof |
| WO2007137816A1 (en) * | 2006-05-30 | 2007-12-06 | Dsm Ip Assets B.V. | Process for the preparation of epoxide intermediates for pharmaceutical compounds such as statins |
| CN101952453A (en) * | 2008-01-23 | 2011-01-19 | 力奇制药公司 | ((2S,4R)-4,6-dihydroxytetrahydro-2H-pyran-2-yl)methyl carboxylate and process for the production thereof |
| CN104388488A (en) * | 2014-10-28 | 2015-03-04 | 尚科生物医药（上海）有限公司 | Preparation of (3R,5R)-6-cyan-3,5-dihydroxy ter-butyl caproate employing immobilized whole-cell catalysis |
| CA3020916A1 (en) * | 2016-04-16 | 2017-10-19 | Zymtronix Catalytic Systems, Inc. | Magnetic macroporous polymeric hybrid scaffolds for immobilizing bionanocatalysts |
Non-Patent Citations (2)
| Title |
|---|
| An aldolase for the synthesis of the statin side chain;Martin Schumann;《Industrial Enzyme Applications》;20191231;第385-403页 * |
| Chemoenzymatic preparation of (S)-p-nitreostyrene oxide from p-nitrophenacyl bromide by recombinant Escherichia coli cells expressing a novel halohydrin dehalogenase;Die Hu et al;《Catalysis Communications》;20150603;第69卷;第72-75页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112501223A (en) | 2021-03-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107653238B (en) | Carbonyl reductase gene engineering bacterium immobilized cell and application thereof | |
| JP6720420B2 (en) | Use in the preparation of (S)-α-ethyl-2-oxo-1-pyrrolidine acetate by methylopira and its selective resolution | |
| CN104774881A (en) | Method for producing L-2-aminobutyric acid by virtue of biological catalysis | |
| CN110387359B (en) | Carbonyl reductase mutant and application thereof | |
| CN107557412B (en) | Method for catalytically synthesizing NADPH by immobilized enzyme | |
| CN106995808A (en) | One kind restructuring transaminase and its application | |
| CN112662658A (en) | Production of L-phenylpyruvic acid by immobilized recombinant escherichia coli using L-phenylalanine | |
| CN110106130B (en) | Transaminase-coenzyme co-immobilized engineering bacteria cell and application thereof | |
| CN102827853B (en) | Halogenohydrin dehalogenation enzyme gene mutant and application thereof | |
| CN109371070A (en) | A kind of method of high yield α-ketoisovaleric acid | |
| CN112501223B (en) | Process for the preparation of 2- ((2R, 4R) -4-hydroxy-6-oxotetrahydro-2H-pyran-2-yl) -acetonitrile | |
| CN104059952A (en) | Method for catalyzing immobilized whole-cell compositions to synthesize (S)-N-t-butyloxycarbonyl-3-hydroxypiperidine | |
| CN104212850A (en) | Method for preparing 1-cyancyclohexylacetic acid by using nitrilase engineering bacterium | |
| CN104830744A (en) | Method for preparing (R)-phenylglycol from SD-AS sequence coupled (R)-carbonyl reductase and glucose dehydrogenase | |
| CN113249364B (en) | Industrial fermentation production method of whole cell containing glutamate decarboxylase | |
| CN112143692B (en) | Lovastatin ester hydrolase recombinant strain, construction method and application | |
| CN110791536B (en) | Biosynthesis method of levodopa | |
| JP2005533497A (en) | Coupled enzyme reaction system based on two-phase alcohol dehydrogenase | |
| CN116254279B (en) | Method for catalyzing xylitol to biosynthesize L-xylose by using double-enzyme cascade recombinant escherichia coli | |
| CN113897322B (en) | Engineering bacterium of 3-methyl-4-nitrobenzoic acid and preparation method thereof | |
| CN111676256A (en) | Biological preparation method of L-tert-leucine | |
| CN1668753A (en) | Coupled enzymatic reaction system using a formate dehydrogenase derived from candida boidinii | |
| CN115896186A (en) | Multi-enzyme catalysis method for synthesizing hydroxytyrosol | |
| CN117778281A (en) | Recombinant genetic engineering bacterium and preparation method of (R) -2- (1-aminoethyl) -4-fluorophenol | |
| CN112941124A (en) | Method for preparing eligerstrode intermediate through whole-cell catalysis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 223800 No.5, Yanshan Road, eco Chemical Technology Industrial Park, Suqian City, Jiangsu Province Applicant after: Jiangsu alpha Pharmaceutical Co.,Ltd. Address before: 223800 No.5, Yanshan Road, eco Chemical Technology Industrial Park, Suqian City, Jiangsu Province Applicant before: JIANGSU ALPHA PHARMACEUTICAL Co.,Ltd. |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant |