CN112481228A

CN112481228A - Application of TPST gene in regulation and control of plant traits

Info

Publication number: CN112481228A
Application number: CN201910854378.0A
Authority: CN
Inventors: 不公告发明人
Original assignee: Shandong Shunfeng Biotechnology Co Ltd
Current assignee: Shandong Shunfeng Biotechnology Co Ltd
Priority date: 2019-09-10
Filing date: 2019-09-10
Publication date: 2021-03-12
Also published as: CN113242906B; WO2021047377A1; CN113242906A; CN116042563A

Abstract

The invention provides application of TPST gene in regulation and control of plant traits, in particular application of TPST gene or protein coded by TPST gene or promoter thereof in regulation and control of plant traits or preparation of a preparation or composition for regulation and control of plant traits, wherein the plant traits comprise one or more of the following traits: (i) stress resistance; (ii) thousand seed weight; (iii) yield and/or biomass; (iv) the size, weight and/or quantity of fruits and/or seeds, the invention discovers for the first time that the expression quantity or activity of TPST gene or protein coded by the TPST gene in the plant (such as rice) can be improved obviously.

Description

Application of TPST gene in regulation and control of plant traits

Technical Field

The invention relates to the field of agriculture, in particular to application of TPST genes in regulation and control of plant traits, and more particularly to application of TPST genes in regulation and control of plant agronomic traits, particularly stress resistance, yield and the like of rice.

Background

The genes in organisms are numerous and have various functions, and the genes are mutually synergistic to finish the life process. For example, the genome of the model plant Arabidopsis thaliana has about 2.5 ten thousand genes, and the genome of rice contains 3 to 5 ten thousand genes. With the completion of the whole genome sequence maps of plants such as arabidopsis, soybean, rice, corn and the like, a plurality of important genes are cloned successively, and the functions of the important genes are deeply researched. In recent years, with the growing grain problems in the world, scientists are gradually shifting from simple gene function research to more concern about the relationship of important agronomic characters of the researched gene function domain in order to improve the yield of grain crops, improve varieties, improve resistance and achieve the aims of high yield, stable yield and high quality. In grain crops, researches are mainly carried out around new plants such as crop yield, resistance, varieties and the like, so as to discover important genes for regulating and controlling target properties and cultivate excellent varieties by means of genetic engineering, molecular marker assisted breeding and the like. Part of research results are successfully applied to crop improvement, show a huge application prospect in grain production, and highlight the important significance of plant functional gene research.

Rice is one of the most important food crops in the world, is the main source of human energy and protein, and the yield and consumption of the rice always dominate the food crops. Due to the shortage of cultivated land, the increase of population and the problem of water and soil loss, the breeding and production use of new varieties of high-yield, high-quality and multi-resistance rice are always the subject of Chinese rice breeding. Therefore, the method excavates related functional genes, utilizes the genes to cultivate good varieties with target properties, develops a new breeding path, and has important significance for promoting China to advance from a large country to a strong country.

Disclosure of Invention

The invention aims to provide the application of TPST gene or its coded protein or its promoter in the regulation of plant (such as rice) characters.

Specifically, in the present invention, one or more traits may be improved in a plant by increasing the expression level or activity of a TPST gene or its encoded protein, including enhancing stress resistance of a plant, increasing thousand kernel weight, increasing yield and/or biomass, increasing size, weight and/or number of fruits and/or seeds, increasing root length or root weight. The invention provides a new technical means for the improvement of plant characters and molecular breeding.

The invention provides a first aspect of the invention provides the use of a substance which is a TPST gene or a protein encoded by it, or an enhancer thereof, for modulating a trait in a plant or for preparing a formulation or composition for modulating a trait in a plant, wherein the trait in the plant comprises one or more traits selected from the group consisting of:

(i) stress resistance;

(ii) thousand seed weight;

(iii) yield and/or biomass;

(iv) size, weight and/or number of fruits and/or seeds.

In another preferred embodiment, the stress resistance is selected from the group consisting of: salt resistance, drought resistance, disease and pest resistance, or a combination thereof.

In another preferred embodiment, the trait further comprises one or more selected from the group consisting of:

(v) root length;

(vi) root weight.

In another preferred example, the modulating the trait of a plant comprises:

(i) enhancing the stress resistance of the plants; and/or

(ii) Increasing the thousand seed weight; and/or

(iii) Increasing yield and/or biomass; and/or

(iv) Increase the size, weight and/or number of fruits and/or seeds.

In another preferred example, the modulating the trait of a plant further comprises:

(v) increasing the root length; and/or

(vi) Increase the root weight.

In another preferred embodiment, the composition comprises an agricultural composition.

In another preferred embodiment, the formulation comprises an agricultural formulation.

In another preferred embodiment, the composition comprises (a) a TPST gene or protein encoding it, or promoter thereof; and (b) an agronomically acceptable carrier.

In another preferred embodiment, the composition comprises component (a) in an amount of 0.0001 to 99 wt%, preferably 0.1 to 90 wt%, based on the total weight of the composition.

In another preferred embodiment, the composition or formulation is in a dosage form selected from the group consisting of: a solution, an emulsion, a suspension, a powder, a foam, a paste, a granule, an aerosol, or a combination thereof.

In another preferred embodiment, the composition further comprises other substances for regulating plant traits.

In another preferred embodiment, the other plant trait regulating substances include osmoregulators, brassin, algin, fertilizers with high potassium or nitrogen or phosphorus content, trace elements (such as boron zinc, calcium and silicon), triazole bactericides (such as difenoconazole, propiconazole and tebuconazole), high-potassium foliar fertilizers, plant hormones (such as abscisic acid, ethylene, cytokinin and polyamine), rare earth and PP (polypropylene)₃₃₃Benzoic acid, salicylic acid, uniconazole.

In another preferred embodiment, the osmolyte regulator is selected from the group consisting of: an inorganic regulator, an organic regulator, a growth regulator, or a combination thereof.

In another preferred embodiment, the inorganic regulator comprises Ca²⁺And salicylic acid.

In another preferred example, the organic modifier comprises betaine, proline, Sodium Nitroprusside (SNP).

In another preferred embodiment, the growth regulator comprises: abscisic acid (ABA).

In another preferred embodiment, the promoter comprises a small molecule compound that promotes the expression of the TPST gene or its encoded protein.

In another preferred embodiment, the accelerator is selected from the group consisting of: a small molecule compound, a nucleic acid molecule, or a combination thereof.

In another preferred embodiment, the plant comprises a monocot, a dicot, and/or a gymnosperm.

In another preferred embodiment, the plant includes a crop, a forestry plant, a vegetable, a melon, a flower, a pasture grass (including a lawn grass).

In another preferred embodiment, the plant is selected from the group consisting of: cruciferae, Gramineae, Leguminosae, Solanaceae, Umbelliferae, Chenopodiaceae, or combinations thereof.

In another preferred embodiment, the plant is selected from the group consisting of: arabidopsis, rice, soybean, tomato, corn, sorghum, tobacco, wheat, sorghum, millet, quinoa, potato, sweet potato, rape, cabbage, spinach, lettuce, cucumber, garland chrysanthemum, water spinach, celery, lettuce, or a combination thereof.

In another preferred embodiment, the plant comprises: rice, wheat, corn, and/or sorghum.

In another preferred embodiment, the rice is selected from the group consisting of: indica rice, japonica rice, or a combination thereof.

In another preferred embodiment, the TPST gene is selected from the group consisting of: a cDNA sequence, a genomic sequence, or a combination thereof.

In another preferred embodiment, said TPST gene is from one or more plants selected from the group consisting of: cruciferae plant, Gramineae plant, Solanaceae plant, Leguminosae plant, Chenopodiaceae plant.

In another preferred embodiment, said TPST gene is from one or more plants selected from the group consisting of: arabidopsis, rice, corn, sorghum, wheat, millet, brachypodium distachyon and quinoa.

In another preferred embodiment, the TPST gene is selected from the group consisting of: the TPST gene of arabidopsis (atttps, AT1G08030), the TPST gene of rice (ostpsst, accession number LOC9267276), the TPST gene of corn (corn ZmTPST, accession number LOC100280275), the TPST gene of sugarcane (sugarcane SbTPST, accession number LOC8071351), the TPST gene of camelina sativa (camelina sativa CsTPST, accession number LOC104754980), the TPST gene of canola (rape BrTPST, accession number LOC103871547), the TPST gene of radish (radish rstsst, accession number LOC108862166), or a combination thereof.

In another preferred embodiment, the TPST gene includes a wild-type TPST gene and a mutant TPST gene.

In another preferred embodiment, the mutant form includes a mutant form in which the function of the encoded protein is not altered (i.e., the function is the same or substantially the same as the wild-type encoded protein) and the function is enhanced after mutation.

In another preferred embodiment, the mutant TPST gene encodes a polypeptide that is the same or substantially the same as the polypeptide encoded by the wild-type TPST gene.

In another preferred embodiment, the mutant TPST gene comprises a polynucleotide having a homology of 80% or more (preferably 90% or more, more preferably 95% or more, still more preferably 98% or 99% or more) with the wild-type TPST gene.

In another preferred embodiment, the mutant TPST gene comprises a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added at the 5 'end and/or 3' end of the wild-type TPST gene.

In another preferred embodiment, the amino acid sequence of the TPST protein is selected from the group consisting of:

(i) a polypeptide having an amino acid sequence as set forth in SEQ ID No. 3;

(ii) (ii) a polypeptide which is formed by substituting, deleting or adding one or more (such as 1-10) amino acid residues of the amino acid sequence shown as SEQ ID NO. 3, has the function of regulating plant traits and is derived from (i); or

(iii) The polypeptide with the TPST activity has homology of more than or equal to 80 percent (preferably more than or equal to 90 percent, more preferably more than or equal to 95 percent or more than or equal to 98 percent) with the amino acid sequence shown in SEQ ID NO. 3.

In another preferred embodiment, the nucleotide sequence of the TPST gene is selected from the group consisting of:

(a) a polynucleotide encoding a polypeptide as set forth in SEQ ID No. 3;

(b) a polynucleotide having a sequence as set forth in any one of SEQ ID No. 1, 2 or 5;

(c) a polynucleotide having a nucleotide sequence homology of 75% or more (preferably 85% or more, more preferably 90% or more or 95%) to any of the sequences shown in SEQ ID No. 1, 2 or 5;

(d) a polynucleotide in which 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides are truncated or added at the 5 'end and/or 3' end of any one of the polynucleotides shown in SEQ ID NO. 1, 2 or 5;

(e) a polynucleotide complementary to any one of the polynucleotides of (a) - (d).

In a second aspect, the present invention provides a composition comprising:

(a) an enhancer of the TPST gene or a protein encoded thereby; and

(b) an agronomically acceptable carrier.

In another preferred embodiment, the dosage form of the composition is selected from the group consisting of: a solution, an emulsion, a suspension, a powder, a foam, a paste, a granule, an aerosol, or a combination thereof.

In another preferred embodiment, the promoter of the TPST gene or protein encoded thereby is present in the composition in an amount (wt%) of 0.05% to 10%, preferably 0.1% to 8%, more preferably 0.5% to 6%.

In another preferred embodiment, the composition further comprises other substances that modulate the traits of plants.

In another preferred example, the other plant trait regulating substances include osmoregulators, brassin, algin, fertilizers with high potassium or nitrogen or phosphorus content, trace elements (such as boron, zinc, calcium and silicon), and triazole bactericidesAgent (such as difenoconazole, propiconazole, tebuconazole), high-potassium foliar fertilizer, plant hormone (such as abscisic acid, ethylene, cytokinin, polyamine), rare earth, and paclobutrazol (PP)₃₃₃) Benzoic acid, salicylic acid, uniconazole. In another preferred embodiment, the osmolyte regulator is selected from the group consisting of: an inorganic regulator, an organic regulator, a growth regulator, or a combination thereof.

In a third aspect, the present invention provides the use of a composition according to the second aspect of the present invention for improving a plant trait.

In a fourth aspect, the present invention provides a method of improving a trait in a plant, comprising the steps of:

increasing the expression level and/or activity of the TPST gene or the protein coded by the TPST gene in the plant, thereby improving the character of the plant.

In another preferred embodiment, the method comprises administering to the plant an enhancer of the TPST gene or a protein encoded thereby.

In another preferred embodiment, the promoter is a substance that promotes the expression of the TPST gene or its encoded protein.

In another preferred embodiment, the method comprises introducing an exogenous TPST gene into a plant.

In another preferred embodiment, the method comprises introducing into a plant a substance that promotes the expression of an endogenous TPST gene or protein encoding it.

In another preferred embodiment, the method comprises promoting expression of an endogenous TPST gene or protein encoding the same in the plant.

In another preferred example, the method comprises the steps of:

(i) providing a plant or plant cell; and

(ii) introducing a TPST gene sequence into said plant or plant cell, thereby obtaining a transgenic plant or plant cell.

In another preferred example, the method comprises the steps of:

(a) providing agrobacterium carrying an expression vector of a TPST gene sequence;

(b) contacting a plant cell or tissue or organ with the agrobacterium of step (a) such that the gene sequence of TPST is transferred into the plant cell and integrated into the chromosome of the plant cell;

(c) selecting plant cells or tissues or organs into which the TPST gene sequence has been transferred; and

(d) regenerating the plant cell or tissue or organ of step (c) into a plant.

In another preferred embodiment, the expression level or activity of the TPST gene or its encoded protein in the plant tissue or plant cells is increased by 5% or more, 10% or more, 20% or more, preferably 50% or more.

In another preferred embodiment, the expression "increase" means that the expression or activity of the TPST gene or its encoded protein is increased to satisfy the following condition:

the ratio of A1/A0 is not less than 5%, preferably not less than 10%, more preferably not less than 20%, most preferably 50-200%; wherein, A1 is the expression or activity of TPST gene or its coded protein in plant tissue or plant cell; a0 is the expression or activity of the same TPST gene or its coded protein in wild-type plant tissue or plant cells of the same type.

In another preferred embodiment, the ratio of the activity E1 of TPST in the plant to the background activity E0 of the same TPST in a wild-type plant of the same species (E1/E0) is ≥ 2 times, preferably ≥ 5 times, more preferably ≥ 10 times.

In a fifth aspect, the present invention provides a method for preparing a genetically engineered plant tissue or plant cell comprising the steps of:

increasing the expression quantity and/or activity of TPST gene or its coding protein in plant tissue or plant cell, thereby obtaining the genetically engineered plant tissue or plant cell.

In another preferred embodiment, the genetic engineering comprises a transgene.

In another preferred embodiment, the method further comprises introducing into the plant tissue or plant cells an enhancer of the TPST gene or a protein encoding the same.

In a sixth aspect, the present invention provides a method for producing a plant with improved traits, comprising the steps of:

a plant having an improved trait is obtained by regenerating a plant body from a genetically engineered plant tissue or plant cell prepared by the method of the fifth aspect of the present invention.

In another preferred embodiment, the trait comprises one or more traits selected from the group consisting of:

(i) stress resistance;

(ii) thousand seed weight;

(iii) yield and/or biomass;

(iv) size, weight and/or number of fruits and/or seeds.

(iii) root length;

(iv) root weight.

In another preferred embodiment, the trait improvement comprises:

(i) enhancing the stress resistance of the plants; and/or

(ii) Increasing the thousand seed weight; and/or

(iii) Increasing yield and/or biomass; and/or

(iv) Increase the size, weight and/or number of fruits and/or seeds.

In another preferred embodiment, the trait improvement further comprises:

(iii) increasing the root length; and/or

(iv) Increase the root weight.

The seventh aspect of the present invention provides a genetically engineered plant, wherein the plant into which the TPST gene or its encoded protein, or its promoter, or the plant is introduced is prepared by the method of the sixth aspect of the present invention.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the gene expression detection of AtTPST of transgenic T1 generation rice line AtTPST. Wherein, the control is a Nipponbare negative control transferred into an empty vector pCambia1305, wherein, P35S-3, 46, 51 and 52 are TPST CDs transgenic rice lines driven by 35S promoter; PTPST-31, 40, 46, 47 is a transgenic rice line with an Arabidopsis TPST endogenous promoter driving the AtTPST genomic sequence.

FIG. 2 shows the comparison of metal ion content in transgenic and wild rice seeds. Wherein, the content of potassium element in figure 2A, and the content of sodium element in figure 2B; control is a Nipponbare negative control transferred into an empty vector pCambia1305, P35S is TPST CDs transgenic rice driven by a 35S promoter, and PTPST is transgenic rice driven by an Arabidopsis thaliana TPST endogenous promoter to drive AtTPST genome sequence.

FIG. 3 shows the comparison of seed weight of transgenic and wild rice seeds, wherein control is Nipponbare negative control transferred into empty vector pCambia1305, P35S is TPST CDs transgenic rice driven by 35S promoter, PTPST is transgenic rice driven by Arabidopsis thaliana TPST endogenous promoter to drive AtTPST genome sequence.

FIG. 4 shows that the water-cultured seedling of the AtTPST transgenic rice has a more developed root system, and the Arabidopsis thaliana TPST endogenous promoter in FIG. 4A drives the AtTPST genome sequence transgenic line No. 7 and No. 31 to have a more developed root system compared with Nipponbare (Japonica) and an empty vector control transformed Nipponbare negative control (control); FIG. 4B Arabidopsis TPST endogenous promoter driving AtTPST genomic sequence transgenic line No. 7 and line No. 31 to increase root length compared to Nipponbare (Japonica), empty vector control transformed Nipponbare negative control (control); FIG. 4C Arabidopsis thaliana TPST endogenous promoter driving AtTPST genome sequence transgene No. 7 strain and No. 31 strain to increase root fresh weight and aerial part compared with Nipponbare (Japonica), the empty vector control transformation Nipponbare negative control (control); japonica refers to Nipponbare; control refers to the negative control of converting the empty vector control into Nipponbare; PTPST-7 refers to a No. 7 strain of an Arabidopsis TPST genome sequence driven by an endogenous promoter; PTPST-31 refers to a transgenic No. 31 strain of an Arabidopsis TPST endogenous promoter driving AtTPST genomic sequence.

Fig. 5 shows the drought resistance of AtTPST transgenic rice, where a: normal growing rice seedlings; b: stopping watering the rice seedlings which germinate for 2 weeks, and carrying out drought treatment for two weeks; c, 1 week after the watering is resumed.

Detailed Description

After extensive and intensive research, the inventor discovers for the first time that the expression quantity or activity of TPST genes or coding proteins thereof in plants (such as rice) is improved and the properties of the plants can be obviously improved through research and screening of a large number of plant property sites. On this basis, the inventors have completed the present invention.

Specifically, when the expression amount or activity of the TPST gene or its encoded protein is increased in the plant, it is possible to (i) enhance plant stress resistance; and/or (ii) increase thousand kernel weight; and/or (iii) increase yield and/or biomass; and/or (iv) increasing the size, weight and/or number of fruits and/or seeds; and/or (v) root length; and/or (vi) root weight.

TPST gene

TPST, tyrosyl-protein sulfo-transferase, known in Chinese as tyrosylsulfonyltransferase, is involved in post-translational sulfation modification of proteins by transferring the sulfonic acid group of the substrate 3-phosphoadenosine-5-phosphate sulfate (PAPS) to a tyrosine residue of the protein, which modification confers a mature biological function to the secreted or membrane protein^[1]。

As used herein, the terms "TPST gene of the present invention", "TPST gene" are used interchangeably and refer to a TPST gene derived from a plant (e.g., rice, arabidopsis), or a variant thereof. In a preferred embodiment, the nucleotide sequence of the TPST gene of the invention is shown in SEQ ID No. 2. Variants of the gene may be obtained by insertion or deletion of regulatory regions, random or site-directed mutagenesis, and the like.

The present invention also includes nucleic acids having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, e.g., 99%) homology to the preferred gene sequences of the present invention (SEQ ID No.:2), which are also effective in regulating the traits of plants such as rice. "homology" refers to the level of similarity (i.e., sequence similarity or identity) between two or more nucleic acids in terms of percentage positional identity.

In the present invention, the nucleotide sequence in SEQ ID NO. 2 can be substituted, deleted or added with one or more (usually 1-90, preferably 1-60, more preferably 1-20, most preferably 1-10) nucleotides, and added with several (usually less than 60, preferably less than 30, more preferably less than 10, most preferably less than 5) nucleotides at the 5 'and/or 3' end to generate the derivative sequence of SEQ ID NO. 2, which can basically encode the amino acid sequence shown in SEQ ID NO. 3 even if the homology with SEQ ID NO. 2 is low due to the degeneracy of codons.

In addition, the meaning of "the nucleotide sequence in SEQ ID No. 2 is substituted, deleted or added with at least one nucleotide derivative sequence" also includes a nucleotide sequence that can hybridize to the nucleotide sequence shown in SEQ ID No. 2 under moderate stringency conditions, more preferably under high stringency conditions. These variants include (but are not limited to): deletion, insertion and/or substitution of several (usually 1 to 90, preferably 1 to 60, more preferably 1 to 20, most preferably 1 to 10) nucleotides, and addition of several (usually less than 60, preferably less than 30, more preferably less than 10, most preferably less than 5) nucleotides at the 5 'and/or 3' end.

It is to be understood that although the genes provided in the examples of the present invention are derived from Arabidopsis thaliana, the gene sequences of TPST derived from other similar plants (especially plants belonging to the same family or genus as Arabidopsis thaliana or plants of other families or genera having higher homology to Arabidopsis thaliana) having a certain homology (conservation, e.g., greater than 80%, such as 85%, 90%, 95%, or even 98% sequence identity) with the sequence of the present invention (preferably, the sequence is as shown in SEQ ID NO: 2) are also included in the scope of the present invention, as long as the sequence can be easily isolated from other plants by those skilled in the art after reading the present application based on the information provided herein, and methods and means for aligning the sequence identity are also well known in the art, such as BLAST.

The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA forms include: DNA, genomic DNA or artificially synthesized DNA, the DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region as shown in SEQ ID No. 2 or may be a degenerate variant.

Polynucleotides encoding mature polypeptides include coding sequences encoding only mature polypeptides; the coding sequence for the mature polypeptide and various additional coding sequences; the coding sequence (and optionally additional coding sequences) as well as non-coding sequences for the mature polypeptide.

The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences. The invention also relates to variants of the above polynucleotides which encode fragments, analogs and derivatives of the polyglycosides or polypeptides having the same amino acid sequence as the invention. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the polynucleotides of the present invention. In the present invention, "stringent conditions" mean: (1) hybridization and elution at lower ionic strength and higher temperature, such as 0.2 XSSC, 0.1% SDS, 60 ℃; or (2) adding denaturant during hybridization, such as 50% (v/v) methyl phthalein amine, 0.1% calf serum/0.1% Ficoll, 42 deg.C, etc.; or (3) hybridization occurs only when the identity between two sequences is at least 90% or more, preferably 95% or more.

The full-length nucleotide sequence of the TPST or a fragment thereof can be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using a commercially available DNA library or a cDNA library prepared by conventional methods known to those skilled in the art as a template. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order. Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. Usually, it is cloned into a vector, transferred into a cell, and then isolated from the propagated host cell by a conventional method to obtain the relevant sequence.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them. At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

TPST gene encoded polypeptide

As used herein, the terms "polypeptide of the invention", "protein encoding a TPST gene", which are used interchangeably, refer to a plant-derived TPST polypeptide and variants thereof. In a preferred embodiment, a typical amino acid sequence of a polypeptide of the invention is shown in SEQ ID No. 3.

The invention relates to a TPST polypeptide for regulating and controlling plant traits and a variant thereof, and in a preferred embodiment of the invention, the amino acid sequence of the polypeptide is shown as SEQ ID NO. 3. The polypeptide of the invention can effectively regulate and control the character of plants (such as rice).

The invention also includes polypeptides or proteins having 50% or more (preferably 60% or more, 70% or more, 80% or more, more preferably 90% or more, more preferably 95% or more, most preferably 98% or more, e.g., 99%) homology to the sequence shown in SEQ ID No. 3 of the invention and having the same or similar functions.

The "same or similar functions" mainly refer to: "control the traits of plants or crops (such as rice)".

The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention can be naturally purified products, or chemically synthesized products, or using recombinant technology from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, higher plant, insect and mammalian cells). Depending on the host used in the recombinant production protocol, the polypeptides of the invention may be glycosylated or may be non-glycosylated. The polypeptides of the invention may or may not also include an initial methionine residue.

The invention also includes fragments and analogs of the TPST proteins having TPST protein activity. As used herein, the terms "fragment" and "analog" refer to a polypeptide that retains substantially the same biological function or activity of a native TPST protein of the invention.

The polypeptide fragment, derivative or analogue of the invention may be: (i) polypeptides in which one or more conserved or non-conserved amino acid residues (preferably conserved amino acid residues) are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code; or (ii) a polypeptide having a substituent group in one or more amino acid residues; or (iii) a polypeptide formed by fusing the mature polypeptide to another compound, such as a compound that increases the half-life of the polypeptide, e.g., polyethylene glycol; or (iv) a polypeptide formed by fusing an additional amino acid sequence to the polypeptide sequence (e.g., a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the definitions herein.

In the present invention, the polypeptide variant is an amino acid sequence shown in SEQ ID NO. 3, a derivative sequence obtained by several (usually 1-60, preferably 1-30, more preferably 1-20, and most preferably 1-10) substitutions, deletions, or additions of at least one amino acid, and one or several (usually less than 20, preferably less than 10, and more preferably less than 5) amino acids added at the C-terminal and/or N-terminal. For example, in the protein, when the performance similar or similar amino acid substitution, usually does not change the protein function, C terminal and/or \ terminal addition of one or several amino acids usually does not change the protein function. These conservative changes are best made by making substitutions according to table 1.

TABLE 1

The invention also includes analogs of the claimed proteins. These analogs may differ from the native SEQ ID NO. 3 by amino acid sequence differences, by modifications that do not affect the sequence, or by both. Analogs of these proteins include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by irradiation or exposure to mutagens, site-directed mutagenesis, or other well-known biological techniques. Analogs also include analogs having residues other than the natural L-amino acids (e.g., D-amino acids), as well as analogs having non-naturally occurring or synthetic amino acids (e.g., beta, gamma-amino acids). It is to be understood that the proteins of the present invention are not limited to the representative proteins exemplified above.

Modified (generally without altering primary structure) forms include: chemically derivatized forms of the protein such as acetoxylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those performed during protein synthesis and processing. Such modification may be accomplished by exposing the protein to an enzyme that performs glycosylation, such as mammalian glycosylating or deglycosylating enzymes. Modified forms also include sequences having phosphorylated amino acid residues (e.g., phosphotyrosine, phosphoserine, phosphothreonine).

Expression vector

The invention also relates to vectors comprising the polynucleotides of the invention, as well as genetically engineered host cells engineered with the vectors of the invention or the mutein-encoding sequences of the invention, and methods for producing the polypeptides of the invention by recombinant techniques.

The polynucleotide sequences of the present invention may be used to express or produce the proteins of the present invention or variants thereof by conventional recombinant DNA techniques. Generally, the following steps are performed:

(1) transforming or transducing a suitable host cell with a polynucleotide encoding a protein of the invention or a variant thereof, or with a recombinant expression vector comprising the polynucleotide;

(2) a host cell cultured in a suitable medium;

(3) isolating and purifying the protein from the culture medium or the cells.

The present invention also provides a recombinant vector comprising the gene of the present invention. In a preferred embodiment, the promoter downstream of the recombinant vector comprises a multiple cloning site or at least one cleavage site. When it is desired to express the target gene of the present invention, the target gene is ligated into a suitable multiple cloning site or restriction enzyme site, thereby operably linking the target gene with the promoter. As another preferred mode, the recombinant vector comprises (in the 5 'to 3' direction): a promoter, a gene of interest, and a terminator. If desired, the recombinant vector may further comprise an element selected from the group consisting of: a 3' polyadenylation signal; an untranslated nucleic acid sequence; transport and targeting nucleic acid sequences; resistance selection markers (dihydrofolate reductase, neomycin resistance, hygromycin resistance, fluorescent proteins, etc.); an enhancer; or operator.

In the present invention, the polynucleotide sequence encoding the protein may be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors well known in the art. Any plasmid or vector may be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing a DNA sequence encoding a protein of the invention and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. When the gene of the invention is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added in front of the transcription initiation nucleotide.

The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling gene expression in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Vectors comprising the gene, expression cassette or gene of the invention may be used to transform appropriate host cells to allow the host to express the protein. The host cell may be a prokaryotic cell, such as E.coli, Streptomyces, Agrobacterium; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. It will be clear to one of ordinary skill in the art how to select an appropriate vector and host cell. Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic (e.g., E.coli), competent cells capable of DNA uptake can be harvested after exponential growth phase using CaCl₂Methods, the steps used are well known in the art. Another method is to use MgCl₂. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc. The transformed plant may be transformed by methods such as Agrobacterium transformation or biolistic transformation, for example, leaf disc method, immature embryo transformation, flower bud soaking method, etc. The transformed plant cells, tissues or organs can be regenerated into plants by conventional methods to obtain transgenic plants.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast, plant cells (e.g., rice cells).

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The protein of the present invention may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

Improving traits in plants

In the present invention, there is also provided a method of improving a trait in a plant, in particular promoting or increasing expression of a TPST gene or protein encoding therefor, thereby improving a trait in a plant, said trait being selected from one or more of the group consisting of:

(i) stress resistance;

(ii) thousand grains are heavy.

(iii) Yield and/or biomass;

(iv) size, weight and/or number of fruits and/or seeds.

In a preferred embodiment, the trait further comprises one or more selected from the group consisting of:

(v) root length;

(vi) root weight.

In a preferred embodiment, the traits of the modified plant comprise:

(i) enhancing the stress resistance of the plants; and/or

(ii) Increasing the thousand seed weight; and/or

(iii) Increasing yield and/or biomass; and/or

(iv) Increase the size, weight and/or number of fruits and/or seeds.

In a preferred embodiment, the traits of the modified plant further comprise:

(v) increasing the root length; and/or

(vi) Increase the root weight.

The main advantages of the invention include:

(1) the invention discovers for the first time that increasing the content of TPST gene in plants or up-regulating expression of the gene can improve the agronomic traits of plants, such as stress resistance, thousand kernel weight, yield, biomass, fruit or seed size, weight, quantity, root length, root weight and the like.

(2) The invention discovers for the first time that the root system development of the rice in the seedling stage can be promoted by adopting the arabidopsis thaliana endogenous promoter to drive the expression of the arabidopsis thaliana AtTPST gene in the rice, so that the growth of the overground part of the rice is necessarily facilitated under the natural cultivation condition, and the effect of strengthening the seedling is achieved. The developed and strong root system can also ensure that the rice has excellent growth traits of drought resistance and barren resistance, and can promote the strengthening of later-period rice plants from multiple aspects. Moreover, the gene can improve the thousand kernel weight of the seeds and directly promote the rice yield, so that the plants have excellent yield traits. The problems of food shortage and efficient land utilization are solved most directly and effectively.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise specified, materials and reagents used in the examples are all commercially available products.

Example 1 acquisition of TPST gene:

1) TPST gene promoter and genomic sequence cloning

The total volume of the reaction system is 25 muL, the template is arabidopsis genome DNA for gene cloning, and a TPST gene full-length sequence (SEQ ID NO:1) is obtained, the promoter sequence is shown as SEQ ID NO:4, and the genome sequence is shown as SEQ ID NO: 5.

The primers used (designed by the inventors) were as follows:

TPST-F:GTAAGCTTCATGGGAGCTCCA(SEQ ID NO.:6)；

TPST-R:AATCTTAACTTTGGAGGTTCTTCT(SEQ ID NO.:7)。

reaction system:

water was added to 50. mu.L.

And (3) amplification process: 2min at 98 ℃;

(98℃20sec；58℃30min；72℃90sec)for 30cycles；

72℃5min。

2) cloning of the CDS Gene sequence of TPST

The total volume of the reaction system is 25 muL, the template is Arabidopsis thaliana cDNA to carry out gene cloning, and a TPST CDS sequence (the sequence is shown as SEQ ID NO: 2) is obtained, and the amino acid sequence coded by the gene is shown as SEQ ID NO: 3;

the primers used (designed by the inventors) were as follows:

TPST-CDS-F:ATGCAAATGAACTCTGTTTGGA(SEQ ID NO.:8)；

TPST-CDS-R:AATCTTAACTTTGGAGGTTCTTCT(SEQ ID NO.:9)。

reaction system:

adding water to 50 μ L

And (3) amplification process: 2min at 98 ℃;

(98℃20sec；58℃30min；72℃90sec)for 30cycles；

72℃5min。

example 2: construction and character analysis of transgenic plants

1. Construction of transgenic vectors

1) Construction of TPST Gene transgene vector

The sequence shown in SEQ ID NO:1 was cloned into pCambia1305 vector, and the sequence was compared with HA (influenza hemagglutinin, influenza hemagglutinin:

10) ) label fusion expression to construct TPST gene transgenic carrier.

2) Construction of 35S-TPST transgenic vector

The sequence shown in SEQ ID NO. 2 is cloned to pCambia1305 vector, and fused and expressed with HA tag to construct 35S-TPST gene transgenic vector.

2. Genetic transformation of rice

The rice genetic transformation adopts an agrobacterium EHA105 mediated genetic transformation method, and comprises the following steps:

removing hull of mature rice seed, sterilizing with mercuric chloride, and culturing in dark at 26 deg.C for 30d in callus induction culture medium; culturing the induced callus on a subculture medium for 15 d; selecting fresh yellow callus, soaking in agrobacterium liquid carrying target carrier for 30min, drying, and culturing at 18 deg.C for 2 d; washing the callus with sterile water, drying by blowing, placing on a resistant screening culture medium, and performing 2 rounds of resistance screening for 15 days each time; transferring the obtained resistant callus to a differentiation culture medium, and differentiating for about 40d in a light culture room to generate a regeneration plant; transferring the regenerated plant to rooting culture medium, culturing for 10 days, hardening seedling for 3-5 days, and transplanting.

3. Transplantation, expression level identification and phenotypic analysis

And (3) genetically constructing each rooted transgenic plant into a line, transplanting the line into a greenhouse, and taking leaves to perform realtime qRT-PCR expression quantity identification.

The primers used (designed by the inventors) were:

qTPST-1F TTACTTCTTAGCTCAGTTATTGGC(SEQ ID NO.:11)

qTPST-1R CAATGAAAATATGTTCTGCCTCCA(SEQ ID NO.:12)

reaction system:

adding water to 15 μ L

And (3) amplification process: 2min at 98 ℃; (98 ℃ for 20 sec; 60 ℃ for 30sec) for 45 cycles;

the fusion curve is added.

4. Results

1) AtTPST gene expression detection in AtTPST transgenic T1 generation rice

As shown in figure 1, after seeds of transgenic lines of rice of T1 generation germinate, total RNA is extracted and subjected to RT-qPCR detection, and compared with negative control of a transformation empty vector, AtTPST expression lines P35-3/46/51/52 driven by a PCMV35S promoter and AtTPST gene transgenic rice line PTPST-31/40/46/47 driven by an AtTPST endogenous promoter have the AtTPST gene transcripts detected, and the activity of the AtTPST endogenous promoter in the detected lines is obviously higher than that of the CMV35S promoter line, and the transcription activity in the rice of T1 generation is averagely 3.5 times higher than that of the rice of the CMV35S promoter line.

2) Phenotypic identification of AtTPST transgenic T1 generation rice

See FIGS. 2-4 for the results of the identification. The metal ion content of the AtTPST transgenic rice seeds is obviously different from that of a control group, particularly the AtTPST transgenic rice seeds have higher K content, the K content of the AtTPST transgenic plants is higher than 130% of that of the control group (figure 2A), and the lower Na content is about 50% of that of the control group (figure 2B).

The transgenic plants had seeds heavier than the control by thousand kernel weight, with an average weight gain of about 15% (fig. 3).

The transgenic rice seedling of the AtTPST has a more developed root system, the root length is increased by more than 14%, the root weight is increased by more than 60%, and the transgenic rice seedling has a obviously more developed root system (fig. 4A-4C), wherein an endogenous promoter of the Arabidopsis TPST drives the transgenic No. 7 strain and the transgenic No. 31 strain of the AtTPST genome sequence to have more developed root systems (fig. 4A) compared with a negative control (control) of Nipponbare (Japonica) and an empty vector control transformed Nipponbare (fig. 4B), the root length is obviously increased, the fresh weight of the root is obviously increased, and the overground part is also increased (fig. 4C).

3) Drought resistance test of AtTPST transgenic T1 generation rice

The seeds are soaked in water for accelerating germination for three days. Weighing dry soil with equal mass in a flowerpot, placing the flowerpot on the same tray, and soaking and irrigating until the upper soil is wet. The germinated seeds were planted in soil. And (5) greenhouse culture. The upper soil was kept moist before drought treatment. Watering is stopped after the rice seedlings grow for two weeks, and the phenotypic change is observed after the rice seedlings grow for two weeks. Growth was then resumed for 1 week after watering and observed for phenotypic changes.

The results show that: under normal conditions, there was no significant difference between the wild type group and the vehicle control group, as shown in FIG. 5A. After two weeks of drought treatment, the growth of seedlings of the wild type group and the carrier control group is obviously inhibited, and the seedlings are remarkably shortened and have wilting leaves compared with the height of transgenic plants, as shown in fig. 5B. After rehydration, seedlings of the wild type group and the vector control group were not improved significantly, and the transgenic plants were improved to some extent, as shown in fig. 5C.

5. Conclusion

The increase of TPST content can reduce Na/K ratio in plants, thereby enhancing the salt resistance of the plants; meanwhile, the thousand seed weight of the seeds is obviously increased, so that the yield of crops is improved; the root length and the root weight of the plant are obviously increased, so that the drought resistance, the disease and pest resistance and the lodging resistance of the plant are improved, and the environment adaptability is enhanced. The TPST is shown to have important scientific application value in cultivating new varieties of high-yield and stress-tolerant plants.

EXAMPLE 3 experiment for enhancing OsTPST Gene-related expression level in Rice

Further, the inventors will increase the expression level of OsTPST in rice by the following method:

(1) the endogenous content of the rice is increased by transferring OsTPST related genes into the rice;

(2) inserting OsTPST after endogenous strong promoter such as UBQ1, UBQ2, UBI9 or ACT2 to increase its expression level;

(3) the insertion of AHD and/or AMV at the upstream or downstream of the OsTPST promoter promotes the expression of OsTPST and increases the expression level.

The method can obviously enhance the expression quantity of endogenous TPST of the rice and improve partial properties of the rice, such as increasing thousand kernel weight, enhancing stress resistance, increasing root length and root weight and the like, and provides a new means for improving plant properties.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Reference to the literature

[1]Moore K L(2003).The biology and enzymology of protein tyrosine Osulfation.J Biol Chem，278(27):24243-24246。

Sequence listing

<110> Shunheng Biotech Co., Ltd

Application of <120> TPST gene in regulation and control of plant traits

<130> P2019-1380

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5523

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 1

gtaagcttca tgggagctcc agggcaagct gcagagacag gtgtgtgaga accataacca 60

gattcctctg tttgaaggca gagaacaata ctaaagatgt tttgatacaa agactcaatg 120

atttcttcat cggaacaagt agtaagagaa tcaatcctca tgtgattatt gtagtggtca 180

cagagtggag aaattgcaat gattccactg tctcctttag agatcatagg agttatgggt 240

tccacataac ctgatgttcc ttcaatggag ttttcttcat agtccatggt gatggtgtca 300

caatatctgg aaaaagacag taaaaccata cattcagaca aagcccttgt aaacgaaacc 360

agaggaagca acgagtttaa aatccatgat tattgaatag tacccctaat aagctatttc 420

acaaattgcg ttaagttcga gaagaaacat ttagtcgcat atcgtgatgc cattaatgaa 480

agaaaaaaaa tctaatctaa aagacaaaaa gattgcacga caaattagat gatacgaaat 540

catcgaattt attagagtta tggcactttt tcagaaacga ttcaaaagag tgagaaaatc 600

tctatacctt tgactcatga ggtctgtaat tttttgttta tcttttcttt ttttctttga 660

cagcaatttt tttttttttt ttttttttgc gattttaata ttttttataa acttaagaaa 720

atgataagcg gagaaacaga agacactagg cccatttaat tatcaggccc aattgtatta 780

atatcttaaa ccttctttaa aaccataaga ttaacacaaa ggtttacgac tatccttcta 840

gattttattt tccaagcatt tttaatccta ctgtatttct caaatctaca acctttgatg 900

attttttgtc atcaccaact tttttaaaaa aataattcat tttaggacat ttcaatccca 960

atggcaataa ttacccattt atacgaattc tagcatacta gttaatgtat aattactttg 1020

ctatttattg gaaacctatg gaggtaatat ttatctctaa aggaatttat atatattttt 1080

agttaaatac atatttattg atattttagg attacaataa acatggcaac aaattatatt 1140

aaaaattaaa aaacagatat ttttattgta tagatgaaaa caaacaagtc attgcaaaac 1200

gaatggaacg atgacaagat tgaaaggaga cagcatccgc catcagcatg agacatttga 1260

acccacaaca tttttttgta gacaagtctg gtctttttac ttaaagcaaa taaactctag 1320

actttaggcc ttataacatt taagcataaa gtatggccac tgtcaggatt gaactctcaa 1380

atctcaacgg aaaactttaa tgctcataaa aatctgtgaa cgaatgattg aactgaagca 1440

atgactaaga acaaatgagt cataactcat aaccatgatc ctgtaactat aagtttcctc 1500

cttgaggtct ttcacacaca acgagggatg gatgtacatg tcaccagaag caacaagaag 1560

atcaagacgc aactaaaagg ccaaaagaag tgaagaacaa aatattacac aaagagggga 1620

tgtatagttg tatacccacg gtttaccgat ttcggttttc gttccgataa ccggttatgt 1680

atttcatttt gtattatata gaaggcattg gtcaaaccgc actcgaacca gaaaggaaag 1740

tgcattcata ctattactga ctagtggaaa aaaaaaaaaa aaaaaagcat tggtctctct 1800

caaaaaagat taattcgttt ggctaaatca aatttgacac tagtgtcttc ctcagtgcgt 1860

gtttataatt tttctgggtg gcgagaaacc aagagaaaat ctcgtgaccc tgttctctcg 1920

ggagcgcaca caatctctct tcttcttcgt cttcctcctc caatcgatgt aatcacacac 1980

acacacaaaa acacatcttt tccttgtttt cgtaggacct agtagatagc gagttttgcc 2040

cccaaaacag cgatcgaggg aatttatgag cacgagatct cgattcccca tacacgtagg 2100

cctctgcttc tctctcttgt tcctttgttc ctttctttat tcgattttct gggtcccttt 2160

tgccctgttt ttcctctgtc tccttccccc aaaatctttc ggttttgttt ttatacaact 2220

tgcaaccgtt aatgttcatc ctcaccgatt gatcacctac tcttttccct tcctgggttt 2280

tgtttctttc gaataaagat tgatccttct ttcacttata atcgttttgg taatcagtag 2340

ggtttggaat cgaggcacaa tgcaaatgaa ctctgtttgg aagctgtctc ttgggttatt 2400

acttcttagc tcaggtatgt atgcagaatg gttttacaaa attgttcatt tgataaaaaa 2460

gctggacttg tctctgatgt tcttggaata attggcaaat tatatctcag ttattggctc 2520

ttttgcggaa cttgattttg gccattgcga aactcttgtg aaaaaatggg ctgattcttc 2580

ttcatctcgt gaagaacatg ttaataaaga caaacgctcg cttaaggatt tgctcttctt 2640

tctccacgtt ccgcgaactg gaggcagaac atattttcat tggtgatttg atttccttta 2700

ccaaaaagtt tttgagagat tcttttatga ttgttgtgtg gttaaggctg tgtttgtgct 2760

cttgtagttt tttgaggaag ttgtatgata gctctgagga atgtcctcga tcttacgaca 2820

agctccactt caatccaagg tatcttaatt tcatcagtgc tctcgctaat tgtacgtctt 2880

tatttgatgc caaagactct ttcttgtgga aacaataaga tggcttacag aatgctgttt 2940

gtacattcta ttggttgtta agttgacttt agatagctta gctagacata tataaagtta 3000

aatattgttt catatgaaaa tcaattttcc ctagcctcct ttacctaaag aaaaacaatg 3060

tgaaaaaagt attttgcctg tggtgttact accttcggac agttaagatc gtgttgactc 3120

gtaaatttat aggaaggaaa agtgcaagtt gttagccaca catgatgatt atagtttgat 3180

ggcaaagctt ccgagggaga gaacttcggt gatgacaata gttcgggatc ctattgcgcg 3240

tgtgttaagc acttatgaat tttccgtaga ggtagcagct aggtttttgg tgcatcccaa 3300

tttaacttct gcgtcaagga tgtctagccg catacgcaag agtaatgtaa taagcacact 3360

agacatatgg ccatggaaat acctagttcc atggatgaga gaagacttgt ttgctcgggt 3420

atgtcgacct atcccattcg tcttttttgg cttttaagct agaacatgat aagaacacat 3480

aaaacttggg ctgaagcttt ttttactcat ccttggcttt tcttagcgag atgcacgaaa 3540

attgaaggag gtagtgatca ttgaggacga taacccgtat gacatggagg agatgcttat 3600

gcctttgcac aaatatcttg atgcgcctac tgctcatgac atcatccaca atggagcgac 3660

ttttcaggta ctttttcatg ctatttgttt aagttttcaa agttattgat tagagatctc 3720

cagagcattt tcatttcact tcacagattg caggattgac aaataactcc catttatcag 3780

aagcacacga ggttcggcat tgtgtgcaga aattcaaaag ccttggtgag tctgttctcc 3840

aagttgccaa ggtagtaaca cttcttcttc atcatagttc actgcgtctt ggtattgtgc 3900

ttttaaaagc agcagattct gtaagctttt ttaaattttg cagaggaggc tagacagcat 3960

gttgtatgtt ggactgacag aggagcacag ggaatctgca tcactttttg ccaatgtagt 4020

gggttctcaa gtgctgtctc aagtggttcc gtccaatgca actgcgaaaa tcaaagctct 4080

taaatcaggt tggtgtaagt ttcttaatac catcgctggg ctatctaagg agaatctagc 4140

aacttagttg aaggacatgg tgatcatttt tttagtcaca gtgtacagtt ttttcagagt 4200

accgctttgg agatggtatt tactttagtt tttggctttt gaaagtcaaa acccgtcata 4260

ttattcatta aaatgtttga ctgatatttt tcattcactt tttaggagtt tgatttttaa 4320

ttacctaggg aagctactta ttgttctctg ttatttgggg attatcgtat aaggtttgat 4380

tgtctttcat catgaagatt tttctgatct atgtttcttg ttgtcacatc atctttaaag 4440

gttctcttgc cctcttttgt tttagacttg tgtcttgtta ctctgggtcc ctgggtttat 4500

taaagtttct ttgttggtta atcatagtct cttagagtaa gtagaatgat gatatgacag 4560

ttcatgtgca tacagcctag gctttctatt gcttttgttg tatttaaagt caggataaca 4620

aatggttgta cttgcactca ccaaattgtc aactttattt ccttgatgct tcagaagcaa 4680

gtgtcacaat ttcagaaacc gggtcagata agagtaatat tcaggtaaag tcctgctgca 4740

gaaggtaata atttgtttgt tcaactgtca tttttgtaat tgtcttgctg aaaatggctg 4800

tgacattaca gaatggtaca tctgaagtta cattgaataa ggcagaagct aagagtggga 4860

atgtaagtag aatccctttt ccaatttatt atcaacgctt gagaccttgt gtgactttta 4920

tatatacact tcagatgacg gtaaaaaccc ttatggaagt ctatgaaggc tgcatcactc 4980

atttacgaaa gtcccaagga accagacggg tcaactctct gaagagaata actccagcaa 5040

attttacaag aggggtaaag tgttttcgta catgatctaa acttagtaaa gttaatgaga 5100

gaaggctgga ataatgaaat cttttgacaa tgcatctaac agacgcgtac aagagttcct 5160

aaagaggtca ttcagcagat caaatcgctt aacaacctcg atgtggagct ctacaaatat 5220

gcaaaagtaa tctttgccaa agaacatgaa ttagtgtcga ataagttgat ctcaagtgta 5280

agaaacttct tgtcttcaca tttcgccttt tagtttctgt ctgatataag actaaactcc 5340

atgattcgtg tgcagtctaa gagaagcatt gttgatctgc cgagtgagtt aaagagcgta 5400

ttgggagaaa tgggtgaaga gaagctatgg aagttcgtac cagtggcatt gatgctttta 5460

ttgatcgtcc tcttctttct atttgtaaac gctaaaagga gaagaacctc caaagttaag 5520

att 5523

<210> 2

<211> 1503

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 2

atgcaaatga actctgtttg gaagctgtct cttgggttat tacttcttag ctcagttatt 60

ggctcttttg cggaacttga ttttggccat tgcgaaactc ttgtgaaaaa atgggctgat 120

tcttcttcat ctcgtgaaga acatgttaat aaagacaaac gctcgcttaa ggatttgctc 180

ttctttctcc acgttccgcg aactggaggc agaacatatt ttcattgttt tttgaggaag 240

ttgtatgata gctctgagga atgtcctcga tcttacgaca agctccactt caatccaagg 300

aaggaaaagt gcaagttgtt agccacacat gatgattata gtttgatggc aaagcttccg 360

agggagagaa cttcggtgat gacaatagtt cgggatccta ttgcgcgtgt gttaagcact 420

tatgaatttt ccgtagaggt agcagctagg tttttggtgc atcccaattt aacttctgcg 480

tcaaggatgt ctagccgcat acgcaagagt aatgtaataa gcacactaga catatggcca 540

tggaaatacc tagttccatg gatgagagaa gacttgtttg ctcggcgaga tgcacgaaaa 600

ttgaaggagg tagtgatcat tgaggacgat aacccgtatg acatggagga gatgcttatg 660

cctttgcaca aatatcttga tgcgcctact gctcatgaca tcatccacaa tggagcgact 720

tttcagattg caggattgac aaataactcc catttatcag aagcacacga ggttcggcat 780

tgtgtgcaga aattcaaaag ccttggtgag tctgttctcc aagttgccaa gaggaggcta 840

gacagcatgt tgtatgttgg actgacagag gagcacaggg aatctgcatc actttttgcc 900

aatgtagtgg gttctcaagt gctgtctcaa gtggttccgt ccaatgcaac tgcgaaaatc 960

aaagctctta aatcagaagc aagtgtcaca atttcagaaa ccgggtcaga taagagtaat 1020

attcagaatg gtacatctga agttacattg aataaggcag aagctaagag tgggaatatg 1080

acggtaaaaa cccttatgga agtctatgaa ggctgcatca ctcatttacg aaagtcccaa 1140

ggaaccagac gggtcaactc tctgaagaga ataactccag caaattttac aagagggacg 1200

cgtacaagag ttcctaaaga ggtcattcag cagatcaaat cgcttaacaa cctcgatgtg 1260

gagctctaca aatatgcaaa agtaatcttt gccaaagaac atgaattagt gtcgaataag 1320

ttgatctcaa gttctaagag aagcattgtt gatctgccga gtgagttaaa gagcgtattg 1380

ggagaaatgg gtgaagagaa gctatggaag ttcgtaccag tggcattgat gcttttattg 1440

atcgtcctct tctttctatt tgtaaacgct aaaaggagaa gaacctccaa agttaagatt 1500

tga 1503

<210> 3

<211> 500

<212> PRT

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 3

Met Gln Met Asn Ser Val Trp Lys Leu Ser Leu Gly Leu Leu Leu Leu

1 5 10 15

Ser Ser Val Ile Gly Ser Phe Ala Glu Leu Asp Phe Gly His Cys Glu

20 25 30

Thr Leu Val Lys Lys Trp Ala Asp Ser Ser Ser Ser Arg Glu Glu His

35 40 45

Val Asn Lys Asp Lys Arg Ser Leu Lys Asp Leu Leu Phe Phe Leu His

50 55 60

Val Pro Arg Thr Gly Gly Arg Thr Tyr Phe His Cys Phe Leu Arg Lys

65 70 75 80

Leu Tyr Asp Ser Ser Glu Glu Cys Pro Arg Ser Tyr Asp Lys Leu His

85 90 95

Phe Asn Pro Arg Lys Glu Lys Cys Lys Leu Leu Ala Thr His Asp Asp

100 105 110

Tyr Ser Leu Met Ala Lys Leu Pro Arg Glu Arg Thr Ser Val Met Thr

115 120 125

Ile Val Arg Asp Pro Ile Ala Arg Val Leu Ser Thr Tyr Glu Phe Ser

130 135 140

Val Glu Val Ala Ala Arg Phe Leu Val His Pro Asn Leu Thr Ser Ala

145 150 155 160

Ser Arg Met Ser Ser Arg Ile Arg Lys Ser Asn Val Ile Ser Thr Leu

165 170 175

Asp Ile Trp Pro Trp Lys Tyr Leu Val Pro Trp Met Arg Glu Asp Leu

180 185 190

Phe Ala Arg Arg Asp Ala Arg Lys Leu Lys Glu Val Val Ile Ile Glu

195 200 205

Asp Asp Asn Pro Tyr Asp Met Glu Glu Met Leu Met Pro Leu His Lys

210 215 220

Tyr Leu Asp Ala Pro Thr Ala His Asp Ile Ile His Asn Gly Ala Thr

225 230 235 240

Phe Gln Ile Ala Gly Leu Thr Asn Asn Ser His Leu Ser Glu Ala His

245 250 255

Glu Val Arg His Cys Val Gln Lys Phe Lys Ser Leu Gly Glu Ser Val

260 265 270

Leu Gln Val Ala Lys Arg Arg Leu Asp Ser Met Leu Tyr Val Gly Leu

275 280 285

Thr Glu Glu His Arg Glu Ser Ala Ser Leu Phe Ala Asn Val Val Gly

290 295 300

Ser Gln Val Leu Ser Gln Val Val Pro Ser Asn Ala Thr Ala Lys Ile

305 310 315 320

Lys Ala Leu Lys Ser Glu Ala Ser Val Thr Ile Ser Glu Thr Gly Ser

325 330 335

Asp Lys Ser Asn Ile Gln Asn Gly Thr Ser Glu Val Thr Leu Asn Lys

340 345 350

Ala Glu Ala Lys Ser Gly Asn Met Thr Val Lys Thr Leu Met Glu Val

355 360 365

Tyr Glu Gly Cys Ile Thr His Leu Arg Lys Ser Gln Gly Thr Arg Arg

370 375 380

Val Asn Ser Leu Lys Arg Ile Thr Pro Ala Asn Phe Thr Arg Gly Thr

385 390 395 400

Arg Thr Arg Val Pro Lys Glu Val Ile Gln Gln Ile Lys Ser Leu Asn

405 410 415

Asn Leu Asp Val Glu Leu Tyr Lys Tyr Ala Lys Val Ile Phe Ala Lys

420 425 430

Glu His Glu Leu Val Ser Asn Lys Leu Ile Ser Ser Ser Lys Arg Ser

435 440 445

Ile Val Asp Leu Pro Ser Glu Leu Lys Ser Val Leu Gly Glu Met Gly

450 455 460

Glu Glu Lys Leu Trp Lys Phe Val Pro Val Ala Leu Met Leu Leu Leu

465 470 475 480

Ile Val Leu Phe Phe Leu Phe Val Asn Ala Lys Arg Arg Arg Thr Ser

485 490 495

Lys Val Lys Ile

500

<210> 4

<211> 1850

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 4

gtaagcttca tgggagctcc agggcaagct gcagagacag gtgtgtgaga accataacca 60

gattcctctg tttgaaggca gagaacaata ctaaagatgt tttgatacaa agactcaatg 120

atttcttcat cggaacaagt agtaagagaa tcaatcctca tgtgattatt gtagtggtca 180

cagagtggag aaattgcaat gattccactg tctcctttag agatcatagg agttatgggt 240

tccacataac ctgatgttcc ttcaatggag ttttcttcat agtccatggt gatggtgtca 300

caatatctgg aaaaagacag taaaaccata cattcagaca aagcccttgt aaacgaaacc 360

agaggaagca acgagtttaa aatccatgat tattgaatag tacccctaat aagctatttc 420

acaaattgcg ttaagttcga gaagaaacat ttagtcgcat atcgtgatgc cattaatgaa 480

agaaaaaaaa tctaatctaa aagacaaaaa gattgcacga caaattagat gatacgaaat 540

catcgaattt attagagtta tggcactttt tcagaaacga ttcaaaagag tgagaaaatc 600

tctatacctt tgactcatga ggtctgtaat tttttgttta tcttttcttt ttttctttga 660

cagcaatttt tttttttttt ttttttttgc gattttaata ttttttataa acttaagaaa 720

atgataagcg gagaaacaga agacactagg cccatttaat tatcaggccc aattgtatta 780

atatcttaaa ccttctttaa aaccataaga ttaacacaaa ggtttacgac tatccttcta 840

gattttattt tccaagcatt tttaatccta ctgtatttct caaatctaca acctttgatg 900

attttttgtc atcaccaact tttttaaaaa aataattcat tttaggacat ttcaatccca 960

atggcaataa ttacccattt atacgaattc tagcatacta gttaatgtat aattactttg 1020

ctatttattg gaaacctatg gaggtaatat ttatctctaa aggaatttat atatattttt 1080

agttaaatac atatttattg atattttagg attacaataa acatggcaac aaattatatt 1140

aaaaattaaa aaacagatat ttttattgta tagatgaaaa caaacaagtc attgcaaaac 1200

gaatggaacg atgacaagat tgaaaggaga cagcatccgc catcagcatg agacatttga 1260

acccacaaca tttttttgta gacaagtctg gtctttttac ttaaagcaaa taaactctag 1320

actttaggcc ttataacatt taagcataaa gtatggccac tgtcaggatt gaactctcaa 1380

atctcaacgg aaaactttaa tgctcataaa aatctgtgaa cgaatgattg aactgaagca 1440

atgactaaga acaaatgagt cataactcat aaccatgatc ctgtaactat aagtttcctc 1500

cttgaggtct ttcacacaca acgagggatg gatgtacatg tcaccagaag caacaagaag 1560

atcaagacgc aactaaaagg ccaaaagaag tgaagaacaa aatattacac aaagagggga 1620

tgtatagttg tatacccacg gtttaccgat ttcggttttc gttccgataa ccggttatgt 1680

atttcatttt gtattatata gaaggcattg gtcaaaccgc actcgaacca gaaaggaaag 1740

tgcattcata ctattactga ctagtggaaa aaaaaaaaaa aaaaaagcat tggtctctct 1800

caaaaaagat taattcgttt ggctaaatca aatttgacac tagtgtcttc 1850

<210> 5

<211> 3673

<212> DNA

<213> Arabidopsis thaliana (Arabidopsis thaliana)

<400> 5

ctcagtgcgt gtttataatt tttctgggtg gcgagaaacc aagagaaaat ctcgtgaccc 60

tgttctctcg ggagcgcaca caatctctct tcttcttcgt cttcctcctc caatcgatgt 120

aatcacacac acacacaaaa acacatcttt tccttgtttt cgtaggacct agtagatagc 180

gagttttgcc cccaaaacag cgatcgaggg aatttatgag cacgagatct cgattcccca 240

tacacgtagg cctctgcttc tctctcttgt tcctttgttc ctttctttat tcgattttct 300

gggtcccttt tgccctgttt ttcctctgtc tccttccccc aaaatctttc ggttttgttt 360

ttatacaact tgcaaccgtt aatgttcatc ctcaccgatt gatcacctac tcttttccct 420

tcctgggttt tgtttctttc gaataaagat tgatccttct ttcacttata atcgttttgg 480

taatcagtag ggtttggaat cgaggcacaa tgcaaatgaa ctctgtttgg aagctgtctc 540

ttgggttatt acttcttagc tcaggtatgt atgcagaatg gttttacaaa attgttcatt 600

tgataaaaaa gctggacttg tctctgatgt tcttggaata attggcaaat tatatctcag 660

ttattggctc ttttgcggaa cttgattttg gccattgcga aactcttgtg aaaaaatggg 720

ctgattcttc ttcatctcgt gaagaacatg ttaataaaga caaacgctcg cttaaggatt 780

tgctcttctt tctccacgtt ccgcgaactg gaggcagaac atattttcat tggtgatttg 840

atttccttta ccaaaaagtt tttgagagat tcttttatga ttgttgtgtg gttaaggctg 900

tgtttgtgct cttgtagttt tttgaggaag ttgtatgata gctctgagga atgtcctcga 960

tcttacgaca agctccactt caatccaagg tatcttaatt tcatcagtgc tctcgctaat 1020

tgtacgtctt tatttgatgc caaagactct ttcttgtgga aacaataaga tggcttacag 1080

aatgctgttt gtacattcta ttggttgtta agttgacttt agatagctta gctagacata 1140

tataaagtta aatattgttt catatgaaaa tcaattttcc ctagcctcct ttacctaaag 1200

aaaaacaatg tgaaaaaagt attttgcctg tggtgttact accttcggac agttaagatc 1260

gtgttgactc gtaaatttat aggaaggaaa agtgcaagtt gttagccaca catgatgatt 1320

atagtttgat ggcaaagctt ccgagggaga gaacttcggt gatgacaata gttcgggatc 1380

ctattgcgcg tgtgttaagc acttatgaat tttccgtaga ggtagcagct aggtttttgg 1440

tgcatcccaa tttaacttct gcgtcaagga tgtctagccg catacgcaag agtaatgtaa 1500

taagcacact agacatatgg ccatggaaat acctagttcc atggatgaga gaagacttgt 1560

ttgctcgggt atgtcgacct atcccattcg tcttttttgg cttttaagct agaacatgat 1620

aagaacacat aaaacttggg ctgaagcttt ttttactcat ccttggcttt tcttagcgag 1680

atgcacgaaa attgaaggag gtagtgatca ttgaggacga taacccgtat gacatggagg 1740

agatgcttat gcctttgcac aaatatcttg atgcgcctac tgctcatgac atcatccaca 1800

atggagcgac ttttcaggta ctttttcatg ctatttgttt aagttttcaa agttattgat 1860

tagagatctc cagagcattt tcatttcact tcacagattg caggattgac aaataactcc 1920

catttatcag aagcacacga ggttcggcat tgtgtgcaga aattcaaaag ccttggtgag 1980

tctgttctcc aagttgccaa ggtagtaaca cttcttcttc atcatagttc actgcgtctt 2040

ggtattgtgc ttttaaaagc agcagattct gtaagctttt ttaaattttg cagaggaggc 2100

tagacagcat gttgtatgtt ggactgacag aggagcacag ggaatctgca tcactttttg 2160

ccaatgtagt gggttctcaa gtgctgtctc aagtggttcc gtccaatgca actgcgaaaa 2220

tcaaagctct taaatcaggt tggtgtaagt ttcttaatac catcgctggg ctatctaagg 2280

agaatctagc aacttagttg aaggacatgg tgatcatttt tttagtcaca gtgtacagtt 2340

ttttcagagt accgctttgg agatggtatt tactttagtt tttggctttt gaaagtcaaa 2400

acccgtcata ttattcatta aaatgtttga ctgatatttt tcattcactt tttaggagtt 2460

tgatttttaa ttacctaggg aagctactta ttgttctctg ttatttgggg attatcgtat 2520

aaggtttgat tgtctttcat catgaagatt tttctgatct atgtttcttg ttgtcacatc 2580

atctttaaag gttctcttgc cctcttttgt tttagacttg tgtcttgtta ctctgggtcc 2640

ctgggtttat taaagtttct ttgttggtta atcatagtct cttagagtaa gtagaatgat 2700

gatatgacag ttcatgtgca tacagcctag gctttctatt gcttttgttg tatttaaagt 2760

caggataaca aatggttgta cttgcactca ccaaattgtc aactttattt ccttgatgct 2820

tcagaagcaa gtgtcacaat ttcagaaacc gggtcagata agagtaatat tcaggtaaag 2880

tcctgctgca gaaggtaata atttgtttgt tcaactgtca tttttgtaat tgtcttgctg 2940

aaaatggctg tgacattaca gaatggtaca tctgaagtta cattgaataa ggcagaagct 3000

aagagtggga atgtaagtag aatccctttt ccaatttatt atcaacgctt gagaccttgt 3060

gtgactttta tatatacact tcagatgacg gtaaaaaccc ttatggaagt ctatgaaggc 3120

tgcatcactc atttacgaaa gtcccaagga accagacggg tcaactctct gaagagaata 3180

actccagcaa attttacaag aggggtaaag tgttttcgta catgatctaa acttagtaaa 3240

gttaatgaga gaaggctgga ataatgaaat cttttgacaa tgcatctaac agacgcgtac 3300

aagagttcct aaagaggtca ttcagcagat caaatcgctt aacaacctcg atgtggagct 3360

ctacaaatat gcaaaagtaa tctttgccaa agaacatgaa ttagtgtcga ataagttgat 3420

ctcaagtgta agaaacttct tgtcttcaca tttcgccttt tagtttctgt ctgatataag 3480

actaaactcc atgattcgtg tgcagtctaa gagaagcatt gttgatctgc cgagtgagtt 3540

aaagagcgta ttgggagaaa tgggtgaaga gaagctatgg aagttcgtac cagtggcatt 3600

gatgctttta ttgatcgtcc tcttctttct atttgtaaac gctaaaagga gaagaacctc 3660

caaagttaag att 3673

<210> 6

<211> 21

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 6

gtaagcttca tgggagctcc a 21

<210> 7

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 7

aatcttaact ttggaggttc ttct 24

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 8

atgcaaatga actctgtttg ga 22

<210> 9

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 9

aatcttaact ttggaggttc ttct 24

<210> 10

<211> 9

<212> PRT

<213> Artificial sequence (artificial sequence)

<400> 10

Tyr Pro Tyr Asp Val Pro Asp Tyr Ala

1 5

<210> 11

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 11

ttacttctta gctcagttat tggc 24

<210> 12

<211> 24

<212> DNA

<213> Artificial sequence (artificial sequence)

<400> 12

caatgaaaat atgttctgcc tcca 24

Claims

1. Use of a substance which is a TPST gene or a protein encoding the same, or an enhancer thereof, for modulating a trait in a plant or for preparing a formulation or composition for modulating a trait in a plant, wherein the trait in the plant comprises one or more traits selected from the group consisting of:

(i) stress resistance;

(ii) thousand seed weight;

(iii) yield and/or biomass;

(iv) size, weight and/or number of fruits and/or seeds.

2. The use according to claim 1, wherein the stress resistance is selected from the group consisting of: salt resistance, drought resistance, disease and pest resistance, or a combination thereof.

3. The use of claim 1, wherein the trait further comprises one or more selected from the group consisting of:

(v) root length;

(vi) root weight.

4. The use according to claim 1, wherein said modulating a trait in a plant comprises:

(i) enhancing the stress resistance of the plants; and/or

(ii) Increasing the thousand seed weight; and/or

(iii) Increasing yield and/or biomass; and/or

(iv) Increase the size, weight and/or number of fruits and/or seeds.

5. A composition, comprising:

(a) an enhancer of the TPST gene or a protein encoded thereby; and

(b) an agronomically acceptable carrier.

6. The composition of claim 5, wherein the composition further comprises other substances that modulate the traits of a plant.

7. Use of a composition according to claim 5 for improving plant traits.

8. A method of improving a trait in a plant comprising the steps of:

9. A method of producing genetically engineered plant tissue or plant cells comprising the steps of:

10. A method of making a plant with improved traits comprising the steps of:

regenerating the genetically engineered plant tissue or plant cell prepared by the method of claim 9 into a plant body, thereby obtaining a plant with improved traits.