CN112501150A - Chitin deacetylase, coding gene thereof, recombinant vector, recombinant strain, leavening agent, enzyme preparation and application of chitin deacetylase, recombinant strain, leavening agent and enzyme preparation - Google Patents

Abstract

The invention relates to the field of genetic engineering, in particular to chitin deacetylase, a coding gene, a recombinant vector, a recombinant strain, a leavening agent, an enzyme preparation and application thereof. The chitin deacetylase has relatively low optimal catalytic temperature (about 40 ℃), shows high catalytic activity in a wide pH range (pH value of 6-10), can save energy, auxiliary materials and other costs in industrial application, and has wide application prospect. The preferred recombinant strain is Bacillus licheniformis (Bacillus licheniformis) Bl22/pMA5-bli with the preservation number of CGMCC NO. 20933.

Description

Chitin deacetylase, coding gene thereof, recombinant vector, recombinant strain, leavening agent, enzyme preparation and application of chitin deacetylase, recombinant strain, leavening agent and enzyme preparation

Technical Field

The invention relates to the field of genetic engineering, in particular to chitin deacetylase and a coding gene thereof, a recombinant vector, a recombinant strain, a leavening agent, a preparation method of the chitin deacetylase, an enzyme preparation, a method for removing acetyl on chitin, application of the chitin deacetylase in production of the chitin deacetylase and application of the chitin deacetylase in removal of acetyl on the chitin.

Background

Chitin (chitin), also known as chitin and chitin, is a polysaccharide formed by connecting N-acetamido-D-glucose monomers through beta-1, 4-glycosidic bonds. It is the second largest natural macromolecular organic compound with a second content of cellulose in nature, and is widely found in exoskeletons of invertebrates (such as shrimps, crabs, insects, etc.) and cell walls of fungi and algae. Chitin is insoluble in water, dilute acid, dilute alkali, organic solvent and the like due to poor solubility, so that the utilization value of the chitin is greatly limited. For example, chitosan (chitosan) with greatly improved solubility can be obtained by deacetylating chitin (deacetylation degree is more than 55%). And the chitosan has multiple physiological functions of biodegradability, biocompatibility, nontoxicity, bacteriostasis, cancer resistance, lipid reduction, immunity enhancement and the like, can be widely applied to the fields of medicine, food, textile, agriculture, environmental protection, cosmetics and the like, and has high application value and development prospect.

At present, the industrial production method of chitosan is mainly a chemical method. Chitosan is typically prepared by high temperature treatment of chitin with 40% -60% concentrated sodium hydroxide. The method has the defects of high production cost, large environmental pollution, poor product stability and uniformity and the like. Chitin deacetylase (e.c. 3.5.1.41) can remove acetyl groups from chitin to produce chitosan products with stable deacetylation degree and narrow molecular mass distribution range. In addition, the enzymatic method for producing chitosan has mild reaction conditions, low energy consumption value and environmental protection, provides a new way for solving the problems existing in the chemical method for preparing chitosan, and is a future development direction of the chitosan production industry.

Since the first report in 1974 of Mucoralouxii (Mucorrouxii) chitin deacetylases, researchers have isolated a variety of chitin deacetylases from fungi, bacteria and insects. However, the chitin deacetylases reported at present generally have the problems of long fermentation time, low enzyme production activity, high catalytic temperature, poor deacetylation effect and the like, and most of them are enzymes derived from fungi and few of them are derived from bacteria. The bacteria have more advantages than fungi in the aspect of fermentation and enzyme production, the strain is easier to realize large-scale fermentation culture, and the produced enzyme is easier to separate and purify. Therefore, the engineering strain with high enzyme production is constructed by developing and genetically engineering the microbial resource for producing the chitin deacetylase, and is expected to meet the industrial production requirement of preparing the chitosan by an enzyme method.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides chitin deacetylase and a coding gene thereof, a recombinant vector, a recombinant strain, a leavening agent, a preparation method of the chitin deacetylase, an enzyme preparation, a method for removing acetyl on chitin, application of the chitin deacetylase in production of the chitin deacetylase and application of the chitin deacetylase in removal of acetyl on the chitin, wherein the chitin deacetylase can be expressed by bacteria and has the advantages of low catalytic temperature and wide applicable pH.

In order to achieve the above object, a first aspect of the present invention provides a chitin deacetylase which is the enzyme according to any one of (a) to (e):

(a) an enzyme having an amino acid sequence shown in SEQ ID NO. 2;

(b) SEQ ID NO: 2 by substituting, deleting or adding one or more amino acid residues and still has the chitin deacetylase activity;

(c) and SEQ ID NO: 2 has homology of more than 80 percent and has chitin deacetylase activity;

(d) an enzyme represented by an amino acid sequence wherein a tag is attached to the amino terminus and/or the carboxyl terminus of the amino acid sequence of (a), (b) or (c);

(e) an enzyme represented by an amino acid sequence wherein a signal sequence is linked to the amino terminus of the amino acid sequence of (a), (b) or (c).

In a second aspect, the present invention provides a gene encoding chitin deacetylase, which has a nucleotide sequence encoding chitin deacetylase as described above.

In a third aspect, the present invention provides a recombinant vector containing the gene as described above.

In a fourth aspect, the present invention provides a recombinant strain containing the gene as described above or the recombinant vector as described above.

Preferably, the recombinant strain is bacillus licheniformis engineering strain Bl22/pMA5-bli, and the preservation number is CGMCC NO. 20933.

In a fifth aspect, the invention provides a starter culture comprising a recombinant strain as described above.

The sixth aspect of the present invention provides a method for producing chitin deacetylase, comprising: and inoculating the recombinant strain and/or the leavening agent into a fermentation medium for fermentation, and separating and purifying the fermentation product to obtain the chitin deacetylase.

The seventh aspect of the present invention provides an enzyme preparation comprising the chitin deacetylase prepared by the method described above.

The eighth aspect of the present invention provides a method for removing acetyl groups from chitin, comprising: at least one of the recombinant strain, the leavening agent, the chitin deacetylase and the enzyme preparation is contacted with chitin to deacetylate chitin.

The ninth aspect of the present invention provides the use of at least one of the chitin deacetylase described above, the gene described above, the recombinant vector described above, the recombinant strain described above, the starter culture described above, and the chitin deacetylase prepared by the method described above for producing chitin deacetylase.

In a tenth aspect, the present invention provides the use of at least one of the chitin deacetylase described above, the gene described above, the recombinant vector described above, the recombinant strain described above, the starter culture described above, the chitin deacetylase prepared by the method described above, and the enzyme preparation described above for deacetylation of chitin.

The optimum catalytic temperature of the chitin deacetylase is relatively low, about 40 ℃, the chitin deacetylase shows high catalytic activity in a wide pH range (pH value of 6-10), and the chitin deacetylase can save the cost of energy, auxiliary materials and the like in industrial application and has wide application prospect.

The invention also has the advantages that the preferred recombinant strain (Bacillus licheniformis engineering strain Bl22/pMA5-bli) provided by the invention can utilize common carbon sources and nitrogen sources to rapidly culture and ferment to produce chitin deacetylase with high yield.

Drawings

FIG. 1 shows the result of agarose gel electrophoresis of a gene bli encoding chitin deacetylase;

FIG. 2 shows the result of polyacrylamide gel electrophoresis (SDS-PAGE) of chitin deacetylase.

Biological preservation

The Bacillus licheniformis (Bacillus licheniformis) genetic engineering strain provided by the invention is preserved in the China general microbiological culture Collection center (address: Beijing West Lu No.1 of the sunward area, Beijing, China academy of sciences, microbiological research institute, postal code: 100101) (the abbreviation of the preservation unit is CGMCC) within 22 days 10 months 2020, and the preservation number is CGMCC No.20933, which is called Bl22/pMA5-bli for short.

Detailed Description

The endpoints of the ranges and any values disclosed herein are not limited to the precise range or value, and such ranges or values should be understood to encompass values close to those ranges or values. For ranges of values, between the endpoints of each of the ranges and the individual points, and between the individual points may be combined with each other to give one or more new ranges of values, and these ranges of values should be considered as specifically disclosed herein.

In the present invention, the term "enzyme activity", i.e., the amount of enzyme content, is used in the sense that the enzyme activity unit, i.e., the enzyme unit (U), which is defined in the present invention, is not stated to the contrary: under the conditions of pH 7 and 40 ℃, the enzyme amount of 1 mu g of paranitroanilide generated by deacetylating paranitroanilide per hour is one enzyme activity unit; "specific activity of enzyme" represents the catalytic ability per unit mass of protein, and can reflect the activity of enzyme, and the larger the value, the higher the activity of enzyme, the calculation formula of specific activity is: specific activity (U/mg) is the number of total enzyme activity units/mg total protein; the unit M represents mol/L.

The present invention provides, in a first aspect, a chitin deacetylase which is an enzyme according to any one of (a) to (e):

(a) an enzyme having an amino acid sequence shown in SEQ ID NO. 2;

(b) SEQ ID NO: 2 by substituting, deleting or adding one or more amino acid residues and still has the chitin deacetylase activity;

(c) and SEQ ID NO: 2 has homology of more than 80 percent and has chitin deacetylase activity;

(d) an enzyme represented by an amino acid sequence wherein a tag is attached to the amino terminus and/or the carboxyl terminus of the amino acid sequence of (a), (b) or (c);

(e) an enzyme represented by an amino acid sequence wherein a signal sequence is linked to the amino terminus of the amino acid sequence of (a), (b) or (c).

The 20 amino acid residues constituting a protein can be classified into four types according to the side chain polarity: 1. non-polar amino acids: alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile), methionine (Met), phenylalanine (Phe), tryptophan (Trp), and proline (Pro); 2. polar uncharged amino acids: glycine (Gly), serine (Ser), threonine (Thr), cysteine (Cys), aspartic acid (Asn), glutamine (Gln) and tyrosine (Tyr); 3. positively charged amino acids: arginine (Arg), lysine (Lys), and histidine (His); 4. negatively charged amino acids: aspartic acid (Asp) and glutamic acid (Glu) (see "biochemistry" (second edition) on the book, shengdi, wang spec rock, pages 82-83, higher education press, 1990, 12 months).

If the substitution of amino acid residues belonging to the same class, for example, substitution of Arg for Lys or Leu for Ile, occurs in the protein, the role of the residues in the protein domain (e.g., the role of providing positive charge or forming a hydrophobic pocket structure) is not changed, and thus the steric structure of the protein is not affected, and thus the function of the protein can still be achieved. The substitution of an amino acid residue of the same genus may occur at any one of the amino acid residue positions of the above-mentioned chitin deacetylase.

In addition to the above-mentioned amino acid residue substitutions, the chitin deacetylase provided by the present invention also includes proteins in which one or more amino acid residues are deleted or added or both at any position of amino acid residues 1 to 254 as compared with the amino acid sequence shown in SEQ ID NO. 2. Preferably, the amino acid sequence of the chitin deacetylase in the invention can be a sequence in which the amino acid residues at positions 2-7 and 251-254 are partially or completely deleted compared with the amino acid sequence shown in SEQ ID NO.2, or a sequence in which 1-5 amino acid residues are added at any position between the amino acid residues at positions 2-7, or a sequence in which 1-3 amino acid residues are added at any position between the amino acid residues at positions 251-254, or an amino acid sequence formed by any combination of the above.

As mentioned above, the chitin deacetylase provided by the invention can also be modified or mutated to obtain a derivative protein. The derived protein means a protein having an amino acid sequence different from that of chitin deacetylase having the above amino acid sequence, and may have a difference in modified form which does not affect the sequence, or both. These proteins include natural or induced genetic variants. The induced variants may be obtained by various techniques, such as random mutagenesis by irradiation or mutagenic agents, etc., or by techniques such as site-directed mutagenesis or other known molecular biology techniques. Derivatized proteins also include analogs having residues of natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta-amino acids, gamma-amino acids, etc.).

Modifications (which do not generally alter primary structure, i.e., do not alter amino acid sequence) include: chemically derivatized forms of the protein such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those proteins that result from glycosylation modifications during synthesis and processing of the protein or during further processing steps. Such modification may be accomplished by exposing the protein to an enzyme that performs glycosylation, such as mammalian glycosylating or deglycosylating enzymes. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine). Also included are proteins that have been modified to increase their resistance to proteolysis or to optimize solubility.

In the present invention, the enzyme may also be a polypeptide having an amino acid sequence substantially similar to SEQ ID NO: 2 has homology of more than 80 percent and has chitin deacetylase activity. Preferably, the chitin deacetylase is a chitinase that hybridizes with SEQ ID NO: 2, more preferably 90% or more, still more preferably 95% or more, still more preferably 98% or more, and most preferably 99% or more, and has a chitin deacetylase activity.

For purification, additional modifications of (a), (b) or (c) may be made using tags commonly used in the art, and may be obtained, for example, by attaching the amino acid sequence of a tag (e.g., a tag shown in Table 1 below, at least one of Poly-Arg, Poly-His, FLAG, Strep-tag II and c-myc) to the amino terminus and/or the carboxyl terminus of (a). The label does not influence the activity of the chitin deacetylase, and whether the label is added or not can be selected according to requirements in the practical application process.

TABLE 1

Label (R)	Number of residues	Amino acid sequence
			Poly-Arg	5-6 (typically 5)	RRRRR(SEQ ID NO：3)
Poly-His	2-10 (generally 6)	HHHHHH(SEQ ID NO：4)
			FLAG	8	DYKDDDDK(SEQ ID NO：5)
Strep-tagⅡ	8	WSHPQFEK(SEQ ID NO：6)
			c-myc	10	EQKLISEEDL(SEQ ID NO：7)

In the present invention, the amino terminus of the chitin deacetylase may also be linked to a signal sequence. The signal sequence may be from bacillus licheniformis, bacillus amyloliquefaciens and bacillus subtilis, but is not limited thereto. The signal sequence is preferably SEQ ID NO: 8.

In the present invention, the enzyme still having enzymatic activity means that the enzyme derived from (a) still has enzymatic activity with a percentage (relative activity) between the enzymatic activity and the enzymatic activity of (a) of not less than 60%, preferably not less than 70% (or 80%, or 90%, or 95%, or 96%, or 97%, or 98%, or 99%, or 100%) under the same measurement conditions.

The chitin deacetylase can be obtained by artificial synthesis, or can be obtained by synthesizing the coding gene and then performing biological expression.

In a second aspect, the present invention provides a gene encoding chitin deacetylase, which has a nucleotide sequence encoding chitin deacetylase as described above.

Accordingly, the gene may be (1) or (2) as follows:

(1) a DNA molecule having an amino acid sequence encoding the chitin deacetylase of the first aspect;

(2) and (2) the DNA molecule which is hybridized with the DNA sequence defined in the step (1) under strict conditions and does not change the enzymatic activity of the encoded chitin deacetylase. Wherein the stringent conditions may be: in a solution of 6 XSCC, 0.5% SDS, at 65 ℃ and then washed once with each of 2 XSCC, 0.1% SDS and 1 XSCC, 0.1% SDS. The enzyme activity is not changed, and means that the percentage (relative activity) between the enzyme activity of the protein encoded by (2) and the enzyme activity of the protein encoded by (1) is not less than 95% (or 96%, or 97%, or 98%, or 99%, or 100%) under the same assay conditions.

It is known in the art that 18 other amino acids, besides Met (ATG) or Trp (TGG), which are encoded by a single codon, among the 20 different amino acids that make up the protein, are encoded by 2-6 codons, respectively (Sambrook et al, molecular cloning, Cold spring harbor laboratory Press, New York, USA, second edition, 1989, see appendix D page 950). That is, due to the degeneracy of genetic code, there is usually more than one codon determining one amino acid, and the substitution of the third nucleotide in the triplet codon will not change the composition of the amino acid, so that the nucleotide sequences of genes encoding the same protein may differ. From the amino acid sequences disclosed in the present invention and the amino acid sequences with no change in the chitin deacetylase activity obtained from the amino acid sequences, nucleotide sequences of genes encoding the amino acid sequences can be completely deduced by those skilled in the art from well-known codon tables, and the nucleotide sequences are obtained by biological methods (e.g., PCR method, mutation method) or chemical synthesis methods, and thus the partial nucleotide sequences should be included in the scope of the present invention. Conversely, using the DNA sequences disclosed herein, amino acid sequences consistent with the chitin deacetylase activity of the present invention can also be obtained by modifying the nucleic acid sequences provided herein by methods well known in the art, e.g., Sambrook et al (molecular cloning, Cold spring harbor laboratory Press, New York, U.S. Pat. No.5, second edition, 1989).

Preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO. 2.

As described above, the 5 'end and/or the 3' end of the nucleotide sequence may be linked with the coding sequence of the tag shown in Table 1 above, respectively.

More preferably, the gene has a nucleotide sequence shown in SEQ ID NO. 1.

The nucleotide sequence provided by the present invention can be obtained by a Polymerase Chain Reaction (PCR) amplification method, a recombination method, or an artificial synthesis method. For example, one skilled in the art can easily obtain templates and primers based on the nucleotide sequences provided by the present invention, and obtain the relevant sequences by PCR amplification.

Once the nucleotide sequence of interest is obtained, the amino acid sequence of interest can be obtained in large quantities by recombinant methods. The nucleotide sequence obtained is usually cloned into a vector, then transferred into genetically engineered bacteria, and then separated from the proliferated host cells by a conventional method to obtain the relevant nucleotide sequence.

In addition, the nucleotide sequence can be synthesized by a known artificial chemical synthesis method.

In a third aspect, the present invention provides a recombinant vector containing the gene as described above.

As the "vector" used in the recombinant vector, various vectors known in the art, such as various commercially available plasmids, cosmids, phages, retroviruses and the like can be used, and a preferred expression vector of the present invention is the pMA5 plasmid. The recombinant vector construction can adopt various endonucleases (such as BamH I, MluI and the like for pMA 5) which can have cutting sites at the multiple cloning sites of the vector to carry out enzyme digestion to obtain linear plasmids, and the linear plasmids are connected with gene segments cut by the same endonucleases to obtain recombinant plasmids. The invention preferably adopts BamHI and MluI double enzyme digestion pMA5 and gene segments connected with the same, and the recombinant vector pMA5-Bli is constructed by ligase connection.

In a fourth aspect, the present invention provides a recombinant strain containing the gene as described above or the recombinant vector as described above.

The recombinant vector may be transformed, transduced or transfected into a host cell (strain) by methods conventional in the art, such as chemical transformation by calcium chloride method, high-voltage shock transformation, preferably shock transformation. The host cell may be a prokaryotic cell or a eukaryotic cell, preferably at least one of Bacillus licheniformis (Bacillus licheniformis), Bacillus amyloliquefaciens and Bacillus subtilis, more preferably the host cell is Bacillus licheniformis, such as Bacillus licheniformis Bl 22.

Preferably, the recombinant strain is bacillus licheniformis engineering strain Bl22/pMA5-bli, and the preservation number is CGMCC NO. 20933.

In a fifth aspect, the invention provides a starter culture comprising a recombinant strain as described above.

The starter may be present in liquid form or in solid form. The leavening agent can contain auxiliary materials added in the conventional preparation of microbial inoculum in the field, and the skilled person can select the auxiliary materials according to the needs.

Preferably, the recombinant strain is present in an amount of 10 per gram of said starter culture⁵-10¹⁰CFU, more preferably 10⁷-10⁹CFU。

The sixth aspect of the present invention provides a method for producing chitin deacetylase, comprising: and inoculating the recombinant strain and/or the leavening agent into a fermentation medium for fermentation, and separating and purifying the fermentation product to obtain the chitin deacetylase.

The method for preparing the chitin deacetylase comprises the following steps: culturing the recombinant strain provided by the invention, and inducing the expression of a gene coding the chitin deacetylase; separating and purifying the expressed chitin deacetylase.

Wherein the culture conditions are conventional culture conditions, such as LB medium (solvent is water, solute and final concentration thereof are 5-15g/L tryptone, 1-10g/L yeast extract, and 5-15g/L NaCl), and culture is performed at 35-37 deg.C.

The recombinant strain provided by the invention contains a gene for coding the chitin deacetylase, so that the chitin deacetylase can be efficiently expressed. After culturing, the chitin deacetylase with high purity can be obtained by separation and purification.

The separation and purification can be performed by methods known to those skilled in the art and will not be described herein.

The seventh aspect of the present invention provides an enzyme preparation comprising the chitin deacetylase prepared by the method described above.

The enzyme preparation can exist in a solid, semi-solid or liquid form, and the enzyme preparation can contain auxiliary materials or additives for preparing the enzyme preparation, and the like, and the enzyme preparation can be selected by a person skilled in the art according to needs, and is not described herein again.

The eighth aspect of the present invention provides a method for removing acetyl groups from chitin, comprising: at least one of the recombinant strain, the leavening agent, the chitin deacetylase and the enzyme preparation is contacted with chitin to deacetylate chitin.

The method for removing acetyl groups from chitin may be a method for removing acetyl groups conventionally used in the art.

Wherein the contacting conditions may be suitable conditions for the chitin deacetylase, and preferably the contacting conditions include: a pH value of 4-13, more preferably 7-10; the temperature is 25-55 deg.C, more preferably 30-45 deg.C.

The chitin deacetylase may be used in an amount of 10-100 μ g per gram of chitin sample.

The ninth aspect of the present invention provides the use of at least one of the chitin deacetylase described above, the gene described above, the recombinant vector described above, the recombinant strain described above, the starter culture described above, and the chitin deacetylase prepared by the method described above for producing chitin deacetylase.

In a tenth aspect, the present invention provides the use of at least one of the chitin deacetylase described above, the gene described above, the recombinant vector described above, the recombinant strain described above, the starter culture described above, the chitin deacetylase prepared by the method described above, and the enzyme preparation described above for deacetylation of chitin.

The present invention will be described in detail below by way of examples.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Chitin was purchased from Wako (japan).

Example 1

This example is for explaining the acquisition of the target gene bli.

Shanghai BioEngineers, Inc. was entrusted to synthesize the gene sequence shown in SEQ ID NO.1 and the primer sequences shown in SEQ ID NO.9 and SEQ ID NO. 10. Wherein, SEQ ID NO.9 is GCGGGATCCGTGAACCATTTTTATGTGTG；SEQ ID NO.10:GCGACGCGTCTACTTTACTTCTGAAGATT are provided. The upstream and downstream primers are respectively introduced with BamH I and Mlu I restriction enzyme cutting sites.

PCR amplification was performed using the synthesized DNA as a template. The PCR reaction system is as follows: premix (25. mu.l), ddH₂O (22. mu.l), upstream and downstream primers (1. mu.l each), DNA template (1. mu.l). The reaction conditions are as follows: 5min at 94 ℃ for 1 cycle; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃ for 1 cycle. After the PCR product was analyzed by agarose gel electrophoresis (FIG. 1), the gel was cut and recoveredA fragment of interest.

The fragment of interest was ligated into the pMD-19T cloning vector. The connection reaction system is as follows: vector 1. mu.l, recovered fragment 5. mu.l, T4 DNA ligase (NEB) 1. mu.l, 10. mu.buffer 1. mu.l, ddH₂O2. mu.l. The ligation reaction conditions were 16 ℃ for 2 h.

The ligation solution was transformed into E.coli DH 5. alpha. competent cells. The method comprises the following steps: melting 50ul of competent cells on ice bath, and adding connecting liquid; standing in ice bath for 30 min; heating in 42 deg.C water bath for 45sec, rapidly transferring to ice, standing for 2min, adding 500ul sterile LB culture medium (without antibody), culturing at 37 deg.C and 200rpm for 1 h; after centrifugation at 6000rpm for 3min, a portion of the supernatant was removed, the cells were resuspended, 100. mu.l of the supernatant was spread on LB medium solid plates containing 100. mu.g/mL ampicillin, and cultured overnight at 37 ℃.

And (5) carrying out colony PCR verification. The PCR reaction system is as follows: premix (25. mu.l), ddH₂O (23. mu.l), upstream and downstream primers (1. mu.l each), DNA template (single colony on LB plate). The reaction conditions are as follows: 5min at 94 ℃ for 1 cycle; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃ for 1 cycle. Positive clones with correct amplification product sizes were sequenced by Shanghai Bioengineering Co., Ltd.

The sequencing result shows that the target gene coding region is 765bp long, and the nucleotide sequence is shown as SEQ ID NO. 1. The target gene totally encodes 254 amino acids and a stop codon, the amino acid sequence of the target gene is shown as SEQ ID NO.2, and the predicted protein molecular weight is 28 kDa.

Example 2

This example illustrates the acquisition of the genetically engineered strain of Bacillus licheniformis Bl22/pMA 5-bli.

Double digestion of target gene

The objective gene obtained in example 1 was excised from the cloning vector. The enzyme digestion reaction system is as follows: vector pMD-19T-bli (5. mu.l), restriction enzyme BamH I (1. mu.l), restriction enzyme Mlu I (1. mu.l), 10. mu.buffer (1. mu.l), ddH₂O (2. mu.l); the reaction conditions are as follows: 37 ℃ for 2 h. And (4) carrying out 1% agarose gel electrophoresis analysis on the enzyme digestion product, cutting the gel and recovering the target gene fragment.

Expression vector double restriction enzyme

The expression vector is subjected to double enzyme digestion. The enzyme digestion reaction system is as follows: vector pMA5 (5. mu.l), restriction enzyme BamH I (1. mu.l), restriction enzyme Mlu I (1. mu.l), 10. multidot. Buffer (1. mu.l), ddH₂O (2. mu.l); the reaction conditions are as follows: 37 ℃ for 2 h. And (4) carrying out 1% agarose gel electrophoresis analysis on the enzyme digestion product, cutting the gel and recovering the target gene fragment.

Connection of target gene and expression vector

The gene of interest was ligated into the pMA5 expression vector. The connection reaction system is as follows: vector 1. mu.l, target gene 5. mu.l, T4 DNA ligase (NEB) 1. mu.l, 10. mu.buffer 1. mu.l, ddH₂O2. mu.l. The ligation reaction conditions were 16 ℃ for 2 h.

Transformation of recombinant expression vectors

The ligation solution was transformed into competent cells of Bacillus licheniformis Bl 22. Thawing 50ul of competent cells on ice, and adding the ligation solution; standing for 30 min; transferring the mixed solution into a precooled electric rotor; setting electric shock parameters, and carrying out electric shock conversion according to the conditions of electric shock voltage of 2.5kV and electric shock time of 5 ms; immediately after the electric shock, 1ml of LB medium preheated at 42 ℃ was added to the electric rotor; repeatedly blowing and uniformly mixing by using a pipettor, and then transferring the liquid in the electric shock cup into a centrifugal tube; placing into 42 deg.C water bath, thermally shocking for 6min, rapidly transferring to ice, and standing for 2 min; incubating at 37 ℃ for 2h with 200rpm oscillation; the cells were resuspended by centrifugation at 6000rpm for 3min, and 100. mu.l of the supernatant was plated on LB medium solid plates containing 5. mu.g/mL chloramphenicol and cultured at 37 ℃ for 48 h.

Recombinant strain screening

And (5) carrying out colony PCR verification. The PCR reaction system is as follows: premix (25. mu.l), ddH₂O (23. mu.l), upstream and downstream primers (1. mu.l each), DNA template (single colony on LB plate). The reaction conditions are as follows: 5min at 94 ℃ for 1 cycle; 30 cycles of 94 ℃ for 30s, 55 ℃ for 30s, and 72 ℃ for 1 min; 10min at 72 ℃ for 1 cycle. And (4) performing glycerol tube preservation on the positive recombinant strain with the correct PCR amplification product size, and storing in a refrigerator at the temperature of-80 ℃.

The Bacillus licheniformis (Bacillus licheniformis) genetic engineering strain is preserved in China general microbiological culture Collection center (address: No.3 of West Luo No.1 of Beijing Korean district, China academy of sciences, microbiological research institute, postal code: 100101) (the abbreviation of preservation unit is CGMCC) within 10-month and 22-day of 2020, 10-month and 10-month, wherein the preservation number is CGMCC No.20933, and the abbreviation is Bl22/pMA 5-bli.

Example 3

This example illustrates the acquisition of chitin deacetylase and the determination of enzymatic activity.

Recombinant strain protein expression

(1) Strain activation

The culture method comprises the following steps: taking a proper amount of refrigerator-preserved strain Bl22/pMA5-bli at the temperature of-80 ℃ to streak an LB solid plate added with 5 mu g/mL chloramphenicol, placing the plate in a constant-temperature incubator for culture at the temperature of 35 +/-2 ℃ for 20 hours.

Activating a culture medium: 5g/L of yeast extract, 10g/L, NaCl 10g/L of tryptone, 20g/L of agar powder and the balance of water, and the pH value is 6.5-7.2.

(2) Seed culture

The culture method comprises the following steps: single colonies were picked from the activated plates and placed in seed medium (chloramphenicol concentration 5. mu.g/mL) for shaking culture at a constant temperature at a stirring speed of 150rpm and a temperature of 35. + -. 2 ℃ for 9 hours.

Seed culture medium: 5g/L of yeast extract, 10g/L, NaCl 10g/L of tryptone and the balance of water, and the pH value is 6.5-7.2.

(3) Fermentation culture

The culture method comprises the following steps: transferring the seed solution to a fermentation medium (the concentration of chloramphenicol is 5 mug/mL) according to the inoculation amount of 1%, and performing constant-temperature shaking culture at the stirring speed of 150rpm and the temperature of 35 +/-2 ℃ for 24 h;

fermentation medium: 40g/L of glucose, 25g/L of yeast powder, 15g/L of tryptone, K2HPO 43 g/L and the balance of water, and the pH value is 6.5-7.2.

Preparation of crude enzyme solution of recombinant strain Bl22/pMA5-bli chitin deacetylase

Collecting 10mL fermentation liquor, centrifuging at 12000rpm for 5min, pouring out culture medium supernatant, taking 10mL ultrasonication buffer (50mM Tris-cl, 20mM NaOH, pH 8.0) to suck up and down, and fully resuspending thalli; averagely dividing 10mL of the resuspended bacterial liquid into 10 parts, transferring each part of the resuspended bacterial liquid into 10 centrifugal tubes with the volume of 1mL, placing each centrifugal tube into a fixed ice-water mixed bath, and independently carrying out ultrasonic crushing, wherein an amplitude rod of an ultrasonic crusher is set to be 2, the power is set to be 20%, the ultrasonic frequency is set to be 2s/2s (namely 2s of crushing, 2s of pause), and the total time of crushing is 5 min; centrifuging all the broken solutions at 12000rpm for 5min, collecting supernatant, and transferring into a new 15ml centrifuge tube to obtain crude enzyme solution of recombinant strain chitin deacetylase.

Recombinant protein detection

The expression of recombinant chitin deacetylase was examined by polyacrylamide gel electrophoresis (SDS-PAGE) (FIG. 2).

Recombinant chitin deacetylase enzymatic activity detection

Taking a 15ml centrifuge tube, adding 1ml of 200mg/l paranitroacetanilide aqueous solution, 1ml of crude enzyme solution diluted by proper times and 3ml of pre-insulated phosphate buffer solution with the concentration of 0.05M and the pH value of 7.0 to ensure that the final volume of the reaction solution is 5ml, carrying out water bath reaction at 40 ℃ for 0.5h, carrying out boiling water bath for 5min, stopping enzymatic reaction, adding water to fix the volume to 10ml, uniformly mixing, centrifuging at 12000rpm for 5min, and measuring the light absorption value A400 of the supernatant at 400 nm. The blank control system was supplemented with 1ml of the same concentration of inactivated enzyme solution, and the absorbance A0 of the supernatant was measured as above for each sample.

Definition of enzyme activity unit: the amount of enzyme required to produce 1. mu.g of p-nitroaniline per hour under the above reaction conditions was defined as one unit of enzyme activity. The enzyme activity calculation formula is as follows:

enzyme activity (U/ml) ((A400-A0) × 10 × n)/KT

A400-absorbance of the sample at 400 nm; a0 — absorbance of blank; 10-volume of solution 10 ml; n is the dilution multiple of enzyme solution; k-linear coefficient (0.0648); t-reaction time, h

The enzyme activity result of the obtained chitin deacetylase is 6620U by determination.

Example 4

This example illustrates the acquisition of chitin deacetylase and the determination of enzymatic activity.

The procedure of examples 1-3 was followed except that the amino acid sequence of chitin deacetylase was varied, as shown in Table 1.

The results of the enzyme activities of the enzymes corresponding to the different amino acid sequences are shown in Table 1.

TABLE 1

Numbering	Distinction between	Enzyme activity U
			B1	K108R	6010
B2	Deletion of amino acids at positions 2 to 7	5880
			B3	Deletion of amino acids 251 and 254	5310
B4	Amino acid deletions at positions 2-7 and 251-	4560
			B5	Inserting RLI three amino acid residues between 7 th and 8 th positions	4980
C	SEQ ID NO.11 (83% homology with SEQ ID NO. 2)	4230
			D1	The amino terminal of SEQ ID NO.2 is connected with SEQ ID NO.3	4970
D2	The carboxyl terminal of SEQ ID NO.2 is connected with SEQ ID NO.4	6480
			D3	The carboxyl terminal of SEQ ID NO.2 is connected with SEQ ID NO.5	6010
D4	The amino terminal of SEQ ID NO.2 is connected with SEQ ID NO.6	6230
			D5	The carboxyl terminal of SEQ ID NO.2 is connected with SEQ ID NO.7	5870
E	The amino terminal of SEQ ID NO.2 is connected with SEQ ID NO.8	6590

Example 5

This example illustrates the acquisition of chitin deacetylase and the determination of enzymatic activity.

The procedure of example 3 was followed except that the enzyme activities were measured at pH 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0 and 13.0, respectively.

The enzyme activity results of the obtained chitin deacetylase are 2200U, 3450U, 5860U, 6620U, 6360U, 6320U, 6240U, 5090U, 3310U and 2180U in sequence.

Example 6

This example illustrates the acquisition of chitin deacetylase and the determination of enzymatic activity.

The procedure of example 3 was followed except that the enzyme activities were measured at temperatures of 20, 25, 30, 35, 40, 45, 50 and 55 ℃.

The enzyme activity results of the obtained chitin deacetylase are 1390U, 3130U, 4410U, 5470U, 6620U, 3980U, 1970U and 810U respectively.

The results show that the chitin deacetylase produced by the bacillus licheniformis genetic engineering strain Bl22/pMA5-bli has the characteristics of wide applicable pH and low applicable temperature, and is high in enzyme activity and suitable for industrial production.

The preferred embodiments of the present invention have been described above in detail, but the present invention is not limited thereto. Within the scope of the technical idea of the invention, many simple modifications can be made to the technical solution of the invention, including combinations of various technical features in any other suitable way, and these simple modifications and combinations should also be regarded as the disclosure of the invention, and all fall within the scope of the invention.

SEQUENCE LISTING

<110> Jilin, food biochemistry, Inc.; chinese grain Nutrition and health research institute, Inc.; chinese grain Biotechnology Ltd; biochemical energy resources of Chinese food grain (elm) Co Ltd

<120> chitin deacetylase, gene encoding same, recombinant vector, recombinant strain, fermentation agent, enzyme preparation, and use thereof

<130> 65859

<160> 11

<170> PatentIn version 3.3

<210> 1

<211> 765

<212> DNA

<213> Artificially synthesized

<400> 1

atgaaccatt tttatgtgtg gcatatcaaa cggattaagc agctaatcat tattatgata 60

gccgcttttg cgacagcaag ttttttttat gtgcaaaacc tgctccctct tcctgtgttt 120

tctacagaag gcggagcaaa agcggtatat agaggagatt cagatacaaa tgaagtagcc 180

cttacattta atatcagctg gggagatcaa aaggcaatgc ccattttaga cacattaaaa 240

gcaaacggta ttaaagacgc gacctttttt ctatcagctt catgggcaga gcgccacccg 300

gatgtcgtag aaagaatccg taaagatggt caccagatcg ggagtatggg ctatgcttat 360

aaaaactatt cgcaaatgaa gaaaagcgag atcaaaaaag acttagcaaa agcacgacac 420

tcctttcaaa aactcgggct tgacgacctt acgcttttaa gaccgccgac cggccagttt 480

aataaagacg tactcgatgt tgctaaacag tacggctaca ccgttgttca ttatagtatt 540

aactcggatg actggacgaa cccgggggtt caaaagatcg tccaaaacgt aaatgaaacg 600

gtaaacgccg gtgacatcgt gctctttcac gcttcagatt ccgccaaaca aacaaaagaa 660

gccctgccag agatcgtgca ccatctcaga agcaaggggc tcaaaaacgt aaccgtcagc 720

gaattaatcg caaatacgga tgcaaaatct tcagaagtaa agtag 765

<210> 2

<211> 254

<212> PRT

<213> Artificially synthesized

<400> 2

Met Asn His Phe Tyr Val Trp His Ile Lys Arg Ile Lys Gln Leu Ile

1 5 10 15

Ile Ile Met Ile Ala Ala Phe Ala Thr Ala Ser Phe Phe Tyr Val Gln

20 25 30

Asn Leu Leu Pro Leu Pro Val Phe Ser Thr Glu Gly Gly Ala Lys Ala

35 40 45

Val Tyr Arg Gly Asp Ser Asp Thr Asn Glu Val Ala Leu Thr Phe Asn

50 55 60

Ile Ser Trp Gly Asp Gln Lys Ala Met Pro Ile Leu Asp Thr Leu Lys

65 70 75 80

Ala Asn Gly Ile Lys Asp Ala Thr Phe Phe Leu Ser Ala Ser Trp Ala

85 90 95

Glu Arg His Pro Asp Val Val Glu Arg Ile Arg Lys Asp Gly His Gln

100 105 110

Ile Gly Ser Met Gly Tyr Ala Tyr Lys Asn Tyr Ser Gln Met Lys Lys

115 120 125

Ser Glu Ile Lys Lys Asp Leu Ala Lys Ala Arg His Ser Phe Gln Lys

130 135 140

Leu Gly Leu Asp Asp Leu Thr Leu Leu Arg Pro Pro Thr Gly Gln Phe

145 150 155 160

Asn Lys Asp Val Leu Asp Val Ala Lys Gln Tyr Gly Tyr Thr Val Val

165 170 175

His Tyr Ser Ile Asn Ser Asp Asp Trp Thr Asn Pro Gly Val Gln Lys

180 185 190

Ile Val Gln Asn Val Asn Glu Thr Val Asn Ala Gly Asp Ile Val Leu

195 200 205

Phe His Ala Ser Asp Ser Ala Lys Gln Thr Lys Glu Ala Leu Pro Glu

210 215 220

Ile Val His His Leu Arg Ser Lys Gly Leu Lys Asn Val Thr Val Ser

225 230 235 240

Glu Leu Ile Ala Asn Thr Asp Ala Lys Ser Ser Glu Val Lys

245 250

<210> 3

<211> 5

<212> PRT

<213> Artificially synthesized

<400> 3

Arg Arg Arg Arg Arg

1 5

<210> 4

<211> 6

<212> PRT

<213> Artificially synthesized

<400> 4

His His His His His His

1 5

<210> 5

<211> 8

<212> PRT

<213> Artificially synthesized

<400> 5

Asp Tyr Lys Asp Asp Asp Asp Lys

1 5

<210> 6

<211> 8

<212> PRT

<213> Artificially synthesized

<400> 6

Trp Ser His Pro Gln Phe Glu Lys

1 5

<210> 7

<211> 10

<212> PRT

<213> Artificially synthesized

<400> 7

Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu

1 5 10

<210> 8

<211> 25

<212> PRT

<213> Artificially synthesized

<400> 8

Met Lys Ser Lys Trp Met Ser Gly Leu Leu Leu Val Ala Val Gly Phe

1 5 10 15

Ser Phe Thr Gln Val Met Val His Ala

20 25

<210> 9

<211> 29

<212> DNA

<213> Artificially synthesized

<400> 9

gcgggatccg tgaaccattt ttatgtgtg 29

<210> 10

<211> 29

<212> DNA

<213> Artificially synthesized

<400> 10

gcgacgcgtc tactttactt ctgaagatt 29

<210> 11

<211> 234

<212> PRT

<213> Artificially synthesized

<400> 11

Met Ile Lys Leu Ile Val Asn Ala Asp Asp Phe Gly Leu Thr Glu Gly

1 5 10 15

Thr Asn Tyr Gly Ile Ile Asp Gly His Ile Asn Gly Leu Val Asn Ser

20 25 30

Thr Thr Met Met Met Asn Met Pro Gly Thr Glu His Ala Val Arg Leu

35 40 45

Ala Lys Glu His Asn Thr Leu Gly Val Gly Val His Leu Val Leu Thr

50 55 60

Ala Gly Lys Pro Leu Leu Gly Asp Val Pro Ser Leu Val Ser Ser Asp

65 70 75 80

Gly Leu Phe His Lys Gln Ser Val Val Trp Glu Gly Lys Ile Asn Pro

85 90 95

Glu Glu Val Glu Arg Glu Trp Thr Ala Gln Ile Glu Lys Phe Leu Ser

100 105 110

Tyr Gly Leu Thr Pro Thr His Leu Asp Ser His His His Val His Gly

115 120 125

Leu Pro Ile Leu His Asp Val Leu Glu Lys Leu Ala Ala Thr Tyr Asn

130 135 140

Val Pro Ile Arg Arg Cys Glu Glu Glu Arg Ala Val Arg Pro Phe Ser

145 150 155 160

Asp Val Phe Tyr Ser Asp Phe Tyr Ala Asp Gly Val Thr Glu Asp Tyr

165 170 175

Phe Val Lys Leu Lys Glu Arg Val Gln Gly Glu Gln Thr Val Glu Ile

180 185 190

Met Val His Pro Ala Tyr Ile Asp Pro Glu Leu Val Lys Arg Ser Ser

195 200 205

Tyr Val Met Asp Arg Val Lys Glu Leu Arg Ile Leu Thr Glu Ser Glu

210 215 220

Leu Pro Glu Gly Ile Glu Leu Val Lys Phe

225 230

Claims (12)

1. A chitin deacetylase which is an enzyme according to any one of (a) to (e):

(a) an enzyme having an amino acid sequence shown in SEQ ID NO. 2;

(b) SEQ ID NO: 2 by substituting, deleting or adding one or more amino acid residues and still has the chitin deacetylase activity;

(c) and SEQ ID NO: 2 has homology of more than 80 percent and has chitin deacetylase activity;

(d) an enzyme represented by an amino acid sequence wherein a tag is attached to the amino terminus and/or the carboxyl terminus of the amino acid sequence of (a), (b) or (c);

(e) an enzyme represented by an amino acid sequence wherein a signal sequence is linked to the amino terminus of the amino acid sequence of (a), (b) or (c).

2. The chitin deacetylase of claim 1, wherein the chitin deacetylase is a mutant that hybridizes to SEQ ID NO: 2, preferably 90% or more, more preferably 95% or more, still more preferably 98% or more, most preferably 99% or more, and has chitin deacetylase activity.

3. A gene encoding chitin deacetylase, wherein the gene has a nucleotide sequence encoding the chitin deacetylase of claim 1 or 2;

preferably, the gene has a nucleotide sequence encoding an enzyme having an amino acid sequence shown in SEQ ID NO. 2;

more preferably, the gene has a nucleotide sequence shown in SEQ ID NO. 1.

4. A recombinant vector comprising the gene of claim 3;

preferably, the expression vector of the recombinant vector is the pMA5 plasmid.

5. A recombinant strain comprising the gene of claim 2 or 3 or the recombinant vector of claim 4;

preferably, the recombinant strain is selected from at least one of bacillus licheniformis, bacillus amyloliquefaciens and bacillus subtilis;

more preferably, the recombinant strain is bacillus licheniformis.

6. The recombinant strain of claim 5, wherein the recombinant strain is Bacillus licheniformis engineering strain Bl22/pMA5-bli with the preservation number of CGMCC NO. 20933.

7. A starter culture comprising the recombinant strain of claim 5 or 6;

preferably, the recombinant strain is present in an amount of 10 per gram of said starter culture⁵-10¹⁰CFU, more preferably 10⁷-10⁹CFU。

8. A method for preparing chitin deacetylase, comprising: inoculating the recombinant strain of claim 5 or 6 and/or the starter culture of claim 7 to a fermentation medium, fermenting, and separating and purifying the fermentation product to obtain chitin deacetylase.

9. An enzyme preparation comprising the chitin deacetylase produced by the method of claim 8.

10. A method for removing acetyl groups from chitin, the method comprising: contacting at least one of the recombinant strain of claim 5 or 6, the starter culture of claim 7, the chitin deacetylase produced by the process of claim 8, and the enzyme preparation of claim 9 with chitin to deacetylate the chitin;

preferably, the conditions of the contacting include: a pH value of 4-13, more preferably 7-10; the temperature is 25-55 deg.C, more preferably 30-45 deg.C.

11. Use of at least one of the chitin deacetylase of claim 1 or 2, the gene of claim 3, the recombinant vector of claim 4, the recombinant strain of claim 5 or 6, the starter culture of claim 7, and the chitin deacetylase produced by the method of claim 8 for the production of chitin deacetylase.

12. Use of at least one of the chitin deacetylase of claim 1 or 2, the gene of claim 3, the recombinant vector of claim 4, the recombinant strain of claim 5 or 6, the starter culture of claim 7, the chitin deacetylase produced by the process of claim 8, and the enzyme preparation of claim 9 for deacetylation of chitin.

Images