CN112430619A

CN112430619A - FoMV virus-mediated GFP-ATG8 expression vector and application thereof

Info

Publication number: CN112430619A
Application number: CN202011220249.5A
Authority: CN
Inventors: 王华忠; 岳洁瑜; 胡蕊洁
Original assignee: Tianjin Normal University
Current assignee: Tianjin University; Tianjin Normal University
Priority date: 2020-11-05
Filing date: 2020-11-05
Publication date: 2021-03-02

Abstract

The invention constructs a GFP-ATG8 expression vector mediated by a FoMV virus and application thereof. According to the method, TaATG8a is used as a target for monitoring autophagy, a FoMV-based VOX technology is adopted to express GFP-TaATG8a fusion protein on a wheat plant, the expression condition and the subcellular localization condition of the fusion protein in leaf and root tissues are observed through fluorescence, a technical platform for monitoring autophagy level on a wheat living plant by taking over-expressed GFP-TaATG8 as a target is established, and the carrier is successfully applied to the observation of autophagy corpuscles and autophagy vesicles in starvation and drug treatment of leaf epidermis, mesophyll cells and root cells, and the carrier can be applied to the autophagy level monitoring and autophagy function research in the growth and development process of wheat or the environment factor response process. The research result provides technical support for deeply exploring the autophagy regulation mechanism and physiological function of wheat of important crops.

Description

FoMV virus-mediated GFP-ATG8 expression vector and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a FoMV virus-mediated GFP-TaATG8a expression vector and application thereof in monitoring the autophagy level of wheat.

Background

Autophagy (autophagy for short) is closely related to the processes of plant growth, development, aging, cell death, stress response and the like. The monitoring of the level of autophagy in cells is an essential means for developing the study of the autophagy regulation mechanism and physiological function. During autophagy, the substrate to be degraded in the cytoplasm is wrapped in autophagosome with a double-layer membrane structure, and the inner membrane and the wrapped substrate (called autophagy vesicle in the moment) enter the vacuole cavity and are decomposed along with the fusion of the outer membrane of the autophagosome and the vacuole (animal is lysosome) membrane. Various autophagy-related (ATG) factors are involved in the processes of autophagosome assembly, substrate selection, fusion of autophagosomes and vacuoles, and signal regulation thereof. The autophagy process and ATG factors are well conserved in eukaryotes including yeast, animals and plants.

ATG8 is the most clearly studied ATG factor in the autophagy core mechanism, which is linked with lipid molecule Phosphatidylethanolamine (PE) through a ubiquitination process after being processed by protease ATG4 and positioned on the surfaces of the inner and outer membranes of autophagy corpuscles, then other ATG factors are recruited in an interaction mode to jointly act on the processes of assembly of autophagy corpuscles and fusion with vacuoles, and the ATG8 on the inner membrane enters the vacuole cavity along with the autophagy vacuoles. In view of the symbolic decoration effect of ATG8 on autophagy membranes, the dot fluorescence exhibited by fusion proteins with GFP or RFP after localization to autophagy membranes can be used as evidence of the presence of intracellular autophagy bodies and autophagy vesicles, and the identification of the amount of dot fluorescence can be used to monitor the level of autophagy in cells. The monitoring of the level of autophagy in cells is an essential means for developing the study of the autophagy regulation mechanism and physiological function. ATG8 localized on the autophagy membrane is an important target for detecting the level of autophagy in cells.

Due to the maturity of genetic transformation methods, transgenic materials stably overexpressing GFP/RFP-ATG8 are easily obtained from Arabidopsis, tobacco and important crop rice for the in vivo monitoring of autophagy level. Wheat, an important crop, belongs to the most difficult crop for genetic transformation, and reports of the material are not obtained so far, so that the autophagy regulation mechanism and physiological function research on wheat are greatly limited. In recent years, gene transient expression technology mediated by gene gun, agrobacterium, PEG or virus has been widely used in the research of plant gene function. The virus is a foreign geneThe natural vector can introduce the target gene carried on the genome into the infected cells for expression through a high-efficiency infection process, and can also introduce the target gene into other positions of a host individual through the propagation and moving processes of virus particles. Viruses developed as vectors on plants are mainly RNA viruses, and specific techniques using such vectors include two types of Virus-mediated overexpression (VOX) and Virus-induced gene silencing (VIGS-induced gene silencing, VIGS), which uses RNAi effects induced by dsRNA, an intermediate of RNA Virus replication. The host species specificity of the virus dictates that VIGS/VOX technology developed with a particular virus can only be applied to a particular range of host plants. On wheat, the only virus widely used in VIGS is the barley streak mosaic virus bsmv (barley stripe mosaic virus). BSMV can also be applied to VOX, but the vector can stably carry a small gene fragment (less than 450-500 bp), and the target gene can only be matched with the virusγb expression in the form of gene fusion. Recently, potexvirus single-molecule positive-sense RNA virus, i.e., Setaria viridis mosaic virus FoMV (Foxtail mosaic virus), has also been developed as a VIGS/VOX vector that can be used on wheat, which expresses viral genomic RNA and assembles virus particles in tobacco leaves using Agrobacterium-mediated transformation, followed by frictionally inoculating wheat leaves with tobacco sap containing virus particles, and can mediate expression of 1800 bp long genes in unfused form on wheat using the FoMV-VOX technique. The success of the FoMV-VOX technology provides the possibility of expressing GFP/RFP-ATG8 on wheat plants for monitoring the level of autophagy.

The higher organism ATG8 is a gene family consisting of multiple members. The laboratory has identified 9 ATG8 genes (TaATG 8a-8 i) in wheat, confirming that they are involved in the process of wheat autophagy. According to the method, TaATG8a is selected as a target for monitoring autophagy, a FoMV-based VOX technology is adopted to express GFP-TaATG8a fusion protein on wheat plants, the expression condition of the fusion protein in leaf and root tissues is identified through fluorescence observation, a technical platform for monitoring autophagy level on wheat living plants by taking over-expressed GFP-ATG8 as a target is established, and the method can be applied to deep exploration of an autophagy regulation mechanism and physiological functions of important crop wheat.

Disclosure of Invention

Aiming at the technical problems in the prior art, the invention provides a GFP-TaATG8a expression vector mediated by a FoMV virus, and the FoMV virus-mediated GFP-TaATG8a expression vector is applied to monitoring the wheat autophagy level, so that technical support is provided for deeply exploring the autophagy regulation mechanism and physiological functions of important crop wheat.

In order to achieve the purpose, the invention discloses the following technical scheme:

the invention discloses a FoMV virus-mediated GFP-TaATG8a expression vector, which is GFP-TaATG8a expressed by a VOX method based on FoMV, can be positioned in an autophagy membrane in cells activating autophagy, and can be used for monitoring autophagy activity in root and leaf cells.

The invention further discloses a VOX vector construction method of GFP-TaATG8a fusion gene, which is characterized in that a VOX vector of GFP-TaATG8a fusion gene is constructed by using a VOX vector based on FoMV, primers Fo-G8a-F and Fo-G8a-R are designed and synthesized, the primer pair is used, a GFP-TaATG8a fusion gene expression vector pGFP-G8a is used as a template to amplify a GFP-TaATG8a fragment, the amplified fragment is replaced by a GFP fragment between ClaI and XbaI on the VOX vector based on FoMV, so that a VOX vector pFo-GFP-TaATG8a of the GFP-TaATG8a fusion gene is constructed, and the correctness of the constructed vector is confirmed by PCR amplification and DNA sequencing of an inserted fragment; the primer sequence is as follows:

Fo-G8a-F ACAGTCGACAGCTATATGGTGAGCAAGGGCGAG and

Fo-G8a-R GCGGTCGTTGAGTG TCTAGAGCAATCCGAAGGTGT，

the underlined sequences are the homology arms flanking the insertion site of the target vector added at the 5' end of the primer.

The invention further discloses an application of the FoMV virus-mediated GFP-TaATG8a expression vector in monitoring the level of wheat autophagy. The experimental results show that: GFP-TaATG8a overexpression plants obtained by the FoMV-VOX method can be applied to autophagy level monitoring and autophagy function research in the growth and development process of wheat or in the response process of environmental factors. In order to amplify the information of the autophagy level, a vacuolar protease inhibitor E-64D or a vacuolar acidification inhibitor ConA can be used for inhibiting the terminal link of degradation of autophagy vesicles, so that the aim of accumulating autophagy structures to conveniently monitor the autophagy level is fulfilled. In the research, the use of E-64D can effectively accumulate structural autophagy in starvation-treated wheat leaf tissue cells, thereby facilitating the monitoring of autophagy level; while ConA was not necessarily used for starvation treated wheat root tissue, a large accumulation of starvation-induced autophagy structures was observed in root cells not treated with ConA.

The invention discloses a method for monitoring the autophagy level of wheat, which comprises the following steps:

(1) VOX vector construction of GFP-TaATG8a fusion gene: constructing a VOX vector of a GFP-TaATG8a fusion gene by using a FoMV-based VOX vector, designing and synthesizing primers Fo-G8a-F and Fo-G8a-R, using the primer pair, using a GFP-TaATG8a fusion gene expression vector pGFP-G8a as a template, amplifying a GFP-TaATG8a fragment, replacing the amplified fragment with a GFP fragment between ClaI and XbaI on the FoMV-based VOX vector, and after verifying the correctness of the inserted fragment, transforming the constructed vector into chemically competent cells of agrobacterium GV3101 (pSoup-p 19);

(2) tobacco lamina agroinfiltration: inoculating single colony of Agrobacterium grown on solid culture medium into 3 ml LB liquid culture medium containing 50 ug/ml kanamycin and 25 ug/ml rifampicin, shake culturing at 29 deg.C overnight, inoculating 1% of the strain into enlarged culture solution, shake culturing for 12 hr, centrifuging to collect thallus, suspending the thallus in MMA solution, adjusting thallus concentration to OD₆₀₀Standing at 29 deg.C for 3 h to obtain a value of about 0.5, injecting Agrobacterium suspension from the back into tobacco leaf with 1 ml sterile syringe with needle removed, storing the injected tobacco in dark for 24 h, transferring to normal condition for growth, injecting Agrobacterium 7 d, grinding the tobacco leaf in mortar with liquid nitrogen into powder, adding pre-cooled 20 mM PBS buffer (pH = 7.2) at a ratio of 1:2 (W/V) to obtain tobacco juice containing virus, and directly inoculating semen Tritici Aestivi or storing in refrigerator at-80 deg.C;

(3) virus friction inoculation of wheat plants: adding sterilized diatomite into tobacco juice according to the proportion of 1% (W/V) to prepare virus inoculation liquid, performing friction inoculation on the second leaf of the wheat seedling in the two-leaf stage, performing ultrapure water spray treatment and bagging moisture preservation on the seedling for 24 hours after inoculation, and then culturing under normal conditions;

(4) starvation and drug treatment: injecting 100 μ M E-64D or 1% DMSO (solvent control) directly into the tissue from the back of tobacco leaf or from the main pulse incision of the back of wheat leaf by using a 1 ml syringe without a needle, cutting off the leaf, placing in distilled water, keeping in dark for in vitro starvation, cutting off the root of wheat, placing in distilled water, keeping in dark for in vitro starvation, and adding 1 μ M concanavalin A (concanavalin A) or 1% DMSO (solvent control) to the distilled water;

(5) autophagosome observation: GFP fluorescence in leaf and root tissues was observed using a bulk fluorescence microscope, a common fluorescence microscope or a laser confocal fluorescence microscope.

The VOX vector in the step (1) contains cDNA corresponding to FoMV genomic RNA driven by a 35S promoter, two repeated subgenomic promoters are designed on the viral genome, and a reporter gene GFP is cloned between the two subgenomic promoters. The primer sequence is as follows: Fo-G8a-FACAGTCGACAGCTATATGGTGAGCAAGGGCGAG and

Fo-G8a-RGCGGTCGTTGAGTG TCTAGAGCAATCCGAAGGTGT，

the underlined sequences are the homology arms flanking the insertion site of the target vector added at the 5' end of the primer. The GFP-TaATG8a fragment was amplified using high fidelity polymerase. The correctness of the insert is verified by confirming the correctness of the constructed vector through PCR amplification and DNA sequencing of the insert.

The volume of the expanded culture medium in step (2) was 10 ml, and it was LB liquid medium containing 50. mu.g/ml kanamycin, 25. mu.g/ml rifampicin, 20 mM MES, and 20. mu.M acetosyringone. MMA solution containing 10mM MES, 100. mu.M acetosyringone, 10mM MgCl₂pH = 5.7. In the step (4), the back main vein incision of the wheat leaf bladePrepared by cutting into blade in advance

The invention is described in more detail below:

1. nicotiana benthamiana (B)Nicotiana benthamiana) And conventional culture of wheat seedlings. Wherein 4-5 weeks old lamina of Nicotiana benthamiana is used for Agrobacterium agroinfiltratin, and two-leaf stage wheat seedlings are used for virus inoculation.

2. VOX vector construction of GFP-TaATG8a fusion gene. VOX vectors of GFP-TaATG8a fusion genes were constructed using FoMV-based VOX vectors. Primers were designed with homology arms added to the 5' end on both sides of the insertion site of the target vector. The primer pair is used for amplifying a GFP-TaATG8a fragment by taking a GFP-TaATG8a fusion gene expression vector pGFP-G8a as a template. The amplified fragment was substituted for the GFP fragment between ClaI and XbaI on the FoMV-based VOX vector by seamless cloning to construct VOX vector pFo-GFP-TaATG8a of the GFP-TaATG8a fusion gene. And (3) constructing agrobacterium tumefaciens chemically competent cells transformed by the vector.

3. Tobacco lamina agroinfiltraton. A single colony of Agrobacterium grown on the solid medium was inoculated to LB liquid medium containing kanamycin and rifampicin, and shake-cultured overnight at 29 ℃. Inoculating to an amplification culture medium 10 ml LB liquid medium containing the same antibiotic, 20 mM MES and 20. mu.M acetosyringone at a ratio of 1%, and continuing shaking culture for 12 h. The thalli are collected by centrifugation, suspended in an appropriate amount of MMA solution and kept stand for 3 hours at 29 ℃. The agrobacterium suspension is injected into the tobacco lamina from the back using a sterile syringe. The tobacco after injection is stored for 24 h in the dark and then transferred to normal conditions for growth. After injection of agrobacterium 7 d, the injected tobacco leaves were pulverized in a mortar with liquid nitrogen, and a pre-cooled 20 mM PBS buffer (pH = 7.2) was added to prepare a tobacco juice containing virus. The tobacco juice can be directly used for wheat inoculation or stored in a refrigerator at-80 deg.C.

4. Virus rub inoculation of wheat plants. Adding sterilized diatomite (Celite 545) into tobacco juice to prepare virus inoculation liquid, performing friction inoculation on the second leaf of the wheat seedling in the two-leaf stage, performing ultrapure water spray treatment and bagging moisture preservation on the seedling for 24 hours after inoculation, and then culturing under normal conditions.

5. Starvation and drug treatment. The starvation treatment is to cut off the leaves of the wheat, place the leaves in distilled water, and store the leaves in dark conditions for in vitro starvation treatment. The drug treatment is carried out by using vacuolar protease inhibitor E-64D or vacuolar membrane proton pump inhibitor concanavalin A (concanamycin A) for inhibiting acidification of vacuolar cavity to block degradation of autophagic vesicles.

6. And (4) observing fluorescence. GFP fluorescence in leaf and root tissues was observed using a bulk fluorescence microscope, a common fluorescence microscope or a laser confocal fluorescence microscope. In cells undergoing autophagy, localization of the autophagy membrane of the fluorescent protein-labeled ATG8 exhibited a punctate fluorescence pattern that could be used to characterize the presence and number of autophagic bodies and vesicles (fig. 1 and 2). However, GFP-TaATG8a fluorescence in normal epidermal and mesophyll cells showed a diffuse distribution similar to GFP, and punctate fluorescence was rare, indicating that leaf tissue from normally growing plants had a lower level of autophagy activity. Wheat leaves were subjected to ex vivo dark-induced starvation treatment to activate autophagy, while vacuolar protease inhibitor E64-D was used to block degradation of autophagic vesicles to accumulate autophagosomes and autophagic vesicles. A large amount of punctate fluorescence is observed in epidermal cells of wheat and mesophyll cells of wheat after 24 h of treatment, and the GFP-TaATG8a expressed by the FoMV-based VOX method can be shown to be capable of

Being able to localize to autophagy membranes in leaf epidermal cells and mesophyll cells where autophagy occurs, can be used for monitoring autophagy activity in these two types of cells (fig. 3 and 4).

The vacuolar membrane proton pump inhibitor concanamycin a (concanamycin a) can inhibit acidification of the vacuolar cavity to block degradation of autophagic vesicles, accumulation of autophagic corpuscles and autophagic vesicles. Starvation treatment induced by ex vivo darkness for 24 h observation, a large amount of punctate fluorescence was present in both starved and concanavalin a treatments as well as in the starved root cells alone. This result indicates that GFP-TaATG8a expressed using the FoMV-based VOX method was able to localize to the autophagy membrane in root cells that activated autophagy, and was useful for monitoring autophagy activity in root cells (fig. 5).

Compared with the prior art, the FoMV virus-mediated GFP-ATG8 expression vector and the application thereof disclosed by the invention have the positive effects that:

(1) the method is simple to operate, is rapid, simple, convenient and feasible, and can replace the conventional stable transformation technology.

(2) The established FoMV-VOX technology can mediate the expression of the gene with the length of 1800 bp on wheat in a non-fusion form.

(3) The FoMV-VOX technology is suitable for the gene function research of wheat leaf and root tissues.

(4) The invention uses vacuolar protease inhibitor E-64D or vacuolar acidification inhibitor ConA to inhibit autophagy vesicle degradation, and can achieve the purpose of accumulating autophagy structures to facilitate monitoring autophagy level.

Drawings

FIG. 1 shows the spread of GFP or GFP-TaATG8a in wheat leaves. The juice of the tobacco leaves is used for rubbing the wheat leaves, and the expression of the target gene carried by the virus in the wheat leaves is observed. At 7 d after rubbing, a green fluorescence of GFP or GFP-TaATG8a was observed as a fragment on the second leaf; the same green fluorescence was observed on the newly grown third leaf that was not rubbed 20 d after rubbing. The result shows that tobacco juice contains active FoMV virus particles which can proliferate and expand in wheat leaves and can mediate the expression of target genes carried by the virus particles in the wheat leaves;

FIG. 2 shows the spread of GFP or GFP-TaATG8a in wheat roots. At 20 d after leaf rubbing, large pieces of GFP or GFP-TaATG8a green fluorescence were also observed in tissues above the root tip of wheat plants, indicating that FoMV virions were able to migrate into non-root-tip tissues of wheat roots and mediate the expression of the genes of interest they carry in these tissues. Unlike tissues above the root tip, no expression of GFP or GFP-TaATG8a was observed in the vigorously dividing root tip cells;

FIGS. 3 and 4 show that GFP-TaATG8a fluorescence in wheat epidermal and mesophyll cells, respectively, exhibits a diffuse distribution similar to GFP, with very little punctate fluorescence, indicating that leaf tissue from normally growing plants has a lower level of autophagy activity. Hunger treated wheat leaves with ex vivo dark-induced starvation to activate autophagy, while vacuolar protease inhibitor E64-D was used to block degradation of autophagic vesicles to accumulate autophagic bodies and autophagic vesicles. After 24 h of treatment, a large amount of punctate fluorescence exists in wheat epidermal cells and wheat mesophyll cells, which indicates that GFP-TaATG8a expressed by adopting a FoMV-based VOX method can be positioned in autophagy membranes in the autophagy-occurring mesophyll cells and the epidermal cells, and can be used for monitoring autophagy activity in the two types of cells;

figure 5 is a graph showing inhibition of vacuolar acidification by the vacuolar membrane proton pump inhibitor concanamycin a (concanamycin a) to block degradation of autophagic vesicles, accumulation of autophagosomes and autophagic vesicles. In vitro dark-induced starvation treatment for 24 h, it was observed that a large amount of punctate fluorescence was present in both the starvation and concanavalin a treatments and in the starvation-treated root cells alone, whereas the punctate fluorescence was very low in the cells that were not starved. This result indicates that GFP-TaATG8a expressed by the FoMV-based VOX method can be localized to the autophagy membrane in the root cells activating autophagy, and can be used for monitoring autophagy activity in the root cells.

Detailed Description

The invention is described below by means of specific embodiments. Unless otherwise specified, the technical means used in the present invention are well known to those skilled in the art. In addition, the embodiments should be considered illustrative, and not restrictive, of the scope of the invention, which is defined solely by the claims. It will be apparent to those skilled in the art that various changes or modifications in the components and amounts of the materials used in these embodiments can be made without departing from the spirit and scope of the invention. The methods used in the following examples are conventional methods unless otherwise specified, and the percentages are by volume as used in the following examples, and Agrobacterium GV3101, tobacco, E-64D, DMSO, concanavalin A, kanamycin, rifampicin, MES, acetosyringone, MgCl, are used₂Diatomaceous earth, PBS buffer, wheat variety Yangmai 158 seed, etc. are commercially available.

Example 1

FoMV virus-mediated GFP-ATG8 expression vector for monitoring wheat autophagy level after starvation and drug treatment

Firstly, the method of the invention is used for constructing a GFP-TaATG8a expression vector mediated by the FoMV virus, which is used for monitoring the level of wheat autophagy after starvation and drug treatment, and comprises the following steps:

1. nicotiana benthamiana (B)Nicotiana benthamiana) And conventional culture of wheat seedlings. Nicotiana benthamiana (B)Nicotiana benthamiana) And seeds of Yangmai 158 of the wheat variety are sown in pots filled with nutrient soil and vermiculite and are placed in a light incubator with the conditions of 23 ℃ and 16 h light/8 h dark for growth. 4-5 week old leaf of Nicotiana benthamiana for use in crop stalks

The bacterium agroinfiltration, wheat seedlings in the two-leaf stage, was used for virus inoculation.

2. VOX vector construction of GFP-TaATG8a fusion gene. VOX vectors of GFP-TaATG8a fusion gene were constructed using FoMV-based VOX vectors containing cDNA corresponding to 35S promoter-driven FoMV genomic RNA, two duplicated subgenomic promoters were designed on the viral genome, and reporter GFP was cloned between them. Design of synthetic primer Fo-G8a-F (ACAGTCGACAGCTATATGGTGAGCAAGGGCGAG) and Fo-G8a-R (GCGGTCGTTGAGTG TCTAGAGCAATCCGAAGGTGT), homology arms (underlined sequences) are added to the 5' end of the primers flanking the insertion site of the target vector. Using this primer set, the GFP-TaATG8a fragment was amplified using high Fidelity Polymerase Phanta Max Super-Fidelity DNA Polymerase (Novozam) with the GFP-TaATG8a fusion gene expression vector pGFP-G8a as template. VOX vector pFo-GFP-TaATG8a of the GFP-TaATG8a fusion gene was constructed by replacing the amplified fragment with the GFP fragment between ClaI and XbaI on the FoMV-based VOX vector using the Seamless Cloning Kit pEASY-Basic Seamless Cloning and Assembly Kit (all-purpose gold), and the correctness of the constructed vector was confirmed by PCR amplification and DNA sequencing (production) of the inserted fragment.

In chemically competent cells (Shanghai uniqueness) of Agrobacterium GV3101 (pSoup-p 19) transformed with the construction vector, the transformation was carried out with reference to the manual of competent cells.

3. Tobacco lamina agroinfiltraton. Agricultural crops grown on solid culture mediumA single colony of Bacillus was inoculated in 3 ml of LB liquid medium containing 50. mu.g/ml kanamycin and 25. mu.g/ml rifampicin, and shake-cultured overnight at 29 ℃. Culturing to 10 ml LB liquid culture medium containing the same antibiotic, 20 mM MES and 20. mu.M acetosyringone at 1% amplification, and culturing for 12 h with shaking. The cells were collected by centrifugation and suspended in an appropriate amount of MMA solution (10 mM MES, 100. mu.M acetosyringone, 10mM MgCl)₂pH = 5.7) and the cell concentration was adjusted to OD₆₀₀The value was about 0.5 and left to stand at 29 ℃ for 3 h. The Agrobacterium suspension was injected into the tobacco lamina from the back using a 1 ml sterile syringe with the needle removed. The tobacco after injection is stored for 24 h in the dark and then transferred to normal conditions for growth. After injection of agrobacterium 7 d, the injected tobacco leaves were pulverized in a mortar with liquid nitrogen, and a pre-cooled 20 mM PBS buffer (pH = 7.2) was added at a ratio of 1:2 (W/V) to prepare a virus-containing tobacco juice. The tobacco juice can be directly used for wheat inoculation or preservation

And (5) a refrigerator at 80 ℃.

4. Virus rub inoculation of wheat plants. Adding sterilized diatomite (commercially available) (Celite 545, Sigma) into tobacco juice according to the proportion of 1% (W/V) to prepare virus inoculation liquid, performing friction inoculation on the second leaf of wheat seedlings in the two-leaf stage, performing ultrapure water spray treatment and bagging moisture preservation on the seedlings for 24 h after inoculation, and then culturing under normal conditions.

5. Starvation and drug treatment

100 μ M E-64D or 1% DMSO (solvent control) was injected directly into the tissue from the back of tobacco lamina or from the back of wheat lamina at the main vein incision (prepared with a razor blade in advance) using a 1 ml syringe without a needle, and the lamina was then cut out and placed in distilled water and kept in dark conditions for ex vivo starvation. Wheat roots were cut and placed in distilled water and stored in the dark for ex vivo starvation treatment, and 1 μ M concanamycin a (concanamycin a) or 1% DMSO (solvent control) was added to the distilled water at the final concentration.

6. Fluorescence observation

GFP fluorescence in leaf and root tissues was observed using a bulk fluorescence microscope, a common fluorescence microscope or a laser confocal fluorescence microscope. In cells undergoing autophagy, the localization of the autophagy membrane of the fluorescent protein-labeled ATG8 exhibits a punctate fluorescence pattern that can be used to characterize the presence and quantity of autophagic bodies and vesicles. As shown in FIGS. 3 and 4, GFP-TaATG8a fluorescence in epidermal and mesophyll cells showed a diffuse distribution similar to that of GFP, with little punctate fluorescence, indicating that leaf tissue from normally grown plants had a lower level of autophagy activity. Wheat leaves were subjected to ex vivo dark-induced starvation treatment to activate autophagy, while vacuolar protease inhibitor E64-D was used to block degradation of autophagic vesicles to accumulate autophagosomes and autophagic vesicles. Observation at 24 h after treatment revealed that there was a large amount of punctate fluorescence in both wheat epidermal cells and wheat mesophyll cells, indicating that GFP-TaATG8a expressed by the FoMV-based VOX method could localize to autophagy membrane in both the autophagy-occurring mesophyll and epidermal cells, and could be used for monitoring autophagy activity in both types of cells.

As shown in fig. 5, the vacuolar lumen acidification was inhibited using the vacuolar membrane proton pump inhibitor concanamycin a (concanamycin a) to block degradation of autophagic vesicles, accumulation of autophagosomes and autophagic vesicles. In vitro dark-induced starvation treatment for 24 h, it was observed that a large amount of punctate fluorescence was present in both the starvation and concanavalin a treatments and in the starvation-treated root cells alone, whereas the punctate fluorescence was very low in the cells that were not starved. This result indicates that GFP-TaATG8a expressed by the FoMV-based VOX method can be localized to the autophagy membrane in the root cells activating autophagy, and can be used for monitoring autophagy activity in the root cells.

SEQUENCE LISTING

<110> university of Tianjin

<120> FoMV virus-mediated GFP-ATG8 expression vector and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 33

<212> DNA

<213> Artificial sequence

<400> 1

acagtcgaca gctatatggt gagcaagggc gag 33

<210> 2

<211> 35

<212> DNA

<213> Artificial sequence

<400> 2

gcggtcgttg agtgtctaga gcaatccgaa ggtgt 35

Claims

1. A FoMV virus-mediated GFP-ATG8 expression vector is GFP-TaATG8a expressed by a FoMV-based VOX method, can be positioned on an autophagy membrane in cells activating autophagy, and can be used for monitoring autophagy activity in root and leaf cells.

2. The method for constructing the FoMV virus-mediated GFP-ATG8 expression vector as claimed in claim 1, wherein a FoMV-based VOX vector is used to construct a VOX vector of a GFP-TaATG8a fusion gene, primers Fo-G8a-F and Fo-G8a-R are designed, the GFP-TaATG8a fragment is amplified using the primer pair using a GFP-TaATG8a fusion gene expression vector pGFP-G8a as a template, the amplified fragment is substituted for a GFP fragment between ClaI and XbaI on the FoMV-based VOX vector to construct a GFP-TaATG8a fusion gene VOX vector pFo-GFP-TaATG8a, and the correctness of the constructed vector is confirmed by PCR amplification and DNA sequencing of the inserted fragment; the primer sequence is as follows:

Fo-G8a-F ACAGTCGACAGCTATATGGTGAGCAAGGGCGAG and

Fo-G8a-R GCGGTCGTTGAGTGTCTAGAGCAATCCGAAGGTGT，

3. Use of the FoMV virus-mediated GFP-ATG8 expression vector of claim 1 for monitoring the level of wheat autophagy.

4. The use of claim 3, wherein the method comprises the steps of:

5. The method of claim 3, wherein the VOX vector of step (1) comprises cDNA corresponding to 35S promoter-driven FoMV genomic RNA, two duplicated subgenomic promoters are designed on the viral genome, and the reporter gene GFP is cloned between them.

6. The method of claim 3, wherein the amplification of the GFP-TaATG8a fragment in step (1) is performed using a high fidelity polymerase.

7. The method of claim 3, wherein the verifying the correctness of the insert in step (1) is confirming the correctness of the constructed vector by PCR amplification and DNA sequencing of the insert.

8. The method of claim 3, wherein the expanding medium in step (2) is 10 ml, and is LB liquid medium containing 50. mu.g/ml kanamycin, 25. mu.g/ml rifampicin, and 20 mM MES, 20. mu.M acetosyringone.

9. The method according to claim 3, wherein in the step (2), the MMA solution contains 10mM MES, 100. mu.M acetosyringone, and 10mM MgCl₂，pH=5.7。

10. The method according to claim 3, wherein in the step (4), the blade is prepared in advance at the main vein incision on the back of the wheat leaf.