CN110387359B

CN110387359B - Carbonyl reductase mutant and application thereof

Info

Publication number: CN110387359B
Application number: CN201810343484.8A
Authority: CN
Inventors: 陶荣盛; 朱傅赟; 沈青; 郑云; 潘震华; 沈正权; 孙梁栋; 刘萍; 王亚夫
Original assignee: Huzhou Yisheng Biotechnology Co Ltd
Current assignee: Huzhou Yisheng Biotechnology Co., Ltd
Priority date: 2018-04-17
Filing date: 2018-04-17
Publication date: 2021-04-20
Anticipated expiration: 2038-04-17
Also published as: CN110387359A

Abstract

The invention discloses a carbonyl reductase mutant constructed by a point mutation method, and the amino acid sequence of the mutant is selected from SEQ ID NO. 2-4. Compared with wild carbonyl reductase derived from Candida magnoliae ifo 0705 strain, the carbonyl reductase mutant provided by the invention has the advantages that the enzyme activity is remarkably improved, the asymmetric reduction of tbutyl 6-cyano- (5R) -hydroxy-3-carbonylhexanoate into tbutyl 6-cyano- (3R,5R) -dihydroxyhexanoate can be efficiently catalyzed, and the asymmetric reduction of tbutyl (S) -6-chloro-5-hydroxy-3-carbonylhexanoate into tbutyl 6-chloro- (3R,5S) -dihydroxyhexanoate can be catalyzed, so that a statin compound intermediate is produced.

Description

Carbonyl reductase mutant and application thereof

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a carbonyl reductase mutant constructed by a point mutation method and application thereof in producing statin compound intermediates.

Background

Atorvastatin and rosuvastatin are the most common statin lipid regulating drugs in clinic, belong to HMG-CoA reductase inhibitors, are used for treating hypercholesterolemia, mixed hyperlipidemia, coronary heart disease and cerebral apoplexy, and are important basic drugs for preventing and treating cardiovascular and cerebrovascular diseases at home and abroad. For example, the drug "lipitor" with atorvastatin as the active ingredient was sold annually in excess of $ 100 billion and was the most commercially marketed drug.

As important chiral compound intermediates of statins, atorvastatin intermediate 6-cyano- (3R,5R) -tert-butyl dihydroxyhexanoate shown as formula A7 (CAS number: 125971-93-9), tert-butyl (4R,6R) -6-cyanomethyl-2, 2-dimethyl-1, 3-dioxolane-acetate shown as formula A8 (CAS number: 125971-94-0, atorvastatin calcium side chain ATS-8) and rosuvastatin intermediate 6-chloro- (3R,5S) -tert-butyl dihydroxyhexanoate shown as formula D3 (CAS number: 154026-93-4) are generally prepared by a chemical synthesis method mainly by a chemical carbonyl substrate asymmetric reduction method. Specifically, borohydride is used as a reducing agent, and chiral catalysts such as chiral oxazaborolidine and transition metal complexes are used for catalyzing asymmetric carbonyl reduction of a latent chiral substrate. The technology has the advantages of difficult control of stereospecificity, insufficient diastereoinduction in the reaction process and low optical purity of the product; the reaction needs hydrogenation under the condition of deep cooling, and the equipment requirement is high; the chiral catalyst is expensive and the production cost is high; boron hydride is flammable and explosive, has great potential safety hazard, and boride waste generated by reaction is difficult to treat, thus not conforming to the concept of green chemistry. Since the chemical synthesis method has the disadvantages of large environmental pollution and high production cost, the biological enzyme catalysis method is gradually combined with the chemical method to replace the chemical method.

However, the catalytic activity of currently used enzymes such as carbonyl reductase and glucose dehydrogenase is generally low, resulting in large enzyme dosage in catalytic reaction, affecting extraction yield, and still high production cost.

Therefore, there is an urgent need in the art to develop an enzyme having high catalytic activity, thereby reducing production costs and pollution.

Disclosure of Invention

In order to obtain carbonyl reductase with higher enzyme activity, the invention utilizes genetic engineering technology to transform and screen wild carbonyl reductase (SEQ ID NO:1) derived from Candida magnoliae ifolia ifo 0705, and constructs carbonyl reductase mutant with high enzyme activity, thereby realizing industrialization of producing statin drug intermediates by enzyme method.

Accordingly, a first object of the present invention is to provide a highly enzymatically active carbonyl reductase, the amino acid sequence of which is selected from the group consisting of SEQ ID NOS: 2-4:

wherein, the SEQ ID NO. 2 is a mutant of which the 95 th phenylalanine F of the SEQ ID NO. 1 is replaced by isoleucine I, and the amino acid sequence is as follows:

MSTPLNALVTGASRGIGAATAIKLAENGYSVTLAARNVAKLNEVKEKLPVVKDGQKHHIWELDLASVEAASSFKGAPLPASDYDLFVSNAGIAQITPTADQTDKDFLNILTVNLSSPIALTKALLKGVSERSNEKPFHIIFLSSAAALHGVPQTAVYSASKAGLDGFVRSLAREVGPKGIHVNVIHPGWTKTDMTDGIDDPNDTPIKGWIQPEAIADAVVFLAKSKNITGTNIVVDNGLLA(SEQ ID NO:2)；

wherein, SEQ ID NO. 3 is a mutant of SEQ ID NO. 1 in which phenylalanine F at position 95 is replaced by isoleucine I and threonine T at position 154 is replaced by alanine A, and the amino acid sequence thereof is as follows:

MSTPLNALVTGASRGIGAATAIKLAENGYSVTLAARNVAKLNEVKEKLPVVKDGQKHHIWELDLASVEAASSFKGAPLPASDYDLFVSNAGIAQITPTADQTDKDFLNILTVNLSSPIALTKALLKGVSERSNEKPFHIIFLSSAAALHGVPQAAVYSASKAGLDGFVRSLAREVGPKGIHVNVIHPGWTKTDMTDGIDDPNDTPIKGWIQPEAIADAVVFLAKSKNITGTNIVVDNGLLA(SEQ ID NO:3)；

SEQ ID NO. 4 is a mutant in which the 129 th serine S of SEQ ID NO. 3 is replaced by arginine R and the 145 th alanine A is replaced by valine V, and the amino acid sequence of the mutant is as follows:

MSTPLNALVTGASRGIGAATAIKLAENGYSVTLAARNVAKLNEVKEKLPVVKDGQKHHIWELDLASVEAASSFKGAPLPASDYDLFVSNAGIAQITPTADQTDKDFLNILTVNLSSPIALTKALLKGVRERSNEKPFHIIFLSSVAALHGVPQAAVYSASKAGLDGFVRSLAREVGPKGIHVNVIHPGWTKTDMTDGIDDPNDTPIKGWIQPEAIADAVVFLAKSKNITGTNIVVDNGLLA(SEQ ID NO:4)；

wherein the amino acid sequence of SEQ ID NO. 1 is:

MSTPLNALVTGASRGIGAATAIKLAENGYSVTLAARNVAKLNEVKEKLPVVKDGQKHHIWELDLASVEAASSFKGAPLPASDYDLFVSNAGIAQFTPTADQTDKDFLNILTVNLSSPIALTKALLKGVSERSNEKPFHIIFLSSAAALHGVPQTAVYSASKAGLDGFVRSLAREVGPKGIHVNVIHPGWTKTDMTDGIDDPNDTPIKGWIQPEAIADAVVFLAKSKNITGTNIVVDNGLLA(SEQ ID NO:1)。

preferably, the amino acid sequence of the carbonyl reductase is SEQ ID NO. 4.

It is a second object of the present invention to provide a gene encoding the carbonyl reductase mutant.

In a preferred embodiment, the gene encoding the carbonyl reductase mutant of SEQ ID NO. 2 is SEQ ID NO. 5:

atgtctacgccgctgaatgctctggtgacgggtgcttctcgtggtattggtgctgcgaccgcgatcaaactggccgaaaacggttacagcgtgaccctggcggcccgtaacgtcgcaaaactgaatgaagtgaaagaaaaactgccggtggttaaagatggccagaaacatcacatttgggaactggacctggcctctgtcgaagctgctagctcttttaaaggcgcaccgctgccggcttcagattatgacctgtttgtttcgaacgcaggtatcgcacagatcaccccgacggcggatcaaaccgataaagacttcctgaacattctgacggtgaatctgagttccccgatcgcgctgaccaaagccctgctgaaaggcgttagtgaacgctccaatgaaaaaccgtttcatattatcttcctgtcatcggcagcagcactgcacggtgtgccgcagacggcagtttacagcgcgtctaaagccggcctggatggttttgttcgttcactggctcgcgaagtcggcccgaaaggtattcatgttaacgtcatccacccgggctggaccaaaacggatatgaccgacggtattgatgacccgaatgatacgccgattaaaggttggattcagccggaagctatcgcggacgccgtcgtgttcctggcgaaatcaaaaaacatcacgggcacgaacattgtggtggataacggtctgctggcgtga(SEQ IDNO:5)。

in a preferred embodiment, the gene encoding the carbonyl reductase mutant of SEQ ID NO. 3 is SEQ ID NO. 6:

atgtctacgccgctgaatgctctggtgacgggtgcttctcgtggtattggtgctgcgaccgcgatcaaactggccgaaaacggttacagcgtgaccctggcggcccgtaacgtcgcaaaactgaatgaagtgaaagaaaaactgccggtggttaaagatggccagaaacatcacatttgggaactggacctggcctctgtcgaagctgctagctcttttaaaggcgcaccgctgccggcttcagattatgacctgtttgtttcgaacgcaggtatcgcacagatcaccccgacggcggatcaaaccgataaagacttcctgaacattctgacggtgaatctgagttccccgatcgcgctgaccaaagccctgctgaaaggcgttagtgaacgctccaatgaaaaaccgtttcatattatcttcctgtcatcggcagcagcactgcacggtgtgccgcaggcggcagtttacagcgcgtctaaagccggcctggatggttttgttcgttcactggctcgcgaagtcggcccgaaaggtattcatgttaacgtcatccacccgggctggaccaaaacggatatgaccgacggtattgatgacccgaatgatacgccgattaaaggttggattcagccggaagctatcgcggacgccgtcgtgttcctggcgaaatcaaaaaacatcacgggcacgaacattgtggtggataacggtctgctggcgtga(SEQ IDNO:6)。

in a preferred embodiment, the gene encoding the carbonyl reductase mutant of SEQ ID NO. 4 is SEQ ID NO. 7:

atgtctacgccgctgaatgctctggtgacgggtgcttctcgtggtattggtgctgcgaccgcgatcaaactggccgaaaacggttacagcgtgaccctggcggcccgtaacgtcgcaaaactgaatgaagtgaaagaaaaactgccggtggttaaagatggccagaaacatcacatttgggaactggacctggcctctgtcgaagctgctagctcttttaaaggcgcaccgctgccggcttcagattatgacctgtttgtttcgaacgcaggtatcgcacagatcaccccgacggcggatcaaaccgataaagacttcctgaacattctgacggtgaatctgagttccccgatcgcgctgaccaaagccctgctgaaaggcgttagggaacgctccaatgaaaaaccgtttcatattatcttcctgtcatcggtagcagcactgcacggtgtgccgcaggcggcagtttacagcgcgtctaaagccggcctggatggttttgttcgttcactggctcgcgaagtcggcccgaaaggtattcatgttaacgtcatccacccgggctggaccaaaacggatatgaccgacggtattgatgacccgaatgatacgccgattaaaggttggattcagccggaagctatcgcggacgccgtcgtgttcctggcgaaatcaaaaaacatcacgggcacgaacattgtggtggataacggtctgctggcgtga(SEQ IDNO:7)。

the third object of the present invention is to provide a plasmid containing the above gene.

The fourth object of the present invention is to provide a microorganism transformed with the above plasmid. The microorganism may be selected from Bacillus subtilis, Lactobacillus brevis, Candida magnoliae, Pichia pastoris, Saccharomyces cerevisiae, and Escherichia coli.

Preferably, the microorganism is escherichia coli BL21(DE 3).

The fifth purpose of the invention is to provide the application of the carbonyl reductase mutant or the microorganism expressing the carbonyl reductase mutant in producing statin intermediates. Such intermediates include, but are not limited to, tbutyl 6-cyano- (3R,5R) -dihydroxyhexanoate (CAS number: 125971-93-9), (4R,6R) -6-cyanomethyl-2, 2-dimethyl-1, 3-dioxolane-acetate (CAS number 125971-94-0, atorvastatin calcium side chain ATS-8), tbutyl 6-chloro- (3R,5S) -dihydroxyhexanoate (CAS number: 154026-93-4).

In the production of tbutyl 6-cyano- (3R,5R) -dihydroxyhexanoate (CAS number: 125971-93-9), the reaction was catalyzed using tbutyl (R) -6-cyano-5-hydroxy-3-oxohexanoate (CAS number: 125988-01-4) represented by formula A6 as a substrate starting material and the carbonyl reductase mutant or microorganism expressing it as a catalyst.

In the production of tert-butyl 6-chloro- (3R,5S) -dihydroxyhexanoate, tert-butyl (S) -6-chloro-5-hydroxy-3-oxohexanoate represented by the formula D2 (CAS number: 154026-92-3) was used as a substrate raw material, and the above carbonyl reductase mutant or microorganism expressing the same was used as a catalyst to catalyze the reaction.

In one embodiment, the reaction is performed with glucose dehydrogenase, glucose and NADP⁺In the presence of (a).

The amino acid sequence of the glucose dehydrogenase is preferably SEQ ID NO: 8:

MYPDLKGKVVAITGAASGLGKAMAIRFGKEQAKVVINYYSNKQDPNEVKEEVIKAGGEAVVVQGDVTKEEDVKNIVQTAIKEFGTLDIMINNAGLENPVPSHEMPLKDWDKVIGTNLTGAFLGSREAIKYFVENDIKGNVINMSSVHEVIPWPLFVHYAASKGGIKLMTRTLALEYAPKGIRVNNIGPGAINTPINAEKFADPKQKADVESMIPMGYIGEPEEIAAVAAWLASKEASYVTGITLFADGGMTLYPSFQAGRG(SEQ ID NO:8)。

preferably, tert-butyl 6-cyano- (3R,5R) -dihydroxyhexanoate can be further synthesized by chemical reaction, for example with 2, 2-dimethoxypropane and methanesulfonic acid, to give tert-butyl (4R,6R) -6-cyanomethyl-2, 2-dimethyl-1, 3-dioxolane-acetate (CAS number 125971-94-0).

Compared with the wild enzyme SEQ ID NO. 1, the carbonyl reductase mutant SEQ ID NO. 2-4 of the invention has greatly improved enzyme activity, high stereospecificity for atorvastatin intermediate substrates and rosuvastatin intermediate substrates, and great industrialization prospect.

Drawings

FIG. 1 is a photograph of a TLC spot plate tracing after CRHZ and 3 mutants catalyzed compound A6 for 4 h;

FIG. 2 is a photograph of a TLC spot plate tracing after CRHZ and 3 mutant catalytic compound D2 were reacted for 4 h.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

The addition amount, content and concentration of various substances are referred to herein, wherein the percentage refers to the mass percentage unless otherwise specified.

In the present invention, the terms "carbonyl reductase mutant", "mutant carbonyl reductase" and "mutant enzyme" mean the same meaning, and all refer to a mutant of carbonyl reductase. For the sake of brevity, the "carbonyl reductase mutant" may be referred to herein simply as "carbonyl reductase" as long as it is not confused with the wild-type carbonyl reductase SEQ ID NO: 1.

In the present invention, the terms "wild-type carbonyl reductase", "wild carbonyl reductase" and "wild carbonyl reductase" are used synonymously and refer to the wild-type carbonyl reductase or CRHZ (SEQ ID NO: 1).

For simplicity of description, the "carbonyl reductase" is sometimes referred to herein simply as "CRHZ", and they have the same meaning and may be used interchangeably. "glucose dehydrogenase" is sometimes abbreviated as "GDH", and they have the same meaning and may be used interchangeably.

Since the amino acid sequences of the carbonyl reductase and glucose dehydrogenase of the present invention are well-defined, those skilled in the art can easily obtain the genes encoding them, expression cassettes and plasmids containing the genes, and transformants containing the plasmids.

These genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction means well known to those skilled in the art.

When used as a biocatalyst for the production of atorvastatin and rosuvastatin intermediates, the carbonyl reductase and glucose dehydrogenase of the present invention may be in the form of an enzyme or in the form of a bacterial cell. The enzyme forms comprise free enzyme and immobilized enzyme, including purified enzyme, crude enzyme, fermentation liquor, enzyme immobilized by a carrier and the like; the form of the thallus comprises a viable thallus and a dead thallus.

The carbonyl reductase and glucose dehydrogenase of the present invention are also well known to those skilled in the art, including the techniques for preparing immobilized enzymes.

Examples

Materials and methods

The whole gene synthesis, primer synthesis and sequencing in the examples were performed by Nanjing Kingsler Biotechnology Ltd.

The molecular biological experiments in the examples include plasmid construction, enzyme digestion, competent cell preparation, transformation, and the like, which are mainly performed with reference to molecular cloning, a guide to experiments (third edition), J. SammBruk, D.W. Lassel (America), Huangpeitang, et al, science publishers, Beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.

LB culture medium: 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride, pH7.2, and high temperature and high pressure sterilizing at 121 deg.C for 20 min;

TB culture medium: 24g/L yeast extract, 12g/L tryptone, 16.43g/L K₂HPO₄.3H₂O、2.31g/L KH₂PO₄5g/L of glycerol, pH7.0-7.5, and sterilizing at 121 deg.C for 20 min;

slant culture medium: mixing 10g/L tryptone, 5g/L yeast extract, 10g/L sodium chloride and 20g/L agar powder, subpackaging the mixture into eggplant bottles according to the liquid loading amount of 30-40mL, vertically placing the eggplant bottles at 121 ℃ for high-temperature high-pressure sterilization for 20min, cooling, adding 100 mu g/mL kanamycin sulfate, placing the eggplant bottles into an inclined plane, and condensing the eggplant bottles into a solid.

Fermentation culture

Seed activation: taking a glycerol preservation pipe of the seeds, taking 100 mu L of seed preservation solution, uniformly coating an eggplant bottle inclined plane with an inoculating loop, and then putting the eggplant bottle inclined plane into a 37 ℃ incubator for overnight culture (18 h);

seed culture: introducing 100mL of sterile water into an eggplant bottle to prepare a bacterial suspension, taking 50 mu l of the bacterial suspension, inoculating into a 250mL shake flask containing 50mL of TB medium, and culturing at 30 ℃ and 220rpm for 16 h;

fermentation: inoculating the primary seed culture solution into 5L shake flask containing 1L TB medium, culturing at 37 deg.C and 220rpm for 4-6 hr, adding 0.3mM IPTG, cooling to 28 deg.C, and inducing at 220rpm for 12 hr.

And (3) collecting thalli: collecting fermentation liquor, centrifuging at 4000rpm for 30min, removing supernatant, collecting bacterial sludge, and freezing at-20 deg.C for storage.

Preparation of enzyme solution: respectively weighing 5g of GDH, CRHZ and mutant bacterial sludge thereof, adding 20mL of deionized water for resuspension, ultrasonically crushing cells, centrifuging the crushed liquid at 12000rpm for 10min, taking supernatant, namely enzyme liquid, and placing the enzyme liquid in an ice bath for later use.

EXAMPLE 1 construction of recombinant Escherichia coli having wild-type Carbonyl Reductase (CRHZ) Gene

Codon optimization for E.coli expression was performed according to the amino acid sequence of carbonyl reductase CRHZ derived from Candida magnoliae IFO 0705 as provided in patent EP1152054A1, and the gene sequence was entirely gene-synthesized, enzyme cleavage sites NdeI and EcoRI were designed at both ends, and subcloned into the corresponding sites on the vector pET24a (available from Novagen), thereby obtaining recombinant plasmid pET24 a-CRHZ. And transforming the constructed recombinant plasmid pET24a-CRHZ into an escherichia coli expression host BL21(DE3) by a calcium chloride method to obtain the recombinant escherichia coli BL21(DE3)/pET24a-CRHZ for expressing the wild carbonyl reductase.

The codon-optimized gene sequence is (SEQ ID NO: 9):

atgtctacgccgctgaatgctctggtgacgggtgcttctcgtggtattggtgctgcgaccgcgatcaaactggccgaaaacggttacagcgtgaccctggcggcccgtaacgtcgcaaaactgaatgaagtgaaagaaaaactgccggtggttaaagatggccagaaacatcacatttgggaactggacctggcctctgtcgaagcagctagctcttttaaaggcgcaccgctgccggcttcagattatgacctgtttgtttcgaacgcaggtatcgctcagttcaccccgacggcggatcaaaccgataaagacttcctgaacattctgacggtgaatctgagttccccgatcgcgctgaccaaagccctgctgaaaggcgttagtgaacgctccaatgaaaaaccgtttcatattatcttcctgtcatcggcagcagcactgcacggtgtgccgcagacggcagtttacagcgcgtctaaagccggcctggatggttttgttcgttcactggctcgcgaagtcggcccgaaaggtattcatgttaacgtcatccacccgggctggaccaaaacggatatgaccgacggtattgatgacccgaatgatacgccgattaaaggttggattcagccggaagctatcgcggacgccgtcgtgttcctggcgaaatcaaaaaacatcacgggcacgaacattgtggtggataacggtctgctggcgtga(SEQ ID NO:9)。

the amino acid sequence is determined as SEQ ID NO 1.

Example 2 construction of glucose dehydrogenase GDH-expressing Strain

Bacillus subtilis strain.168 was inoculated into LB liquid medium and cultured at 30 ℃ and 220rpm for 24 hours. The extraction of total DNA was performed according to the genome extraction kit (purchased from Shanghai Co., Ltd. in Biotechnology).

According to the reported gene sequence of glucose dehydrogenase GDH derived from Bacillus subtilis str.168 (NCBI accession number: AL009126.3), primers were designed as follows:

forward primer GDH-F: 5'-CGGGATCCATGTATCCGGATTTAAAAG-3' (BamHI) in the sample,

reverse primer GDH-R: 5'-CCCAAGCTTTTAACCGCGGCCTGCCTGG-3' (HindIII).

The PCR reaction system comprises: GDH-F and GDH-R each 50pmol, total DNA 100ng, 1 XKOD plus buffer, 0.2mM dNTP, 25mM MgSO₄KOD plus 2U, water was added to 50. mu.L of the total system.

The PCR amplification conditions were: the reaction is repeated for 30 cycles at 95 ℃ for 5min, 94 ℃ for 45s, 55 ℃ for 45s and 68 ℃ for 1min, and the reaction is carried out at 68 ℃ for 10 min.

After the PCR reaction, agarose gel electrophoresis was used for analysis, and a specific band of about 800bp was detected as the desired band. The PCR amplification product was recovered using a small amount of gel recovery kit, digested with BamHI and HindIII at 37 ℃ for 3-6 hours, purified and recovered by column chromatography. And connecting the recovered product with an expression vector pET24a subjected to the same enzyme digestion treatment at 16 ℃ overnight by using T4DNA ligase, transforming E.coli DH5 alpha competent cells, and selecting a transformant for sequencing verification to obtain a recombinant plasmid.

Site-directed mutagenesis is carried out on the 252 th site and the 170 th site of the GDH amino acid sequence, glutamic acid (E) at the 170 th site is mutated into arginine (R), and glutamine (Q) at the 252 th site is mutated into leucine (L). Primers were designed based on the amino acid to be mutated and the mutation sites E170R, Q252L, and the mutation was carried out by the MEGA WHOP method (Arnold and Georgiou 2003). Primers were designed as follows:

forward primer GDHE 170R-F: AAGCTGATGACACGAACATTAGCGTT the flow of the air in the air conditioner,

reverse primer GDHQ 252L-R: AATGAAGGATATAGTGTCATACCGC are provided.

The primers were used to amplify a sequence containing the mutation site Q252L/E170R. The PCR reaction system comprises:

50pmol each of GDHE170R-F and GDHQ252L-R, 50ng of plasmid template pET24a-GDH, 1 XKOD plus buffer, 0.2mM dNTP, 25mM MgSO₄KOD plus 2U, water was added to 50. mu.L of the total system.

The PCR amplification conditions were: repeating 30 cycles of 95 deg.C for 5min, 94 deg.C for 45s, 55 deg.C for 45s, and 68 deg.C for 30s, and 68 deg.C for 10 min. After the PCR reaction, agarose gel electrophoresis was used for analysis, and a specific band of about 250bp was detected as the desired band. And recovering the PCR amplification product by using a small-amount gel recovery kit. Taking the PCR product as a large primer, taking pET24a-GDH as a template, and adopting high-fidelity DNA polymerase KOD plus to perform full-plasmid linear amplification, wherein the PCR reaction system comprises: 50-100pmol of the large primer fragment, 50ng of the plasmid template pET24a-GDH, 1 XKOD plus buffer, 0.2mM dNTP, 25mM MgSO 2₄KOD plus 2U, water was added to 50. mu.L of the total system.

The PCR amplification conditions were: 5min at 95 ℃, 45s at 94 ℃, 45s at 55 ℃ and 6min at 68 ℃, repeating 25 cycles for 10min at 68 ℃. After the amplification was completed, DpnI was added to the system and the plasmid template was removed by digestion at 37 ℃, and then the digestion product was directly transformed into e.coli BL21(DE3) competent cells. The clone was picked for sequencing verification, and the correctly sequenced strain was named BL21(DE3)/pET24 a-GDH.

The gene sequence is as follows:

atgtatccggatttaaaaggaaaagtcgtcgctattacaggagctgcttcagggctcggaaaggcgatggccattcgcttcggcaaggagcaggcaaaagtggttatcaactattatagtaataaacaagatccgaacgaggtaaaagaagaggtcatcaaggcgggcggtgaagctgttgtcgtccaaggagatgtcacgaaagaggaagatgtaaaaaatatcgtgcaaacggcaattaaggagttcggcacactcgatattatgattaataatgccggtcttgaaaatcctgtgccatctcacgaaatgccgctcaaggattgggataaagtcatcggcacgaacttaacgggtgcctttttaggaagccgtgaagcgattaaatatttcgtagaaaacgatatcaagggaaatgtcattaacatgtccagtgtgcacgaagtgattccttggccgttatttgtccactatgcggcaagtaaaggcgggataaagctgatgacacgaacattagcgttggaatacgcgccgaagggcattcgcgtcaataatattgggccaggtgcgatcaacacgccaatcaatgctgaaaaattcgctgaccctaaacagaaagctgatgtagaaagcatgattccaatgggatatatcggcgaaccggaggagatcgccgcagtagcagcctggcttgcttcgaaggaagccagctacgtcacaggcatcacgttattcgcggacggcggtatgacactatatccttcattccaggcaggccgcggttaa(SEQ ID NO:10)。

the amino acid sequence is determined as SEQ ID NO 8.

Example 3 construction of error-prone PCR and random mutation library

The coding gene of CRHZ is used as a template, and an error-prone PCR and large primer PCR technology is applied to construct a random mutant library. Primers were designed as follows:

forward primer CRHZerr-F: 5' -GTTTAACTTTAAGAAGGAGATATAC;

reverse primer CRHZerr-R: 5'-CTTGTCGACGGAGCTCGAAT-3' are provided.

The 100. mu.L error-prone PCR reaction system comprises: 50ng plasmid template, 0.2. mu.M each of a pair of primers CRHZerr-F and CRHZerr-R, 1 XTaq buffer, 0.2mM dGTP, 0.2mM dATP, 1mM dCTP, 1mM dTTP, 7mM MgCl₂，(0.2mM,0.3mM,0.4mM)MnCl₂，1U Taq。

The PCR reaction conditions are as follows: 95 ℃ for 5 min; 30s at 94 ℃, 30s at 55 ℃, 1min at 72 ℃ and 40 cycles; 7min at 72 ℃. Gel 1kb random mutant fragment was recovered as large primer and Megaprimer PCR was performed with KOD FXneo DNA polymerase: 94 ℃, 2min, 68 ℃ for 10 min; at 98 ℃ for 10s, at 55 ℃ for 30s, at 68 ℃ for 3min, for 25 cycles; 10min at 68 ℃.

Adding DpnI into PCR product, digesting at 37 deg.C to remove plasmid template, purifying, recovering, electrically transforming Escherichia coli E.coli BL21(DE3), adding 1mLLB culture medium, recovering at 37 deg.C for 1h, coating Kan plate, culturing at 37 deg.C overnight to obtain product with purity over 10⁴A pool of random mutants of individual clones.

Example 4 high throughput screening of CRHZ mutants

Inoculating the transformant in the mutant library into a 96-hole deep-hole culture plate containing 200 mu L of LB culture medium by using a toothpick, culturing for more than 6h at 37 ℃ and 220rpm, wherein the Kan (kanamycin) content is 100 mu g/mL; 200. mu.L of LB + 100. mu.g/mL, Kan +0.6mM IPTG medium was added to each well, and cultured overnight at 220rpm at 28 ℃.

Inducing overnight 96-well plate to shake and beat thallus, transferring 15 μ L bacterial liquid to another 96-well plate, freezing at-70 deg.C for 1-2 hr, and thawing at 37 deg.C for 20 min. Adding 100 mu L of water into each hole for dilution, shaking and uniformly mixing, absorbing 15 mu L of diluted enzyme liquid into each hole, transferring the enzyme liquid to another 96-hole plate, adding 185 mu L/hole of chromogenic reaction liquid (60g/L glucose, 1.8g/L EDTA, 8.4g/L triethanolamine, 6 mu L of compound A6, 9 mu L isopropanol, 46 mu L methyl red, 5 mu L4000U/mL GDH enzyme liquid, 0.05g/L NADP +, pH 7.0), reacting at 37 ℃ and 180rpm for 1.5h to observe color change, and detecting the mutant with red color from a corresponding mother plate for re-screening and enzyme activity determination.

Preparing methyl red: 0.1g of methyl red is dissolved in 100mL of 60% ethanol.

The enzyme activity determination method comprises the following steps: 0.5g of triethanolamine, 24g of glucose and 25g of compound A6 are weighed into a 250mL beaker, and 25mL of water is added, stirred uniformly and heated to 30 ℃. With 20% of H₂SO₄The pH was adjusted to 7.0, the carbonyl reductase enzyme solution (2.5mL) and the GDH enzyme solution (1.39mL) were added, respectively, and NADP was added finally⁺(0.315mL) to start the reaction, dropwise adding 1M sodium carbonate solution during the reaction to control the pH to be 7.0, and characterizing the enzyme activity by the amount of the dropwise added sodium carbonate solution for 1 hour.

By the screening method, a mutant CRHZ18 with improved enzyme activity is screened from a mutant library which takes a CRHZ coding gene as a template; then, a random mutant library is reconstructed by taking the CRHZ18 encoding gene as a template, and the mutant 154A6 with further improved enzyme activity is screened out by the same screening method; repeating the above operation steps, and continuously carrying out random mutation and directional screening on the basis of 154A6 to finally obtain a mutant 246G12 with greatly improved enzyme activity.

Carbonyl reductasesMutant numbering	Mutation site (compared to CRHZ)	SEQ ID NO:
			CRHZ18	F95I	2
154A6	F95I,T154A	3
			246G12	F95I,T154A,S129R,A145V	4

Example 5 comparison of the catalytic Activity of wild type CRHZ and 3 mutants against Compound A6

5.1, an experimental method:

1) 0.5g of triethanolamine, 24g of glucose and 25g of compound A6 are weighed into a 250mL beaker, and 25mL of water is added, stirred uniformly and heated to 30 ℃.

2) With 20% of H₂SO₄The pH was adjusted to 7.0, the carbonyl reductase enzyme solution (1.25mL) and the GDH enzyme solution (1.39mL) were added, respectively, and NADP was added finally⁺The reaction was started (0.315mL), the pH was controlled at 7.0 with 1M sodium carbonate solution and the addition was recorded over time. Follow the reaction by TLC.

3) Wherein the carbonyl reductase added in the 1# reaction is CRHZ; the carbonyl reductase added in the 2# reaction is CRHZ 18; carbonyl reductase added in the 3# reaction is 154A 6; the carbonyl reductase added in reaction # 4 was 246G 12.

5.2, experimental data: since 1 molecule of gluconic acid is generated by converting 1 molecule of the substrate A6, 0.5 molecule of sodium carbonate is needed, so the using speed of the sodium carbonate solution represents the speed of the catalytic reaction and the enzyme activity.

5.2.1, addition comparison of sodium carbonate solution:

the above results show that when catalyzing the reduction of a6, the enzyme activities of mutant 154a6 and mutant 246G12 were greatly improved as compared with the wild-type enzyme CRHZ, and for example, when reacting for 1h, the enzyme activity of mutant 154a6 was shown to be 2 times as high as that of the wild-type enzyme, while the enzyme activity of mutant 246G12 was shown to be 7 times as high as that of the wild-type enzyme. At reaction time 4h, mutant 154A6 showed 2-fold more enzyme activity than the wild type, while mutant 246G12 showed 4-fold more enzyme activity than the wild type.

5.2.2, TLC spot plate:

referring to FIG. 1, TLC detection also demonstrated that 246G12 reacted most rapidly and that the substrate had reacted to completion after 4 hours of reaction.

5.2.3 chiral assay

Due to the high detection requirement of the product A7, the chiral detection is carried out after the compound A8 is further synthesized in production. The specific method comprises the following steps:

and (3) when the reactions of No. 1, No. 2 and No. 3 continue to react for 16h, the TLC detection is complete, and the reacted feed liquid is respectively treated according to the following steps:

step 1: adding 250mL of ethyl acetate and 25g of diatomite into the reacted feed liquid, heating to 50-60 ℃, filtering, demixing, extracting the water layer twice with 150mL of ethyl acetate, combining the organic layers, and concentrating to obtain a crude product of the compound A7, which is an oily substance.

The oily substance obtained in step 1, 25g of 2, 2-dimethoxypropane, 50mL of toluene and 0.2g of methanesulfonic acid were put into a flask, and the mixture was heated to 25 ℃ and reacted for 3 hours while maintaining the temperature. After completion of the reaction, 100mL of toluene was added, and a saturated aqueous solution of sodium hydrogencarbonate was added to neutralize the pH to 7.5, and the aqueous layer was separated and the dry organic layer was concentrated. Adding 75mL of hexane, heating to dissolve, cooling to 0 ℃, crystallizing, and filtering to obtain a crude compound A8. Then recrystallizing with mixed solvent of n-hexane (50mL) and ethanol (2.5mL), filtering, and drying to obtain compound A8.

Chiral analysis of compound A8:

a detection instrument: agilent 1200 type high performance liquid chromatograph

Liquid phase mobile phase: n-hexane: isopropyl alcohol thickness 98: 2

Wavelength λ 215nm, flow rate 0.6mL/min, solvent: a mobile phase;

a chromatographic column: chiralcel OD-H250 is multiplied by 4.6mm and 5 mu m;

sample introduction amount: 20 μ l, column temperature: 30 ℃, run time: and (6) taking 28 min.

The retention time of the compound A8 is about 19.8 min; the retention time of the 4R, 6S-isomer is about 14.1 min; the retention time of the 4S, 6S-isomer is about 15.5 min; the retention time of the 4S, 6R-isomer is about 16.9 min.

And (3) sample analysis: 200mg of A8 sample obtained by respectively catalyzing and treating CRHZ 1#, CRHZ18 2#, 154A6 3#, and 246G12 4#, is weighed and placed in a 10ml volumetric flask, dissolved by a solvent, subjected to constant volume, and shaken up to obtain a sample solution. A sample solution (20. mu.L) was taken and injected into a liquid chromatograph for detection.

The results show that under the condition of liquid phase chiral analysis, the content of enantiomer 4S, 6S-isomer in 4 samples does not exceed 0.02%, and other isomers are not detected. The wild type CRHZ and 3 mutants constructed by the invention are shown to have high stereospecificity for a substrate A6.

Example 6 comparison of catalytic Activity of wild type CRHZ and 3 mutants against Compound D2

6.1, experimental method:

1) 0.5g of triethanolamine, 24g of glucose and 25g of substrate compound D2 are weighed into a 250mL beaker, and 25mL of water are added, stirred uniformly and heated to 30 ℃.

2) With 20% of H₂SO₄The pH was adjusted to 7.0, the carbonyl reductase enzyme solution (1.25mL) and the GDH enzyme solution (1.39mL) were added, respectively, and NADP was added finally⁺(0.315ml) the reaction was started, the pH was controlled at 7.0 with 1M sodium carbonate solution and the amount of base added was recorded over time. Follow the reaction by TLC.

6.2, experimental data: since 1 molecule of gluconic acid is generated by converting 1 molecule of the substrate D2, 0.5 molecule of sodium carbonate is needed, so the using speed of the sodium carbonate solution represents the speed of the catalytic reaction and the enzyme activity.

6.2.1, comparison of alkali addition amount:

the above results show that when catalyzing the reduction of D2, the enzyme activities of mutant 154a6 and mutant 246G12 were greatly improved as compared to the wild-type enzyme CRHZ, and for example, when reacting for 1h, the enzyme activity of mutant 154a6 was shown to be more than 3 times that of the wild-type enzyme, while the enzyme activity of mutant 246G12 was shown to be 8 times that of the wild-type enzyme. At reaction time 4h, mutant 154A6 showed nearly 4-fold higher enzyme activity than the wild type, while mutant 246G12 showed 4-fold higher enzyme activity than the wild type.

6.2.2, TLC spot plate:

referring to FIG. 2, TLC detection also demonstrated that 246G12 reacted most rapidly and that the substrate had reacted to completion after 4 hours of reaction.

6.2.3 liquid phase and chiral detection

A detection instrument: agilent model 1200 hplc.

The detection method of the product of the invention comprises the following steps:

HPLC column: ZORBAX SB-C8, 4.6X 150mm, 5-Micron,

mobile phase: 30% acetonitrile, flow rate: 1.0mL/min of the reaction solution,

column temperature: 40 ℃, detection wavelength: 210 nm.

Product D3 retention time: about 7.1 min; substrate D2 retention time: about 12.0 min.

The liquid phase detection and conversion result of 4h shows that the substrate conversion rate corresponds to the amount of the sodium carbonate solution, and is respectively 22.7%, 48.26%, 84.6% and 99.7%;

for detecting chirality, a chiral chromatography OD-H column (250X 4.6mm, 5 μm) was used, and the mobile phase: n-hexane: isopropanol 85: 15, flow rate 1mL/min, detection wavelength 215 nm. The retention times of compound D3 and the (3S,5S) -isomer were 5.1min and 4.9min, respectively. The detection result shows that the ee values of the products catalyzed and reduced by CRHZ, CRHZ18, 154A6 and 246G12 are all over 99.9 percent, which indicates that the wild type CRHZ and 3 mutants constructed by the invention have high stereospecificity for a substrate D2.

In conclusion, the carbonyl reductase mutant SEQ ID NO 2-4 is constructed, compared with wild carbonyl reductase, the enzyme activities of the two mutants are obviously improved, and the carboxide reductase mutant has high stereospecificity on substrate atorvastatin intermediate 6-cyano- (3R,5R) -tert-butyl dihydroxyhexanoate and rosuvastatin intermediate 6-chloro- (3R,5S) -tert-butyl dihydroxyhexanoate, and has wide industrial prospect.

Sequence listing

<110> Yihui Biotech Ltd of Huzhou

<120> carbonyl reductase mutant and use thereof

<130> SHPI810323

<160> 10

<170> SIPOSequenceListing 1.0

<210> 1

<211> 241

<212> PRT

<213> Candida magnoliae ifo 0705

<400> 1

Met Ser Thr Pro Leu Asn Ala Leu Val Thr Gly Ala Ser Arg Gly Ile

1 5 10 15

Gly Ala Ala Thr Ala Ile Lys Leu Ala Glu Asn Gly Tyr Ser Val Thr

20 25 30

Leu Ala Ala Arg Asn Val Ala Lys Leu Asn Glu Val Lys Glu Lys Leu

35 40 45

Pro Val Val Lys Asp Gly Gln Lys His His Ile Trp Glu Leu Asp Leu

50 55 60

Ala Ser Val Glu Ala Ala Ser Ser Phe Lys Gly Ala Pro Leu Pro Ala

65 70 75 80

Ser Asp Tyr Asp Leu Phe Val Ser Asn Ala Gly Ile Ala Gln Phe Thr

85 90 95

Pro Thr Ala Asp Gln Thr Asp Lys Asp Phe Leu Asn Ile Leu Thr Val

100 105 110

Asn Leu Ser Ser Pro Ile Ala Leu Thr Lys Ala Leu Leu Lys Gly Val

115 120 125

Ser Glu Arg Ser Asn Glu Lys Pro Phe His Ile Ile Phe Leu Ser Ser

130 135 140

Ala Ala Ala Leu His Gly Val Pro Gln Thr Ala Val Tyr Ser Ala Ser

145 150 155 160

Lys Ala Gly Leu Asp Gly Phe Val Arg Ser Leu Ala Arg Glu Val Gly

165 170 175

Pro Lys Gly Ile His Val Asn Val Ile His Pro Gly Trp Thr Lys Thr

180 185 190

Asp Met Thr Asp Gly Ile Asp Asp Pro Asn Asp Thr Pro Ile Lys Gly

195 200 205

Trp Ile Gln Pro Glu Ala Ile Ala Asp Ala Val Val Phe Leu Ala Lys

210 215 220

Ser Lys Asn Ile Thr Gly Thr Asn Ile Val Val Asp Asn Gly Leu Leu

225 230 235 240

Ala

<210> 2

<211> 241

<212> PRT

<213> Artificial sequence ()

<400> 2

Met Ser Thr Pro Leu Asn Ala Leu Val Thr Gly Ala Ser Arg Gly Ile

1 5 10 15

Gly Ala Ala Thr Ala Ile Lys Leu Ala Glu Asn Gly Tyr Ser Val Thr

20 25 30

Leu Ala Ala Arg Asn Val Ala Lys Leu Asn Glu Val Lys Glu Lys Leu

35 40 45

Pro Val Val Lys Asp Gly Gln Lys His His Ile Trp Glu Leu Asp Leu

50 55 60

Ala Ser Val Glu Ala Ala Ser Ser Phe Lys Gly Ala Pro Leu Pro Ala

65 70 75 80

Ser Asp Tyr Asp Leu Phe Val Ser Asn Ala Gly Ile Ala Gln Ile Thr

85 90 95

Pro Thr Ala Asp Gln Thr Asp Lys Asp Phe Leu Asn Ile Leu Thr Val

100 105 110

Asn Leu Ser Ser Pro Ile Ala Leu Thr Lys Ala Leu Leu Lys Gly Val

115 120 125

Ser Glu Arg Ser Asn Glu Lys Pro Phe His Ile Ile Phe Leu Ser Ser

130 135 140

Ala Ala Ala Leu His Gly Val Pro Gln Thr Ala Val Tyr Ser Ala Ser

145 150 155 160

Lys Ala Gly Leu Asp Gly Phe Val Arg Ser Leu Ala Arg Glu Val Gly

165 170 175

Pro Lys Gly Ile His Val Asn Val Ile His Pro Gly Trp Thr Lys Thr

180 185 190

Asp Met Thr Asp Gly Ile Asp Asp Pro Asn Asp Thr Pro Ile Lys Gly

195 200 205

Trp Ile Gln Pro Glu Ala Ile Ala Asp Ala Val Val Phe Leu Ala Lys

210 215 220

Ser Lys Asn Ile Thr Gly Thr Asn Ile Val Val Asp Asn Gly Leu Leu

225 230 235 240

Ala

<210> 3

<211> 241

<212> PRT

<213> Artificial sequence ()

<400> 3

Met Ser Thr Pro Leu Asn Ala Leu Val Thr Gly Ala Ser Arg Gly Ile

1 5 10 15

Gly Ala Ala Thr Ala Ile Lys Leu Ala Glu Asn Gly Tyr Ser Val Thr

20 25 30

Leu Ala Ala Arg Asn Val Ala Lys Leu Asn Glu Val Lys Glu Lys Leu

35 40 45

Pro Val Val Lys Asp Gly Gln Lys His His Ile Trp Glu Leu Asp Leu

50 55 60

Ala Ser Val Glu Ala Ala Ser Ser Phe Lys Gly Ala Pro Leu Pro Ala

65 70 75 80

Ser Asp Tyr Asp Leu Phe Val Ser Asn Ala Gly Ile Ala Gln Ile Thr

85 90 95

Pro Thr Ala Asp Gln Thr Asp Lys Asp Phe Leu Asn Ile Leu Thr Val

100 105 110

Asn Leu Ser Ser Pro Ile Ala Leu Thr Lys Ala Leu Leu Lys Gly Val

115 120 125

Ser Glu Arg Ser Asn Glu Lys Pro Phe His Ile Ile Phe Leu Ser Ser

130 135 140

Ala Ala Ala Leu His Gly Val Pro Gln Ala Ala Val Tyr Ser Ala Ser

145 150 155 160

Lys Ala Gly Leu Asp Gly Phe Val Arg Ser Leu Ala Arg Glu Val Gly

165 170 175

Pro Lys Gly Ile His Val Asn Val Ile His Pro Gly Trp Thr Lys Thr

180 185 190

Asp Met Thr Asp Gly Ile Asp Asp Pro Asn Asp Thr Pro Ile Lys Gly

195 200 205

Trp Ile Gln Pro Glu Ala Ile Ala Asp Ala Val Val Phe Leu Ala Lys

210 215 220

Ser Lys Asn Ile Thr Gly Thr Asn Ile Val Val Asp Asn Gly Leu Leu

225 230 235 240

Ala

<210> 4

<211> 241

<212> PRT

<213> Artificial sequence ()

<400> 4

Met Ser Thr Pro Leu Asn Ala Leu Val Thr Gly Ala Ser Arg Gly Ile

1 5 10 15

Gly Ala Ala Thr Ala Ile Lys Leu Ala Glu Asn Gly Tyr Ser Val Thr

20 25 30

Leu Ala Ala Arg Asn Val Ala Lys Leu Asn Glu Val Lys Glu Lys Leu

35 40 45

Pro Val Val Lys Asp Gly Gln Lys His His Ile Trp Glu Leu Asp Leu

50 55 60

Ala Ser Val Glu Ala Ala Ser Ser Phe Lys Gly Ala Pro Leu Pro Ala

65 70 75 80

Ser Asp Tyr Asp Leu Phe Val Ser Asn Ala Gly Ile Ala Gln Ile Thr

85 90 95

Pro Thr Ala Asp Gln Thr Asp Lys Asp Phe Leu Asn Ile Leu Thr Val

100 105 110

Asn Leu Ser Ser Pro Ile Ala Leu Thr Lys Ala Leu Leu Lys Gly Val

115 120 125

Arg Glu Arg Ser Asn Glu Lys Pro Phe His Ile Ile Phe Leu Ser Ser

130 135 140

Val Ala Ala Leu His Gly Val Pro Gln Ala Ala Val Tyr Ser Ala Ser

145 150 155 160

Lys Ala Gly Leu Asp Gly Phe Val Arg Ser Leu Ala Arg Glu Val Gly

165 170 175

Pro Lys Gly Ile His Val Asn Val Ile His Pro Gly Trp Thr Lys Thr

180 185 190

Asp Met Thr Asp Gly Ile Asp Asp Pro Asn Asp Thr Pro Ile Lys Gly

195 200 205

Trp Ile Gln Pro Glu Ala Ile Ala Asp Ala Val Val Phe Leu Ala Lys

210 215 220

Ser Lys Asn Ile Thr Gly Thr Asn Ile Val Val Asp Asn Gly Leu Leu

225 230 235 240

Ala

<210> 5

<211> 726

<212> DNA

<213> Artificial sequence ()

<400> 5

atgtctacgc cgctgaatgc tctggtgacg ggtgcttctc gtggtattgg tgctgcgacc 60

gcgatcaaac tggccgaaaa cggttacagc gtgaccctgg cggcccgtaa cgtcgcaaaa 120

ctgaatgaag tgaaagaaaa actgccggtg gttaaagatg gccagaaaca tcacatttgg 180

gaactggacc tggcctctgt cgaagctgct agctctttta aaggcgcacc gctgccggct 240

tcagattatg acctgtttgt ttcgaacgca ggtatcgcac agatcacccc gacggcggat 300

caaaccgata aagacttcct gaacattctg acggtgaatc tgagttcccc gatcgcgctg 360

accaaagccc tgctgaaagg cgttagtgaa cgctccaatg aaaaaccgtt tcatattatc 420

ttcctgtcat cggcagcagc actgcacggt gtgccgcaga cggcagttta cagcgcgtct 480

aaagccggcc tggatggttt tgttcgttca ctggctcgcg aagtcggccc gaaaggtatt 540

catgttaacg tcatccaccc gggctggacc aaaacggata tgaccgacgg tattgatgac 600

ccgaatgata cgccgattaa aggttggatt cagccggaag ctatcgcgga cgccgtcgtg 660

ttcctggcga aatcaaaaaa catcacgggc acgaacattg tggtggataa cggtctgctg 720

gcgtga 726

<210> 6

<211> 726

<212> DNA

<213> Artificial sequence ()

<400> 6

atgtctacgc cgctgaatgc tctggtgacg ggtgcttctc gtggtattgg tgctgcgacc 60

gcgatcaaac tggccgaaaa cggttacagc gtgaccctgg cggcccgtaa cgtcgcaaaa 120

ctgaatgaag tgaaagaaaa actgccggtg gttaaagatg gccagaaaca tcacatttgg 180

gaactggacc tggcctctgt cgaagctgct agctctttta aaggcgcacc gctgccggct 240

tcagattatg acctgtttgt ttcgaacgca ggtatcgcac agatcacccc gacggcggat 300

caaaccgata aagacttcct gaacattctg acggtgaatc tgagttcccc gatcgcgctg 360

accaaagccc tgctgaaagg cgttagtgaa cgctccaatg aaaaaccgtt tcatattatc 420

ttcctgtcat cggcagcagc actgcacggt gtgccgcagg cggcagttta cagcgcgtct 480

aaagccggcc tggatggttt tgttcgttca ctggctcgcg aagtcggccc gaaaggtatt 540

catgttaacg tcatccaccc gggctggacc aaaacggata tgaccgacgg tattgatgac 600

ccgaatgata cgccgattaa aggttggatt cagccggaag ctatcgcgga cgccgtcgtg 660

ttcctggcga aatcaaaaaa catcacgggc acgaacattg tggtggataa cggtctgctg 720

gcgtga 726

<210> 7

<211> 726

<212> DNA

<213> Artificial sequence ()

<400> 7

atgtctacgc cgctgaatgc tctggtgacg ggtgcttctc gtggtattgg tgctgcgacc 60

gcgatcaaac tggccgaaaa cggttacagc gtgaccctgg cggcccgtaa cgtcgcaaaa 120

ctgaatgaag tgaaagaaaa actgccggtg gttaaagatg gccagaaaca tcacatttgg 180

gaactggacc tggcctctgt cgaagctgct agctctttta aaggcgcacc gctgccggct 240

tcagattatg acctgtttgt ttcgaacgca ggtatcgcac agatcacccc gacggcggat 300

caaaccgata aagacttcct gaacattctg acggtgaatc tgagttcccc gatcgcgctg 360

accaaagccc tgctgaaagg cgttagggaa cgctccaatg aaaaaccgtt tcatattatc 420

ttcctgtcat cggtagcagc actgcacggt gtgccgcagg cggcagttta cagcgcgtct 480

aaagccggcc tggatggttt tgttcgttca ctggctcgcg aagtcggccc gaaaggtatt 540

catgttaacg tcatccaccc gggctggacc aaaacggata tgaccgacgg tattgatgac 600

ccgaatgata cgccgattaa aggttggatt cagccggaag ctatcgcgga cgccgtcgtg 660

ttcctggcga aatcaaaaaa catcacgggc acgaacattg tggtggataa cggtctgctg 720

gcgtga 726

<210> 8

<211> 261

<212> PRT

<213> Artificial sequence ()

<400> 8

Met Tyr Pro Asp Leu Lys Gly Lys Val Val Ala Ile Thr Gly Ala Ala

1 5 10 15

Ser Gly Leu Gly Lys Ala Met Ala Ile Arg Phe Gly Lys Glu Gln Ala

20 25 30

Lys Val Val Ile Asn Tyr Tyr Ser Asn Lys Gln Asp Pro Asn Glu Val

35 40 45

Lys Glu Glu Val Ile Lys Ala Gly Gly Glu Ala Val Val Val Gln Gly

50 55 60

Asp Val Thr Lys Glu Glu Asp Val Lys Asn Ile Val Gln Thr Ala Ile

65 70 75 80

Lys Glu Phe Gly Thr Leu Asp Ile Met Ile Asn Asn Ala Gly Leu Glu

85 90 95

Asn Pro Val Pro Ser His Glu Met Pro Leu Lys Asp Trp Asp Lys Val

100 105 110

Ile Gly Thr Asn Leu Thr Gly Ala Phe Leu Gly Ser Arg Glu Ala Ile

115 120 125

Lys Tyr Phe Val Glu Asn Asp Ile Lys Gly Asn Val Ile Asn Met Ser

130 135 140

Ser Val His Glu Val Ile Pro Trp Pro Leu Phe Val His Tyr Ala Ala

145 150 155 160

Ser Lys Gly Gly Ile Lys Leu Met Thr Arg Thr Leu Ala Leu Glu Tyr

165 170 175

Ala Pro Lys Gly Ile Arg Val Asn Asn Ile Gly Pro Gly Ala Ile Asn

180 185 190

Thr Pro Ile Asn Ala Glu Lys Phe Ala Asp Pro Lys Gln Lys Ala Asp

195 200 205

Val Glu Ser Met Ile Pro Met Gly Tyr Ile Gly Glu Pro Glu Glu Ile

210 215 220

Ala Ala Val Ala Ala Trp Leu Ala Ser Lys Glu Ala Ser Tyr Val Thr

225 230 235 240

Gly Ile Thr Leu Phe Ala Asp Gly Gly Met Thr Leu Tyr Pro Ser Phe

245 250 255

Gln Ala Gly Arg Gly

260

<210> 9

<211> 726

<212> DNA

<213> Candida magnoliae ifo 0705

<400> 9

atgtctacgc cgctgaatgc tctggtgacg ggtgcttctc gtggtattgg tgctgcgacc 60

gcgatcaaac tggccgaaaa cggttacagc gtgaccctgg cggcccgtaa cgtcgcaaaa 120

ctgaatgaag tgaaagaaaa actgccggtg gttaaagatg gccagaaaca tcacatttgg 180

gaactggacc tggcctctgt cgaagcagct agctctttta aaggcgcacc gctgccggct 240

tcagattatg acctgtttgt ttcgaacgca ggtatcgctc agttcacccc gacggcggat 300

caaaccgata aagacttcct gaacattctg acggtgaatc tgagttcccc gatcgcgctg 360

accaaagccc tgctgaaagg cgttagtgaa cgctccaatg aaaaaccgtt tcatattatc 420

ttcctgtcat cggcagcagc actgcacggt gtgccgcaga cggcagttta cagcgcgtct 480

aaagccggcc tggatggttt tgttcgttca ctggctcgcg aagtcggccc gaaaggtatt 540

catgttaacg tcatccaccc gggctggacc aaaacggata tgaccgacgg tattgatgac 600

ccgaatgata cgccgattaa aggttggatt cagccggaag ctatcgcgga cgccgtcgtg 660

ttcctggcga aatcaaaaaa catcacgggc acgaacattg tggtggataa cggtctgctg 720

gcgtga 726

<210> 10

<211> 786

<212> DNA

<213> Artificial sequence ()

<400> 10

atgtatccgg atttaaaagg aaaagtcgtc gctattacag gagctgcttc agggctcgga 60

aaggcgatgg ccattcgctt cggcaaggag caggcaaaag tggttatcaa ctattatagt 120

aataaacaag atccgaacga ggtaaaagaa gaggtcatca aggcgggcgg tgaagctgtt 180

gtcgtccaag gagatgtcac gaaagaggaa gatgtaaaaa atatcgtgca aacggcaatt 240

aaggagttcg gcacactcga tattatgatt aataatgccg gtcttgaaaa tcctgtgcca 300

tctcacgaaa tgccgctcaa ggattgggat aaagtcatcg gcacgaactt aacgggtgcc 360

tttttaggaa gccgtgaagc gattaaatat ttcgtagaaa acgatatcaa gggaaatgtc 420

attaacatgt ccagtgtgca cgaagtgatt ccttggccgt tatttgtcca ctatgcggca 480

agtaaaggcg ggataaagct gatgacacga acattagcgt tggaatacgc gccgaagggc 540

attcgcgtca ataatattgg gccaggtgcg atcaacacgc caatcaatgc tgaaaaattc 600

gctgacccta aacagaaagc tgatgtagaa agcatgattc caatgggata tatcggcgaa 660

ccggaggaga tcgccgcagt agcagcctgg cttgcttcga aggaagccag ctacgtcaca 720

ggcatcacgt tattcgcgga cggcggtatg acactatatc cttcattcca ggcaggccgc 780

ggttaa 786

Claims

1. The amino acid sequence of the carbonyl reductase is SEQ ID NO. 4.

2. A gene encoding the carbonyl reductase of claim 1.

3. The gene of claim 1 wherein said gene is SEQ ID NO 7.

4. A plasmid comprising the gene of claim 2 or 3.

5. A microorganism transformed with the plasmid of claim 4.

6. The microorganism according to claim 5, wherein the microorganism is selected from the group consisting of Bacillus subtilis, Lactobacillus brevis, Candida magnoliae, Pichia pastoris, Saccharomyces cerevisiae, and Escherichia coli.

7. The microorganism according to claim 6, wherein the microorganism is Escherichia coli BL21(DE 3).

8. Use of the carbonyl reductase of claim 1 or the microorganism of claim 6 for producing statin intermediates tbutyl 6-cyano- (3R,5R) -dihydroxyhexanoate, tbutyl 6-chloro- (3R,5S) -dihydroxyhexanoate.

9. Use according to claim 8, wherein the reaction is in glucose dehydrogenase, glucose and NADP⁺In the presence of (a).

10. The use of claim 9, wherein the amino acid sequence of the glucose dehydrogenase is SEQ ID No. 8.