CN112415204B - Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody - Google Patents
Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody Download PDFInfo
- Publication number
- CN112415204B CN112415204B CN202011146123.8A CN202011146123A CN112415204B CN 112415204 B CN112415204 B CN 112415204B CN 202011146123 A CN202011146123 A CN 202011146123A CN 112415204 B CN112415204 B CN 112415204B
- Authority
- CN
- China
- Prior art keywords
- bispecific antibody
- colloidal gold
- bacteria
- test strip
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/585—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with a particulate label, e.g. coloured latex
- G01N33/587—Nanoparticles
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/12—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria
- C07K16/1203—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria
- C07K16/1228—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- C07K16/1232—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from bacteria from Gram-negative bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia from Escherichia (G)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/44—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material not provided for elsewhere, e.g. haptens, metals, DNA, RNA, amino acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/558—Immunoassay; Biospecific binding assay; Materials therefor using diffusion or migration of antigen or antibody
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56916—Enterobacteria, e.g. shigella, salmonella, klebsiella, serratia
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/52—Constant or Fc region; Isotype
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/245—Escherichia (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2469/00—Immunoassays for the detection of microorganisms
- G01N2469/10—Detection of antigens from microorganism in sample from host
Abstract
The invention discloses a method for detecting bacteria by using a colloidal gold test strip containing bispecific antibodies. The method comprises the following steps: (1) The bacteria to be detected and the colloidal gold marked by the bispecific antibody react to obtain a bacteria-bispecific antibody colloidal gold compound; (2) Purifying the bacterial-bispecific antibody colloidal gold complex and dissolving the bacterial-bispecific antibody colloidal gold complex in a colloidal gold solution marked by a small molecule hapten-carrier conjugate to obtain a sample loading solution; (3) And (3) dripping the sample liquid onto the colloidal gold test strip to react. The method for detecting bacteria can improve the detection sensitivity while avoiding bacterial aggregation, and can optimally reach 2.5x10 4 CFU/mL, and the stability of the bispecific antibody is high.
Description
Technical Field
The invention belongs to the field of microorganism detection, and particularly relates to a method for detecting bacteria by using a colloidal gold test strip containing bispecific antibodies.
Background
In recent years, food poisoning events caused by food-borne pathogenic bacteria have been of great concern, and bacteria causing these poisoning mainly include: coli O157, H7, salmonella, listeria monocytogenes, etc. These bacteria cause outbreaks and epidemics of diseases, bringing huge losses to society, such as enterohemorrhagic escherichia coli O157: h7 can produce shiga toxin, and can cause hemorrhagic enteritis, thrombocytopenic purpura, hemolytic uremia and other diseases. The bacteria are mainly transmitted through the feces mouth by polluting food and water source, and have the characteristics of strong gastric acid resistance and low infection dosage, and tens of living bacteria are reported to cause human and animal infection. The detection of the "gold standard" of bacteria requires separation by plate counting and physiological and biochemical identification, and is complex in operation and long in time consumption. The colloidal gold immunochromatography test strip method utilizes the antigen-antibody specific binding reaction, has the characteristics of simple operation, short time consumption and the like, and is widely applied to a plurality of detection fields of microorganisms, drug residues and the like.
The existing method for detecting bacteria by using the colloidal gold test strip has the following problems:
1. the traditional immunochromatography test strip for detecting bacteria is generally a colloidal gold test strip method utilizing a double-antibody sandwich principle, and two antibodies compete against a binding site of bacteria;
2. the Fab used as the detection probe of the colloidal gold labeled antibody has two antigen binding fragments, and one antibody can bind to two bacteria to cause bacterial aggregation in the binding reaction process of the colloidal gold labeled antibody and the bacteria (which is verified under a common microscope and a scanning electron microscope), and the bacteria aggregation into larger particles can cause blockage when chromatography is performed on a test strip to form irregular strips, so that the colloidal gold labeled antibody-bacteria immune complex which migrates to reach a T line is less.
For the reasons mentioned above, the sensitivity can only reach 10 6 CFU/mL, but some bacteria such as Escherichia coli O157H7 are infected with a low pathogenic dose, so the sensitivity of the traditional immunochromatographic test strip for detecting bacteria is in need of improvement and improvement.
Disclosure of Invention
The invention aims to solve the technical problems that in the existing colloidal gold test strip detection method, bacteria are aggregated to cause the defects of blockage, insufficient sensitivity, long detection time and the like in test strip chromatography, and provides a method for detecting bacteria by using a colloidal gold test strip containing bispecific antibodies.
Through conception and verification, the inventor of the present invention found that the use of bispecific antibodies in colloidal gold test strip detection can avoid bacterial aggregation and improve the detection sensitivity. Wherein one antigen binding site of the bispecific antibody binds to the bacteria to be tested and the other antigen binding site binds to the small molecule hapten-carrier conjugate. The bacteria aggregation is completely avoided in the test, and the detection sensitivity can reach 2.5X10 4 CFU/mL. In addition, the bispecific antibody used in the invention has high stability and stable and reliable detection result; the improvement of sensitivity also brings about the improvement of detection efficiency.
In order to solve the technical problems, one of the technical schemes provided by the invention is as follows: a method for detecting bacteria using a colloidal gold test strip containing bispecific antibodies, comprising the steps of:
(1) Reacting bacteria to be detected with the colloidal gold marked by the bispecific antibody to obtain a bacteria-bispecific antibody colloidal gold compound;
(2) Purifying the bacterial-bispecific antibody colloidal gold complex and dissolving the bacterial-bispecific antibody colloidal gold complex in a colloidal gold solution marked by a small molecule hapten-carrier conjugate to obtain a sample loading solution;
(3) The sample liquid is dripped on the colloidal gold test strip to react;
wherein one antigen binding site of the bispecific antibody binds to the bacteria to be tested and the other antigen binding site binds to the small molecule hapten-carrier conjugate.
The amounts of the sample to be tested, the colloidal gold labeled with the bispecific antibody and the colloidal gold solution labeled with the small molecule hapten-carrier conjugate can be determined routinely by those skilled in the art, and can be detected, for example, by reference to a colloidal gold test strip containing a monoclonal antibody in the art.
Preferably, the bispecific antibody comprises a Fab 1 -Fc-Fab 2 In the structure, the superscript numerals in the foregoing structure are only used for distinguishing the same terms and have no practical meaning.
In some embodiments, the bispecific antibody further comprises an antibody constant region whose heavy chain constant region is selected from human or murine IgG1, igG2, igG3 and IgG4 constant regions and conventional variants thereof, and whose light chain constant region is selected from human or murine kappa and lambda chain constant regions and conventional variants thereof.
Preferably, the bacteria to be tested can be harmful bacteria common in the food industry, including gram-positive bacteria and gram-negative bacteria, such as escherichia coli, salmonella typhimurium, vibrio parahaemolyticus, staphylococcus aureus, listeria monocytogenes and the like; gram-negative bacteria are preferred.
And/or, the small molecule hapten-carrier conjugate is a non-naturally occurring artificially synthesized small molecule hapten, and can be routinely selected by a person skilled in the art within the scope, preferably the furazolidone metabolite 4-CPAOZ.
Preferably, the gram-negative bacterium is Escherichia coli; preferably E.coli O157, more preferably E.coli O157: H7.
preferably, the carrier in the small molecule hapten-carrier conjugate is a hapten common carrier such as Bovine Serum Albumin (BSA), chicken Ovalbumin (OVA) or hemocyanin (KLH) and the like; BSA is preferred.
In a preferred embodiment of the invention, the small molecule hapten-carrier complex is 4-CPAOZ-BSA and the bacteria to be tested is E.coli O157: H7.
preferably, the bispecific antibody is prepared as follows:
preparing 4-CPAOZ-BSA as a complete antigen by taking AOZ as a raw material, and preparing immune cells secreting an anti-4-CPAOZ-BSA antibody by using the complete antigen;
preparing an inactivated escherichia coli O157:H27 bacterial antigen, preparing immune cells resisting the escherichia coli O157:H27 bacterial antigen by using the inactivated escherichia coli O157:H27 bacterial antigen, and preparing hybridoma cells resisting the escherichia coli O157:H27 bacterial antigen by using the immune cells;
fusing the immune cells secreting the anti-4-CPAOZ-BSA antibody and the hybridoma cells resisting the escherichia coli O157:H7 bacterial antigen to obtain the hybridoma cells secreting the bispecific antibody, and extracting the bispecific antibody from the peritoneal fluid of the mice injected with the hybridoma cells secreting the bispecific antibody.
The immune cells of the invention are preferably immune spleen cells.
In a preferred embodiment of the invention, the bispecific antibody comprises a heavy chain variable region and a light chain variable region, wherein the nucleic acid sequences encoding the heavy chain variable region are shown in SEQ ID NO. 1 and SEQ ID NO. 3, and the nucleic acid sequences encoding the light chain variable region are shown in SEQ ID NO. 2 and SEQ ID NO. 4, respectively.
Preferably, the method comprises the following specific steps:
separating bacteria from a sample to be detected, adding the bispecific antibody labeled colloidal gold into the separated bacteria, and separating and purifying the obtained bacteria-bispecific antibody colloidal gold complex after reaction;
dissolving the bacterial-bispecific antibody colloidal gold complex in a PBST buffer solution containing colloidal gold marked by the small molecule hapten-carrier conjugate to obtain a sample loading solution of the colloidal gold test strip;
and (3) dripping the sample liquid onto the colloidal gold test strip to react.
Preferably, the separation method is centrifugation; preferably, the purification step is repeated.
And/or the test strip comprises a detection line and a quality control line, wherein the detection line is coated with the antibody resisting the bispecific antibody, and the quality control line is coated with the antibody resisting the small molecule hapten.
In order to solve the technical problems, the second technical scheme provided by the invention is as follows: a bispecific antibody comprising a heavy chain variable region and a light chain variable region, wherein the nucleic acid sequences encoding the heavy chain variable region are shown in SEQ ID NOs 1 and 3, respectively, and the nucleic acid sequences encoding the light chain variable region are shown in SEQ ID NOs 2 and 4, respectively.
Preferably, the bispecific antibody comprises a Fab 1 -Fc-Fab 2 In the structure, the superscript numerals in the foregoing structure are only used for distinguishing the same terms and have no practical meaning.
In some embodiments, the bispecific antibody further comprises an antibody constant region whose heavy chain constant region is selected from human or murine IgG1, igG2, igG3 and IgG4 constant regions and conventional variants thereof, and whose light chain constant region is selected from human or murine kappa and lambda chain constant regions and conventional variants thereof.
In order to solve the technical problems, the third technical scheme provided by the invention is as follows: the method for preparing the bispecific antibody for detecting bacteria, which is characterized by comprising the following steps of preparing a colloidal gold test strip for detecting bacteria.
On the basis of conforming to the common knowledge in the field, the above preferred conditions can be arbitrarily combined to obtain the preferred examples of the invention.
The reagents and materials used in the present invention are commercially available.
The invention has the positive progress effects that:
1. the novel antibody of the modified Fab fragment is utilized, and only a single antigen binding fragment is used for specifically binding bacteria, so that the degree of bacterial aggregation is reduced, the phenomenon that a chromatographic test strip is blocked by larger particles due to bacterial aggregation is avoided, and the bacterial quantity reaching a T line is increased;
2. the test strip developed by combining the indirect method avoids the sensitivity reduction caused by the existence of the same competition site of the two antibodies, so that the secondary antibodies on the T line capture more bacteria combined with the gold-labeled antibodies, and compared with the double-antibody sandwich test strip method, the sensitivity is improved.
3. The gold-labeled 4-CPAOZ-BSA can be combined with another antigen binding fragment of the antibody, so that the color development of the T line is enhanced, the sensitivity is further improved, and finally the sensitivity of the test strip can reach 2.5 multiplied by 10 4 The excessive gold-labeled 4-CPAOZ-BSA substance can also realize C line color development, ensure the effectiveness of the test strip and provide reliable reference for reading the T/C ratio.
4. The bispecific antibody used in the invention has a complete framework of a natural Y-type antibody, is more stable in a conventional environment, and ensures the stability of a colloidal gold test strip detection experiment.
5. Because the sensitivity of the detection method is improved, the sample enrichment processing time is relatively shortened, the sample enrichment processing time of the conventional gold-labeled test strip method is more than 12 hours, and the sample enrichment processing time is about 10 hours, and the total time of the sample enrichment processing time is saved by more than 1.5 hours, so that the detection method is faster.
Drawings
FIG. 1 is a schematic diagram of the assembly of a test strip.
FIG. 2 is a hybridoma cell line secreting bispecific antibodies.
FIG. 3 is a diagram of the chromosomes of a modified hybridoma cell.
FIG. 4 shows the results of the pH optimization test for the optimal reaction.
FIG. 5 shows the results of an optimal antibody labeling amount optimization test.
Fig. 6 shows the observation result of the optical microscope.
Fig. 7 shows the observation result of the scanning electron microscope. Wherein a, the gold-labeled modified antibody reacts with Escherichia coli O157H 7; b, the reaction result of the gold-labeled common antibody and escherichia coli O157:H27; c, combining single escherichia coli O157H7 with a plurality of gold-labeled modified antibodies; and d, modifying the antibody by a gold label.
FIG. 8 is a selection assay for optimal buffers. a 0.01M PBS buffer; b 0.01M PBST buffer; c 0.01M PBST buffer containing 1% BSA; d: 0.01M PBST buffer with 5% FBS.
Fig. 9 is a plot of the detection line (T-line) coating concentration optimization.
Fig. 10 is a control line (C line) coating concentration optimization.
FIG. 11 shows the amount of gold-labeled 4-CPAOZ-BSA optimized.
FIG. 12 is a graph showing the development of enhanced T-line by the validation of gold-labeled 4-CPAOZ-BSA. A: gold-labeled 4-CPAOZ-BSA was not added; b, adding gold-labeled 4-CPAOZ-BSA; a': after no addition of the gold-labeled 4-CPAOZ-BSA test strip.
FIG. 13 shows test strip sensitivity test results. A: modifying the sensitivity test of the antibody preparation test strip; b: and (3) preparing a test strip sensitivity test by using a common antibody.
FIG. 14 shows the minimum detection limit of the duplicate test strips.
FIG. 15 shows test strip specificity test results. A: coli O157: H7 ATCC31350; b: coli O111 CVCC1450; c: coli O26 CVCC1540; d: salmonella typhimurium ATCC14028; e: salmonella choleraesuis BNCC186354; f: staphylococcus aureus ATCC29523; g: vibrio parahaemolyticus ATCC33847; h: listeria monocytogenes cic 21662; i: enterobacter sakazakii cic 21550; j: sterile PBST buffer.
Fig. 16 shows the results of milk simulation sample testing.
FIG. 17 is a mass spectrum of 4-CPAOZ.
FIG. 18 is a MALDI-TOF-MS test chart of 4-CPAOZ-BSA.
cDNA sequence of bispecific antibody
SEQ ID NO. 1: cDNA sequence of heavy chain variable region mRNA of anti-4-CPAOZ antibody
TATGGCCGAGGTCAAACTGCAGGAGTCTGGAGATGATCTGGTAAAGCCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATTAACTGGATAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATAGGACGTATTTCTCCTGGAAGTGGTAGTACTTACTACAATGAAATGTTCAAGGGCAAGGCAACACTGACTGTAGACACATCCTCCAGCACAGCCTACATTCAGCTCAGCAGCCTGTCATCTGAGGACTCTGCTGTCTATTTCTGTGCAATCCTCTATGATGGTTACTACGTGGACTATGCTATGGACTACTGGGGTCAAGGAACCACGGTCACCGTCTCCTCAGGTGGAGGCGGT
SEQ ID NO. 2: anti-E.coli O157: cNA sequence of H7 antibody heavy chain variable region mRNA
TACCGCCTCCACCTGAGGAGACGGTGACCGTGGTTCCTTGACCCCAGTAGTCCATAGCATAGTCCACGTAGTAACCATCATAGAGGATTGCACAGAAATAGACAGCAGAGTCCTCAGATGACAGGCTGCTGAGCTGAATGTAGGCTGTGCTGGAGGATGTGTCTACAGTCAGTGTTGCCTTGCCCTTGAACATTTCATTGTAGTAAGTACTACCACTTCCAGGAGAAATACGTCCTATCCACTCAAGGCCCAGTCCAGGCCTCTGTTTTATCCAGTTAATCCAGTAGCTGGTGAAGGTGTAGCCAGAAGCCTTGCAGGACAGCTTCACTGAGGCCCCAGGCTTTACCAGATCATCTCCAGACTGCTGCAGTTGCACCTCGGCCAT
SEQ ID NO. 3: cDNA sequence of antibody light chain variable region mRNA of anti-4-CPAOZ
GTGGCGGATCGGACATCGAGCTCACTCAGTCTCCAGCAATCATGTCTGCATCTCTAGGGGAGGAGATCACCCTAACCTGCAGTGCCAGCTCGAGTGTAAGTTACATGCACTGGTACCAGCAGAAGTCAGGCACCTCTCCCAAACTCTTGATTTATAGCACATCCAACCTGGCTTCTGGAGTCCCTTCTCGCTTCAGTGGCAGTGGGTCTGGGACCTTTTATTCTCTCACAATCAGCAGTGTGGAGGCTGAAGATGCTGCCGATTATTACTGCCATCAGTGGAGTAGTTATCACGTTCGGTGCTGGCACAAAGCTGGAGATCAAACGG
SEQ ID NO. 4: anti-E.coli O157: cNA sequence of H7 antibody light chain variable region mRNA
TCCGTTTGATTTCCAACTTTGTGCCCCCTCCGAACGTGTAAGCTCCCTAATGTGCTGACAGTAATAGGTTGCAGCATCCTCCTCCTCCACAGGATGGATGTTGAGGGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCAGGGACCCCAGATTCTAGGTTGGATACAAGATAGATGAGGAGTCTGGGTGGCTGTCCTGGTTTCTGTTGGTTCCAGTGCATATAACTATAGCCAGATGTACTGACACTTTTGCTGGCCCTGTATGAGATGGTGGCCCTCTGCCCCAGAGATACAGCTAAGGAAGCAGGAGACTGAGTGAGCTCAATGTCCGATCCGCCACC
cDNA sequence of 4-CPAOZ monoclonal antibody
SEQ ID NO. 5: cDNA sequence of heavy chain variable region mRNA of monoclonal antibody resisting 4-CPAOZ
TATGGCCGAGGTGCAGCTGCAGGAGTCTGGAGATGATCTGGTAAAGCCTGGGGCCTCAGTGAAGCTGTCCTGCAAGGCTTCTGGCTACACCTTCACCAGCTACTGGATTAACTGGATAAAACAGAGGCCTGGACAGGGCCTTGAGTGGATAGGACGTATTTCTCCTGGAAGTGGTAGTACTTACTACAATGAAATGTTCAAGGGCAAGGCAATACTGACTGTAGACACATCCTCCAGCACAGCCTACATTCAGCTCAGCAGCCTGTCATCTGAGGACTCTGCTGTCTATTTCTGTGCAATCCTCTATGATGGTTACTACGTGGACTATGCTATGGACTACTGGGGTCAAGGAACCACGGTCACCGTCTCCTCAGGTGGAGGCGGT
SEQ ID NO. 6: cDNA sequence of monoclonal antibody light chain variable region mRNA resisting 4-CPAOZ
TCCGTTTGAGCTCCAACTTGGTGCCCCCTCCGAACGTGTAAGCTCCCTAATGTGCTGACAGTAATAGGTTGCAGCATCCTCCTCCTCCACAGGATGGATGTTGAGGGTGAAGTCTGTCCCAGACCCACTGCCACTGAACCTGGCAGGGACCCCAGATTCTAGGTTGGATACAAGATAGATGAGGAGTCTGGGTGGCTGTCCTGGTTTCTGTTGGTTCCAGTGCATATAACTATAGCCAGATGTACTGACACTTTTGCTGGCCCTGTATGAGATGGTGGCCCTCTGCCCCAGAGATACAGCTAAGGAAGCAGGAGACTGAGTGAGCTCAATGTCCGATCCGCCAC
Detailed Description
The invention is further illustrated by means of the following examples, which are not intended to limit the scope of the invention. The experimental methods, in which specific conditions are not noted in the following examples, were selected according to conventional methods and conditions, or according to the commercial specifications.
Test animals
Clean grade 8 week old Balb/c females and 8 week old Kunming females were purchased from Shanghai Jieshikari Inc.
Test cell lines
The anti-E.coli O157H7 hybridoma cell line was prepared by this experiment.
Test materials and reagents
3-amino-2-oxazolidinone (AOZ) Shanghai Ala Di Biochemical technology Co., ltd
Para-aldehyde benzoic acid, 93% Shaoshao chemical technology (Shanghai) Co., ltd
Freund's complete adjuvant Sigma Co., USA
Freund's incomplete adjuvant Sigma Co., USA
Polyethylene glycol 6000 Sigma Co., USA
Hypoxanthine Sigma Co
Thymidine U.S. Sigma Co
Aminopterin U.S. Sigma Co
Glutamic acid Sigma Co., ltd
Green streptomycin mixture Sigma Co., USA
Bovine Serum Albumin (BSA) Sigma Co., USA
Chicken Ovalbumin (OVA) Sigma company in united states
8-AZguanine (8-AG) Sigma Co., USA
Colchicine Sigma Co., USA
4-methylmorpholine national drug group chemical reagent Co.Ltd
Isobutyl chloroformate national medicine group chemical reagent Co.Ltd
Dimethyl sulfoxide national drug group chemical reagent Co., ltd
98% concentrated sulfuric acid national medicine group chemical reagent Co.Ltd
Sodium hydroxide national medicine group chemical Co., ltd
30% Hydrogen peroxide national medicine group chemical reagent Co.Ltd
N, N-Dicyclohexylcarbodiimide (DCC) national pharmaceutical Condition chemical Co., ltd
Gelatin national pharmaceutical Congress chemical Co., ltd
N, N-dimethylformamide (NHS) national medicine group chemical Co., ltd
Gibco fetal bovine serum was purchased from Invitrogen, inc., USA
Gibco DMEM high sugar Medium was purchased from Invitrogen, inc., USA
96 well cell culture plate Costar Co., USA
24 well cell culture plate Costar Co., USA
6 well cell culture plate Costar Co., USA
96-well ELISA plate Co.Ltd
25mL 2 Cell culture flask Corning Co., USA
HiTrap TM Protein G antibody purification column GE Co
Coli O157: h7 ATCC31350
Modified EC broth Qingdao Gaokou Haibo biotechnology Co., ltd;
anti-EHEC O157H 7O-SP monoclonal antibody laboratory preparations;
chloroauric acid national medicine group chemical company, inc;
sodium citrate national pharmaceutical group chemical company, inc;
glass fiber mat Shanghai Jiening Biotechnology Co., ltd;
the absorbent pad Shanghai Jiening Biotechnology Co., ltd;
NC film Shanghai Jiening Biotechnology Co., ltd;
PVC backboard Shanghai Jiening Biotechnology Co., ltd;
test instrument
Siemens Feier (Thermo Fisher) technology Co., ltd
AL104 electronic analytical balance METTLER TOLEDO Co., USA
Dry thermostat (MK-20) Hangzhou Orthosiphon Cheng Yiqi Co
4 ℃ refrigerator and-80 ℃ ultralow temperature refrigerator China sea company
THZ-D bench constant temperature oscillator Suzhou Diels test Equipment Co., ltd
Constant temperature and humidity biochemical incubator, queue Co., USA
Lab Dancer vortex Mixer Germany IKA company
Direct-Pure 15Plus ultrapure water all-in-one Shanghai Rui maple Biotechnology Co., ltd
CO 2 Cell incubator U.S. Thermo Scientific Co
In the invention, the small molecule hapten is 4-CPAOZ.
Example 1: furazolidone metabolite antigen (4-CPAOZ-BSA) synthesis and monoclonal antibody preparation thereof
1.1 derivatization of Furazolidone Metabolic Acid (AOZ) to hapten 4-CPAOZ
Into a 50ml single-neck flask, 0.6456g of p-aldehyde benzoic acid and 6ml of deionized water are added, N-Dimethylformamide (DMF) is slowly added dropwise during stirring, after the p-aldehyde benzoic acid is completely dissolved, 0.306g of AOZ is added, the reaction is carried out for 2 hours at room temperature, the solution becomes mixed, light yellow sediment exists, and the light yellow solid is obtained after filtering and water washing for 3 times, namely 4-CPAOZ.
The reaction equation for the synthesis of 4-CPAOZ is as follows:
and carrying out mass spectrometry analysis and identification on the synthesized product. The mass spectrum of 4-CPAOZ was shown in FIG. 17, and it was found that the molecular weight of 4-CPAOZ was 232.9 (positive ion) and found to be 234.
1.2 Coupling 4-CPAOZ with BSA to generate complete antigen
The isobutyl chloroformate method is adopted to couple 4-CPAOZ-BSA, and the coupling route is as follows: 20.5mg of 4-CPAOZ was dissolved in 2ml of DMF, 75. Mu.l of 4-methylmorpholine was added dropwise with stirring, stirring was continued for 5 minutes, 50. Mu.l of isobutyl chloroformate was added dropwise, stirring was continued for 15 minutes, and solution A was obtained. 50mg of BSA was dissolved in 5ml of PBS at pH7.2, 1mM, to give solution B. The solution A is dropwise added into the solution B under stirring, and the reaction is carried out for 2 hours at room temperature. Dialysis was performed at 4℃for 3 days and 3 night with PBS at pH7.2, with 2 changes per day. Freeze-drying, packaging, and storing at-20deg.C. The product was identified by MALDI-TOF-MS and the 4-CPAOZ-OVA was coupled using OVA instead of BSA.
The 4-CPAOZ-BSA coupling route is as follows:
identification of antigen 4-CPAOZ-BSA
MALD-TOF-MS method: 4-CPAOZ-BSA was lyophilized and identified by sample feeding. As a result, as shown in FIG. 18, the molecular weight of BSA was 66479.5, the molecular weight after coupling was 70693.06, the molecular weight was increased 4213.56, and the coupling ratio was 22.27 to 24.03, achieving the optimum coupling ratio value.
EXAMPLE 2 preparation of bispecific antibody against E.coli O157H7 and 4-CPAOZ-BSA
2.1 preparation of complete antigen
4-CPAOZ and BSA were coupled together using isobutyl chloroformate to give 4-CPAOZ-BSA, and the product was dialyzed against 0.01M PBS for 3d. After dialysis, the product was concentrated appropriately and centrifuged to remove the precipitate, and the final product, 4-CPAOZ immunogen, was stored at-20 ℃.
And (3) performing coupling reaction by using OVA instead of BSA in the same way, wherein the final product is the 4-CPAOZ coating antigen, and preserving at-20 ℃.
2.2 immunization of mice
8-week-old clean-grade healthy female BALB/c mice were immunized with the prepared immunogen, and the immunization procedure is as follows in Table 1:
table 1 mouse immunization procedure
2.3 mouse serum titers determination
After the third immunization of the mice, the serum titers of the mice were determined by indirect ELISA with synthetic coating precursors.
2.4 preparation and Induction of E.coli-resistant O157:H27 hybridoma cell lines
2.4.1 reference (Long Mengyao, intestinal tractThe IMS-RT-PCR of the blood colibacillus O157:H7 and the establishment of the immune chromatography detection method of lanthanide fluorescent microspheres (the article of the university of Shuos, the university of Nanjing agriculture, 2016), the hot phenol-water method is used for extracting the EHEC O157:H7 Lipopolysaccharide (LPS), the water-phase lipopolysaccharide and the phenol-phase lipopolysaccharide are separated, and the O-specific polysaccharide (O-spectific polysaccharides, O-SP) is prepared by an acidolysis method. The concentration was set at 2X 10 9 CFU/mL EHEC O157: H7 formaldehyde was inactivated to prepare whole-cell immunogens, and 8 week old female Balb/c mice were immunized by conventional methods. Taking spleen cells of immunized mice, fusing the spleen cells with SP2/0 myeloma cells according to the ratio of 5-10:1, culturing for a plurality of days, taking EHEC O157:H27 inactivated thalli and O-SP as coating sources respectively, sequentially screening positive cell clones secreting EHEC O157:H27O-SP antibodies by an indirect ELISA method, constructing subclones, and freezing in liquid nitrogen.
2.4.2 Induction culture of hybridoma cell lines with 8-AG
The anti-colibacillus O157: H7 hybridoma cell strain stored in a resuscitating laboratory is subjected to induction culture by adding 8-AG into a culture medium, so that hypoxanthine guanine phosphoribosyl transferase HGPRT of the hybridoma cells is deleted, and the cell strain is subjected to expansion culture and frozen storage backup.
2.5 cultivation of feeder cells
On the day before fusion, clean-class 8-week-old Kunming mice were sacrificed by eye exsanguination and fixed in an ultra-clean bench after 75% alcohol immersion. Cutting abdominal skin with sterile ophthalmic scissors, exposing peritoneum, injecting blank DMEM medium into the peritoneum, gently tapping the abdominal cavity of a mouse with sterile forceps, extracting culture in the abdominal cavity, centrifuging at 1000r/min for 10min based on 15mL centrifuge tube, discarding supernatant, resuspending cells with HAT medium containing 20% fetal bovine serum, dripping into 96-well cell culture plate, and standing at 37deg.C and 5% CO 2 Culturing in a cell culture incubator.
2.6 preparation and fusion of immune splenocytes
Mice with higher serum titers measured by indirect ELISA are taken, and after the mice are killed by eyeball bloodletting, the mice are soaked in 75% alcohol and then fixed in an ultra-clean workbench. Sequentially cutting abdominal skin and peritoneum by using sterile ophthalmic scissors, taking out spleen, placing into a 6-hole cell culture plate, washing with a blank DMEM culture medium, transferring into another hole, repeatedly washing the spleen by using a syringe to absorb the blank DMEM culture medium, eluting spleen cells, transferring eluent into a 15mL centrifuge tube, centrifuging at 1000r/min for 10min, discarding the supernatant, and re-suspending with a proper amount of blank DMEM culture medium for later use.
Blank DMEM medium, complete medium containing 20% FBS HAT and 1mL PEG 6000 (polyethylene glycol) were pre-incubated at 37deg.C, 5% CO 2 Preheating for standby in the incubator.
The anti-escherichia coli O157: H7 hybridoma cells with good growth state and lacking HGPRT enzyme are collected into a 15mL centrifuge tube, centrifuged for 10min at 1000r/min, and after the supernatant is discarded, the bottom cells of the tube are resuspended with 2-3mL blank DEME medium. The anti-escherichia coli O157:H7 hybridoma cell with the HGPRT enzyme deleted and 4-CPAOZ-BSA immune spleen cell are mixed according to the proportion of 1:10 and added into a fusion tube, a blank DEME culture medium is added to enable the final volume to be 30mL,1000r/min is centrifuged for 10min, the supernatant is discarded, the culture medium in the tube is sucked, and after the two cells are fully mixed, the mixture is placed in a 37 ℃ water bath for 10min. Adding 1mL preheated PEG into 45s, allowing to act for 90s, stopping PEG reaction in the order of adding 1mL blank DMEM medium into 30s, adding 2mL blank DMEM medium into 30s, and adding 30mL blank DMEM medium into 2min, and finally placing the fusion tube at 37deg.C and 5% CO 2 Standing in incubator for 10min, centrifuging at 1000r/min for 10min, removing supernatant, re-suspending cells with 12mL of 20% HAT complete medium, diluting to different concentrations, adding 100 μl into each well, standing at 37deg.C, and 5% CO 2 Culturing in an incubator.
2.7 screening of Positive clones
An indirect ELISA method is adopted, a 4-CPAOZ-OVA coating ELISA plate is used, and the ELISA plate is blocked by 1% gelatin for later use. When the hybridoma cells grow to a proper size, 50 mu L of the supernatant of each hole is added into a coated ELISA plate, negative mouse serum is used as a negative control, an HRP-marked goat anti-mouse antibody is used as a secondary antibody, and whether each hole is positive to 4-CPAOZ-OVA is tested.
For the positive wells obtained by the screening, each clone well was tested for positivity to E.coli O157:H27 by an indirect ELISA method.
A cloning well is positive for both coating substances, namely the required hybridoma cell cloning well for secreting the bispecific antibody, and 2 Fab fragments of the secreted antibody can be specifically combined with escherichia coli O157: H7 and 4-CPAOZ respectively.
2.8 subcloning and expanded culture of Positive hybridoma cells
The cells of the bispecific antibody positive secretion strain obtained by screening are subjected to subcloning twice, and are subjected to expansion culture and frozen storage backup by using a 48-hole cell culture plate, a 24-cell culture pore plate and a cell culture bottle in sequence.
The bispecific antibody secreting hybridoma cell lines are shown in FIG. 2.
2.9 preparation and purification of monoclonal antibody by ascites tumor method
Clean-class 8 week old female BALB/c mice were given intraperitoneal injections of 0.5mL of sterilized paraffin oil, 1 time a week, 3 consecutive injections for use.
The bispecific antibody hybridoma cells after the expansion culture are taken and centrifuged for 10min at 1000r/min, and the supernatant is discarded and then the cells are resuspended in physiological saline. The mice were first intraperitoneally injected with 0.5mL of sterilized paraffin oil and then the cell suspension was injected. The change of the mice is observed, the abdominal cavity of the mice is enlarged about 10-12 days after the injection of the cell suspension, and the ascites can be collected. Centrifuging ascites to remove upper paraffin oil and lower precipitate, and storing in-80deg.C refrigerator.
The crude antibody obtained was filtered using a 0.45 μm filter and then HiTrap was used TM Protein G purification column was used for purification.
The purified bispecific antibody is sequenced, and the variable region sequence is shown as SEQ ID NO. 1-4.
Example 3 detection of engineered antibody-based E.coli O157H7 colloidal gold test strip
3.1 chromosomal identification of hybridoma cells
Taking bispecific antibody hybridoma cells, adding 0.4 mug/mL colchicine into a culture medium, continuously culturing for 4-6 hours, collecting the cells, centrifuging at 1000r/min for 10min, and discarding the supernatant. The cell pellet was resuspended in 0.075M KCl solution and hypotonic in a water bath at 37℃for 30 min. To the cell suspension, 1mL of freshly prepared fixative (methanol: glacial acetic acid=3:1) was added, and after mixing, the mixture was centrifuged at 1000r/min for 10min, and the supernatant was discarded. Adding 5mL of fixed solution into the sediment to resuspend the cells, standing for 30min at room temperature, centrifuging for 10min at 1000r/min, discarding the supernatant, repeating the operation twice, adding 5mL of fixed solution, sealing a pipe orifice, and reacting for 8h at 4 ℃. Centrifuging the reaction product, removing supernatant, re-suspending with appropriate amount of fixing solution, dripping 1-2 drops of the fixing solution onto the glass slide soaked in ice water, fixing with flame, and naturally drying. Staining with freshly prepared Giemsa staining solution, microscopic examination, selecting cell chromosome with good chromosome dispersion, no overlap and no loss in visual field, observing, counting about 100 complete cells, and counting the chromosome number. The E.coli-resistant O157H7 hybridoma was obtained by fusing SP2/0 cells (60-68 chromosomes) with mouse spleen cells (40 chromosomes), so that the number of chromosomes was about the sum of the two (about 100), while the bispecific hybridoma strain was obtained by fusing E.coli-resistant O157H7 hybridoma with mouse spleen cells, so that the number of chromosomes was about 140, as shown in FIG. 3.
3.2 preparation of colloidal gold
100mL of 0.01% chloroauric acid solution was added to a clean conical flask, placed on a magnetic stirrer, heated to boiling, followed by rapid addition of 2mL of 1% sodium citrate solution, continued heating until the solution became reddish and no longer changed in color, with ddH 2 O is supplemented to the original volume, and the mixture is stored at 4 ℃ for standby.
3.3 colloidal gold-labeled antibodies and Condition optimization
The pH value is selected to dilute the purified antibodies to 0.1mg/mL by PBS respectively; to 62 mL EP tubes, 1mL of colloidal gold solution was added, and 0.1mol/L K was added to each tube 2 CO 3 Mixing solution 0, 5, 10, 15, 20, 25 μl, adding 100 μl antibody, mixing, and standing for 10min; adding 100 mu L of 10% NaCl solution into each tube, standing for 2 hours, and observing whether the color of the solution in each tube changes; the EP tube, which turned the color of the solution blue, was discarded and the pH of the solution, which remained red, was taken as the optimal pH. At the same time, the solution still kept red is centrifuged to obtain the supernatant, and OD is measured 520 Value, determine if the antibody was successfully labeled.When the amount of antibody added was constant and the pH of each tube solution was different, as shown in FIG. 4, the reaction was carried out from 15. Mu. L K 2 CO 3 The EP tube (pH 8.5 was measured) was started and the solution color was reddish and unchanged, so that pH 8.5 was chosen as the optimum pH under this condition.
Antibody dose purified antibodies were diluted to 0.1mg/mL with PBS, respectively; to 62 mL EP tubes, 1mL of colloidal gold solution was added, and 15. Mu.L, 0.1mol/L K, respectively, was added to each tube 2 CO 3 Adding 0, 20, 40, 60, 80 and 100 mu L antibody after uniformly mixing, uniformly mixing and standing for 10min; adding 100 mu L of 10% NaCl solution into each tube, standing for 2 hours, and observing whether the color of the solution in each tube changes; the EP tube, which turned the color of the solution to blue, was discarded, and the amount of antibody added to the solution, which remained red, was taken as the minimum labeled amount, and the optimum labeled amount of antibody was increased by 30% on this basis. When the pH of the reaction was unchanged, the amount of antibody added to each tube was adjusted, and as shown in FIG. 5, from the EP tube to which 40. Mu.L of antibody was added, the color of the solution appeared reddish with no change, and to ensure the effectiveness of antibody labeling, the amount of antibody added was increased by 30% based on the amount of antibody added, i.e., 52. Mu.L as the optimum amount of antibody labeling.
The purified antibodies were diluted to 0.1mg/mL with PBS, respectively; 10mL of colloidal gold solution was added to a 15mL centrifuge tube, and an appropriate amount of 0.1mol/L K was added 2 CO 3 Respectively adjusting the pH values to the optimal values of the labeled metabolite antibodies, adding the antibodies according to the optimal labeling amount of the antibodies, uniformly mixing, and reacting for 0.5h at room temperature; then 1mL of 10% BSA solution was added to make the final concentration of BSA in the system 1%, and the mixture was left to stand for 0.5h; after the reaction was completed, the mixture was centrifuged at 12000r/min for 30min at 4℃to discard the supernatant, and the mobile pellet was resuspended in 2mL of a suspension (containing 0.02% NaN 3) and kept at 4℃for further use.
3.4 observation by Transmission Electron microscope
Coli O157: inoculating H7 to LB medium, shaking culturing at 37deg.C and 180r/min for 2 hr, centrifuging at 3000r/min for 5min, discarding supernatant, re-suspending with PBS buffer (0.01M, pH 7.4), adding formaldehyde to reach final concentration of 3%, fixing for 2 hr, centrifuging at 3000r/min for 5min, discarding supernatant, and re-suspending with PBS buffer (0.01M, pH 7.4) to obtain the desired Escherichia coli O157: h7 observations of the samples.
50 mu L of colloidal gold-labeled bispecific monoclonal antibody, and colloidal gold-labeled anti-Escherichia coli O157:H27 monoclonal antibody were mixed with 100 mu L of 10 7 CFU/mL E.coli O157H7 was mixed and reacted at room temperature for 15min. The results of the observation by an optical microscope are shown in FIG. 6, wherein the bacteria are aggregated after the reaction with the bacteria by using a common gold-labeled antibody, and the bacteria can be still in a dispersed state after the reaction with the bacteria by using a gold-labeled modified antibody. The prepared colloidal gold particles are spherical with uniform size and have a diameter of about 18nm (as shown in fig. 7 d) when observed under a scanning electron microscope. E.coli O157 was observed under transmission electron microscopy: h7, colloidal gold particles, two gold-labeled antibodies and Escherichia coli O157: H7 binding state and Escherichia coli dispersion state. After the engineered gold-labeled antibody reacted with the bacteria, it was also shown that the gold-labeled engineered antibody reduced the degree of aggregation of the bacteria, and multiple colloidal gold particles were observed to bind around a single bacteria (as shown in fig. 7 c).
Example 4 Assembly and optimization of colloidal gold immunochromatographic test strip
4.1 assembling and use of colloidal gold immunochromatographic test paper
The colloidal gold immunochromatographic test strip is assembled by a PVC back plate, a sample adding pad, an NC film and a water absorbing pad according to a figure 1, and comprises the following steps: NC film is fixed in the middle of PVC backboard, sample adding pad and water absorbing pad are cut and stuck on the upper and lower ends of NC film respectively, and are overlapped with NC film by 2mm, detection line (T line) is coated with goat anti-mouse IgG, quality control line (C line) is coated with anti-4-CPAOZ monoclonal antibody (the variable region sequence of heavy chain and the variable region sequence of light chain are respectively shown as SEQ ID NO:5 and 6, the constant region of light chain is the constant region of mouse light and heavy chain), coating concentration is respectively 1mg/mL, 0.5mg/mL, and the mixture is dried for 1h at 25 ℃, finally cut into test paper strips with width of 3.8mm, and the test paper strips are preserved at room temperature in dark place. As shown in fig. 1.
When the kit is used, a sample to be tested is added into an improved EC broth culture medium according to a ratio of 1:9, fully mixed and enriched culture is carried out, 1mL of bacterial solution is taken and centrifuged at 10000r/min for 5min at 4 ℃,100 mu L of 1 xPBST buffer solution containing 1% BSA or 5% FBS is used for sediment, 50 mu L of colloidal gold marked by bispecific antibody is added for reaction for 15min, centrifugation is carried out for 5min at 2500r/min, so that the colloidal gold combined with bacteria is sedimented together with the bacteria, the supernatant is discarded, 1mL of PBST buffer solution is used for resuspension and washing sediment, the centrifugal washing operation is repeated for two times, finally 6.5 mu L of gold-labeled 4-CPAOZ-BSA solution is taken, 100 mu L of PBST buffer solution containing 1% BSA or 5% FBS is used for resuspension sediment, the sediment is dripped onto a sample pad for reaction for 15min, and the color development condition of the strip is observed. If the T line is developed and the C line is developed, judging that the color is positive; if the T line does not develop and the C line develops, judging that the color is negative; if the line C does not develop, the test strip is invalid.
4.2 optimization of conditions of colloidal gold immunochromatographic test strip
Selection of NC film: the following 5 NC films were prepared: preparing test strips by mini PALL90, mini PALL170, AE99, sartorius CN95 and Sartorius CN140, coating T line and C line with the same concentration, and taking 10 7 CFU/mL of E.coli O157: h7 is taken as a sample, the test is carried out according to the test strip using method, and a proper NC membrane is selected according to the chromatographic and color development conditions. The climbing speed of Sartorius CN95 is faster, the pore size is 15 μm, and the size of the escherichia coli is about 1.2X0.5 μm, so that the escherichia coli can be subjected to chromatography conveniently. The NC film preparation was thus selected for detection O157: h7 test strip.
Buffer selection: 0.01M PBS buffer, pH7.2, 0.01M PBST buffer containing 1% BSA, pH7.2, 0.01M PBST buffer containing 5% fetal bovine serum, pH 7.2. Take 10 7 CFU/mL of E.coli O157: h7 was used as a sample, and the samples were subjected to respective resuspension precipitation with the above 4 buffers, and then subjected to a test to observe the chromatography and color development of each test strip.
In addition, 10. Mu.L of gold-labeled bispecific antibody solution was diluted with 90. Mu.L of each of the above four buffers, centrifuged at 2500r/min for 5min, and the bottom of each tube was observed for precipitation, and a buffer solution having good chromatography conditions and no precipitation at the bottom of the centrifugation was selected as the optimal buffer solution. As shown in FIG. 8, after centrifugation, a small amount of red precipitate appeared at the bottom of the tube of 0.01M PBS buffer and 0.01M PBST buffer, while no precipitate was observed at the bottom of the tube of 0.01M PBST buffer containing 1% BSA and 0.01M PBST buffer containing 5% FBS, indicating that these two buffers were able to better disperse suspended colloidal gold particles, avoiding precipitation of colloidal gold due to low-speed centrifugation. Finally, 0.01M PBST buffer containing 1% BSA or 0.01M PBST buffer containing 5% FBS was selected as the optimal buffer.
Detection line (T line) coating concentration: diluting goat anti-mouse IgG to 0.25, 0.5, 1, 2mg/mL at 10 7 CFU/mL of E.coli O157: h7 is tested according to the operation steps, and proper T line coating concentration is selected according to the color development condition. As a result, as shown in FIG. 9, the T-line color development gradually became lighter as the T-line coating concentration decreased, and a dilution of 1mg/mL with a smaller amount and stable color development was selected as the optimal T-line coating concentration while achieving both the test strip stability and the economic cost.
Coating concentration of a quality control line (C line): 4-CPAOZ monoclonal antibodies (5 mg/mL) were diluted 1:5, 1:10, 1:20, 1:40, tested according to the procedure described above, and appropriate C-line coating concentrations were selected according to the color development. As a result, as shown in FIG. 10, the color development of the C line gradually becomes lighter as the concentration of the C line coating decreases, and a dilution of 1:10, which is stable in color development and small in amount, is selected as the optimal concentration of the C line coating, while the stability of the test strip and the economic cost are simultaneously considered.
Gold-labeled 4-CPAOZ-BSA addition: and respectively taking 0, 2.5, 5, 10 and 20 mu L of gold-labeled 4-CPAOZ-BSA, supplementing to 100 mu L by using a PBST buffer solution containing 1% BSA, selecting an addition amount with good effect according to the color development condition and the background depth, and adding 30% on the basis to ensure the stability of the gold-labeled 4-CPAOZ-BSA. As shown in FIG. 11, the color development of the C line is gradually enhanced to be unchanged along with the gradual increase of the addition amount of the gold-labeled 4-CPAOZ-BSA, however, the background depth of the test strip is also gradually increased, the background of the test strip added with 10 and 20 mu L is reddish, and the addition amount of the gold-labeled 4-CPAOZ-BSA is 30% based on 5 mu L due to the stability of the color development of the C line and the consideration of the material consumption amount of the gold-labeled 4-CPAOZ-BSA, namely 6.5 mu L is finally selected as the optimal addition amount of the gold-labeled 4-CPAOZ-BSA.
Example 5 verification and testing of colloidal gold immunochromatographic test strip
5.1 verification of gold-labeled 4-CPAOZ-BSA to enhance T-line color development
1mL each 10 6 CFU/mL E.coli O157: the H7 bacterial liquid is added into an EP tube, and the operation steps are carried out according to the above steps and the anti-escherichia coli O157: and (3) carrying out a pre-reaction on the colloidal gold marked by the H7 monoclonal antibody, adding a proper amount of PBST buffer solution containing 1% BSA for re-suspending and precipitating after finishing the centrifugal washing step, wherein 6.5 mu L of gold-marked 4-CPAOZ-BSA is added into one tube, the other tube is used as a blank control, and the color development condition of the T line of the two test strips is compared and recorded. A proper amount of PBST buffer containing 6.5 mu L of gold-labeled 4-CPAOZ-BSA is added to the blank control test strip later, and the color development of the test strip T line is compared and recorded. As shown in the test result in FIG. 12, the strip does not appear on the C line of the test strip without the gold-labeled 4-CPAOZ-BSA, the color development of the T line is shallower than that of the test strip with the gold-labeled 4-CPAOZ-BSA, and the fact that the gold-labeled 4-CPAOZ-BSA can be combined with the gold-labeled modified antibody is verified, and the color development of the T line is enhanced. Later, the test strip without adding the gold-labeled 4-CPAOZ-BSA is supplemented with the same amount of the gold-labeled 4-CPAOZ-BSA, the T line color development of the test strip is enhanced compared with the prior test strip, the C line also shows a remarkable strip, and the good combination of the gold-labeled 4-CPAOZ-BSA and the C line coated anti-4-CPAOZ-BSA antibody is verified.
5.2 test strip sensitivity test
Coli O157: h7 dilution to 10 8 —10 1 And (3) setting blank control at the same time at different concentrations of CFU/mL, setting 3 repetitions of each concentration, operating according to the test strip using method, and judging whether the test strip is positive according to the color development result of the test strip. As shown in FIG. 13A, the test strip was 10 5 The T line has a distinct band at a CFU/mL concentration of 10 4 No significant banding occurs on the T-line at CFU/mL concentrations. To search for the minimum limit of detection, E.coli O157: H7 was diluted to 5X 10 4 、2.5×10 4 、10 4 CFU/mL, etc., each concentration was tested 10 times. The results are shown in FIG. 14, at 5X 10 4 And 2.5X10 4 All showed positive in CFU/mL condition, but 10 4 The CFU/mL was not completely positive, so the minimum reliable detection limit was 2.5X10 4 CFU/mL. As shown in FIG. 13B, the detection limit of the test strip method constructed by using the common antibody can only reach 10 6 CFU/mL, and there is a phenomenon of clogging on the sample addition pad and NC membrane。
5.3 test strip specificity test
And (3) carrying out step A: coli O157: H7 ATCC31350, B: coli O111 CVCC1450, C: coli O26 CVCC1540, D: salmonella typhimurium ATCC14028, E: salmonella choleraesuis BNCC186354, F: staphylococcus aureus ATCC29523, G: vibrio parahaemolyticus ATCC33847, H: listeria monocytogenes cic 21662, I: enterobacter sakazakii cic 21550, J: diluting 9 strains of food-borne pathogenic bacteria such as sterile PBST buffer solution to 10 7 CFU/mL, use 10 6 CFU/mL E.coli O157: H7 and sterile PBST buffer were used as positive and negative controls, respectively, and 3 replicates were set for each group, and tested according to the CLEIA procedure described above, while ELISA was used for comparison. As a result of the test, as shown in FIG. 15, 10 was added 6 The test strip T line of CFU/mL and escherichia coli O157:H7 has obvious bands, and 10 is added 7 No obvious strip appears on the T line of the test strip of CFU/mL other bacteria, and no obvious strip appears on the blank control test strip added with PBS, which indicates that the method has good specificity.
5.4 analog sample detection
The method comprises the steps of adding escherichia coli O157 into sterile milk: h7 is added into 225mL of liquid LB culture medium to make the concentration of the milk be 1CFU/mL, 25mL of the milk is taken, the mixture is fully mixed, and the mixture is placed on a shaking table to be cultured at 37 ℃ and 180r/min in a shaking way. Every 2 hours, 1mL of the bacterial liquid was centrifuged at 10000r/min for 5min at 4℃and the supernatant was discarded, and the pellet was resuspended in 100. Mu.L of 1% BSA in PBST buffer, and the procedure was performed as described above for the test strip, verifying the time required for the test of the simulated sample. As a result of the test, as shown in FIG. 16, when the milk sample was cultured for 10 hours in advance, a positive band was observed by the test with the test strip. Compared with classical plate separation and physiological and biochemical identification, the time for pre-enrichment treatment is greatly shortened.
SEQUENCE LISTING
<110> Shanghai veterinary institute of agricultural sciences of China (center for sea division of China center for animal health and epidemiology)
<120> a method for detecting bacteria using a colloidal gold test strip containing bispecific antibody
<130> P19015414C
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 385
<212> DNA
<213> Artificial Sequence
<220>
<223> cDNA sequence of antibody heavy chain variable region mRNA against 4-CPAOZ
<400> 1
tatggccgag gtcaaactgc aggagtctgg agatgatctg gtaaagcctg gggcctcagt 60
gaagctgtcc tgcaaggctt ctggctacac cttcaccagc tactggatta actggataaa 120
acagaggcct ggacagggcc ttgagtggat aggacgtatt tctcctggaa gtggtagtac 180
ttactacaat gaaatgttca agggcaaggc aacactgact gtagacacat cctccagcac 240
agcctacatt cagctcagca gcctgtcatc tgaggactct gctgtctatt tctgtgcaat 300
cctctatgat ggttactacg tggactatgc tatggactac tggggtcaag gaaccacggt 360
caccgtctcc tcaggtggag gcggt 385
<210> 2
<211> 385
<212> DNA
<213> Artificial Sequence
<220>
<223> anti-E.coli O157: cNA sequence of H7 antibody heavy chain variable region mRNA
<400> 2
taccgcctcc acctgaggag acggtgaccg tggttccttg accccagtag tccatagcat 60
agtccacgta gtaaccatca tagaggattg cacagaaata gacagcagag tcctcagatg 120
acaggctgct gagctgaatg taggctgtgc tggaggatgt gtctacagtc agtgttgcct 180
tgcccttgaa catttcattg tagtaagtac taccacttcc aggagaaata cgtcctatcc 240
actcaaggcc cagtccaggc ctctgtttta tccagttaat ccagtagctg gtgaaggtgt 300
agccagaagc cttgcaggac agcttcactg aggccccagg ctttaccaga tcatctccag 360
actgctgcag ttgcacctcg gccat 385
<210> 3
<211> 327
<212> DNA
<213> Artificial Sequence
<220>
<223> cDNA sequence of antibody light chain variable region mRNA against 4-CPAOZ
<400> 3
gtggcggatc ggacatcgag ctcactcagt ctccagcaat catgtctgca tctctagggg 60
aggagatcac cctaacctgc agtgccagct cgagtgtaag ttacatgcac tggtaccagc 120
agaagtcagg cacctctccc aaactcttga tttatagcac atccaacctg gcttctggag 180
tcccttctcg cttcagtggc agtgggtctg ggacctttta ttctctcaca atcagcagtg 240
tggaggctga agatgctgcc gattattact gccatcagtg gagtagttat cacgttcggt 300
gctggcacaa agctggagat caaacgg 327
<210> 4
<211> 345
<212> DNA
<213> Artificial Sequence
<220>
<223> anti-E.coli O157: cNA sequence of H7 antibody light chain variable region mRNA
<400> 4
tccgtttgat ttccaacttt gtgccccctc cgaacgtgta agctccctaa tgtgctgaca 60
gtaataggtt gcagcatcct cctcctccac aggatggatg ttgagggtga agtctgtccc 120
agacccactg ccactgaacc tggcagggac cccagattct aggttggata caagatagat 180
gaggagtctg ggtggctgtc ctggtttctg ttggttccag tgcatataac tatagccaga 240
tgtactgaca cttttgctgg ccctgtatga gatggtggcc ctctgcccca gagatacagc 300
taaggaagca ggagactgag tgagctcaat gtccgatccg ccacc 345
<210> 5
<211> 385
<212> DNA
<213> Artificial Sequence
<220>
<223> cDNA sequence of heavy chain variable region mRNA of monoclonal antibody against 4-CPAOZ
<400> 5
tatggccgag gtgcagctgc aggagtctgg agatgatctg gtaaagcctg gggcctcagt 60
gaagctgtcc tgcaaggctt ctggctacac cttcaccagc tactggatta actggataaa 120
acagaggcct ggacagggcc ttgagtggat aggacgtatt tctcctggaa gtggtagtac 180
ttactacaat gaaatgttca agggcaaggc aatactgact gtagacacat cctccagcac 240
agcctacatt cagctcagca gcctgtcatc tgaggactct gctgtctatt tctgtgcaat 300
cctctatgat ggttactacg tggactatgc tatggactac tggggtcaag gaaccacggt 360
caccgtctcc tcaggtggag gcggt 385
<210> 6
<211> 344
<212> DNA
<213> Artificial Sequence
<220>
<223> cDNA sequence of monoclonal antibody light chain variable region mRNA against 4-CPAOZ
<400> 6
tccgtttgag ctccaacttg gtgccccctc cgaacgtgta agctccctaa tgtgctgaca 60
gtaataggtt gcagcatcct cctcctccac aggatggatg ttgagggtga agtctgtccc 120
agacccactg ccactgaacc tggcagggac cccagattct aggttggata caagatagat 180
gaggagtctg ggtggctgtc ctggtttctg ttggttccag tgcatataac tatagccaga 240
tgtactgaca cttttgctgg ccctgtatga gatggtggcc ctctgcccca gagatacagc 300
taaggaagca ggagactgag tgagctcaat gtccgatccg ccac 344
Claims (15)
1. A method for detecting bacteria using a colloidal gold test strip containing bispecific antibodies, comprising the steps of:
(1) Reacting bacteria to be detected with the colloidal gold marked by the bispecific antibody to obtain a bacteria-bispecific antibody colloidal gold compound;
(2) Purifying the bacterial-bispecific antibody colloidal gold complex and dissolving the bacterial-bispecific antibody colloidal gold complex in a solution containing colloidal gold marked by a small molecule hapten-carrier conjugate and a carrier to obtain a sample loading solution;
(3) The sample liquid is dripped on the colloidal gold test strip to react;
wherein one antigen binding site of the bispecific antibody binds to the bacteria to be tested and the other antigen binding site binds to the small molecule hapten-carrier conjugate;
the method is for non-diagnostic purposes;
the bispecific antibody comprises a heavy chain variable region and a light chain variable region, the nucleic acid sequences for encoding the heavy chain variable region are respectively shown in SEQ ID NO. 1 and SEQ ID NO. 3, and the nucleic acid sequences for encoding the light chain variable region are respectively shown in SEQ ID NO. 2 and SEQ ID NO. 4.
2. The method of claim 1, wherein the bispecific antibody comprises a Fab 1 -Fc-Fab 2 Structure is as follows.
3. The method of claim 1, wherein the bacteria to be tested are gram-negative bacteria and/or the small molecule hapten-carrier conjugate is 4-CPAOZ.
4. A method according to claim 3, wherein the gram negative bacteria is e.
5. The method of claim 4, wherein the E.coli is E.coli O157.
6. The method of claim 5, wherein the escherichia coli O157 is escherichia coli O157: H7.
7. the method of claim 3, wherein the carrier in the small molecule hapten-carrier conjugate is BSA or OVA.
8. The method of claim 3, wherein the small molecule hapten-carrier complex is 4-CPAOZ-BSA and the test bacteria is escherichia coli O157: H7.
9. the method of claim 1, wherein the bispecific antibody is prepared by the following method:
preparing 4-CPAOZ-BSA as a complete antigen by taking AOZ as a raw material, and preparing immune spleen cells secreting an anti-4-CPAOZ-BSA antibody by using the complete antigen;
preparing an inactivated escherichia coli O157:H27 bacterial antigen, preparing an immune spleen cell resisting the escherichia coli O157:H27 bacterial antigen by using the inactivated escherichia coli O157:H27 bacterial antigen, and preparing a hybridoma cell resisting the escherichia coli O157:H27 bacterial antigen by using the immune spleen cell;
fusing the immune spleen cells secreting the anti-4-CPAOZ-BSA antibody and the hybridoma cells resisting the escherichia coli O157:H7 bacterial antigen to obtain the hybridoma cells secreting the bispecific antibody, and extracting the bispecific antibody from the peritoneal fluid of the mice injected with the hybridoma cells secreting the bispecific antibody.
10. The method according to any one of claims 1 to 9, characterized in that said steps are in particular:
separating bacteria from a sample to be detected, adding the bispecific antibody labeled colloidal gold into the separated bacteria, and separating and purifying the obtained bacteria-bispecific antibody colloidal gold complex after reaction;
dissolving the bacterial-bispecific antibody colloidal gold complex in a PBST buffer solution containing the small molecule hapten-carrier conjugate to obtain a sample loading solution of the colloidal gold test strip;
and (3) dripping the sample liquid onto the colloidal gold test strip to react.
11. The method of claim 10, wherein the method of separation is centrifugation.
12. The method of claim 10, wherein the step of purifying is repeated;
and/or the test strip comprises a detection line and a quality control line, wherein the detection line is coated with the antibody resisting the bispecific antibody, and the quality control line is coated with the antibody resisting the small molecule hapten.
13. A bispecific antibody, comprising a heavy chain variable region and a light chain variable region, wherein the nucleic acid sequences encoding the heavy chain variable region are shown in SEQ ID NOs 1 and 3, respectively, and the nucleic acid sequences encoding the light chain variable region are shown in SEQ ID NOs 2 and 4, respectively.
14. The bispecific antibody of claim 13, wherein said bispecific antibody comprises a Fab 1 -Fc-Fab 2 Structure is as follows.
15. Use of a bispecific antibody according to claim 13 or 14 for the preparation of a colloidal gold test strip for the detection of bacteria.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011146123.8A CN112415204B (en) | 2020-10-23 | 2020-10-23 | Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011146123.8A CN112415204B (en) | 2020-10-23 | 2020-10-23 | Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112415204A CN112415204A (en) | 2021-02-26 |
| CN112415204B true CN112415204B (en) | 2023-10-13 |
Family
ID=74841983
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011146123.8A Active CN112415204B (en) | 2020-10-23 | 2020-10-23 | Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112415204B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113311156B (en) * | 2021-04-09 | 2022-11-29 | 深圳市计量质量检测研究院（国家高新技术计量站、国家数字电子产品质量监督检验中心） | Preparation method and application of combined detection card for milk protein and goat milk protein |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1948965A (en) * | 2006-09-01 | 2007-04-18 | 河南省农业科学院生物技术研究所 | Gold chromatography detecting test paper strip of furanzoleone metabolite colloid and test paper card thereof |
| CN101955940A (en) * | 2010-09-03 | 2011-01-26 | 付建芳 | Gene sequence of variable regions of anti-vibrio alginolyticus idiotype monoclonal antibody |
| CN103792362A (en) * | 2014-01-22 | 2014-05-14 | 上海理工大学 | Immune colloidal gold rapid detection test strip for enterohemorrhagic E.col O157:H7 |
| CN105899540A (en) * | 2014-01-03 | 2016-08-24 | 豪夫迈·罗氏有限公司 | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
| CN106380520A (en) * | 2016-10-21 | 2017-02-08 | 河北省科学院生物研究所 | Furazolidone-metabolite-resistant monoclonal antibody and application thereof |
| CN109734803A (en) * | 2018-12-28 | 2019-05-10 | 江苏众红生物工程创药研究院有限公司 | Anti-human MYO antibody and its application in detection kit |
| CN109796531A (en) * | 2017-11-15 | 2019-05-24 | 中国农业科学院上海兽医研究所 | Pig Delta coronavirus N protein monoclonal antibody and its epitope and application |
| CN110357960A (en) * | 2018-04-10 | 2019-10-22 | 广州爱思迈生物医药科技有限公司 | Antibody and antibody remodeling method |
| CN110540602A (en) * | 2019-08-28 | 2019-12-06 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Toxoplasma gondii surface antigen GRA1 and GRA7 recombinant protein colloidal gold test strip |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2595682A1 (en) * | 2005-01-31 | 2006-08-03 | Ablynx N.V. | Method for generating variable domain sequences of heavy chain antibodies |
-
2020
- 2020-10-23 CN CN202011146123.8A patent/CN112415204B/en active Active
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1948965A (en) * | 2006-09-01 | 2007-04-18 | 河南省农业科学院生物技术研究所 | Gold chromatography detecting test paper strip of furanzoleone metabolite colloid and test paper card thereof |
| CN101955940A (en) * | 2010-09-03 | 2011-01-26 | 付建芳 | Gene sequence of variable regions of anti-vibrio alginolyticus idiotype monoclonal antibody |
| CN105899540A (en) * | 2014-01-03 | 2016-08-24 | 豪夫迈·罗氏有限公司 | Bispecific anti-hapten/anti-blood brain barrier receptor antibodies, complexes thereof and their use as blood brain barrier shuttles |
| CN103792362A (en) * | 2014-01-22 | 2014-05-14 | 上海理工大学 | Immune colloidal gold rapid detection test strip for enterohemorrhagic E.col O157:H7 |
| CN106380520A (en) * | 2016-10-21 | 2017-02-08 | 河北省科学院生物研究所 | Furazolidone-metabolite-resistant monoclonal antibody and application thereof |
| CN109796531A (en) * | 2017-11-15 | 2019-05-24 | 中国农业科学院上海兽医研究所 | Pig Delta coronavirus N protein monoclonal antibody and its epitope and application |
| CN110357960A (en) * | 2018-04-10 | 2019-10-22 | 广州爱思迈生物医药科技有限公司 | Antibody and antibody remodeling method |
| CN109734803A (en) * | 2018-12-28 | 2019-05-10 | 江苏众红生物工程创药研究院有限公司 | Anti-human MYO antibody and its application in detection kit |
| CN110540602A (en) * | 2019-08-28 | 2019-12-06 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Toxoplasma gondii surface antigen GRA1 and GRA7 recombinant protein colloidal gold test strip |
Non-Patent Citations (3)
| Title |
|---|
| Application of bispecific antibody against antigen and hapten for immunodetection and immunopurification;Hyori Kim等;《Experimental & Molecular Medicine》;第1-7页 * |
| 双特异性抗体及其在肿瘤诊治上的研究进展;李康;《医学分子生物学杂志》;第233-235页 * |
| 呋喃唑酮代谢物AOZ的抗体制备及初步应用;李子颖等;《食品科技》;第38卷(第4期);第309-312、316页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112415204A (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2346673T5 (en) | Process to obtain antibodies | |
| WO2022166354A1 (en) | Anti-oxa-23 type carbapenase hybridoma cell line, monoclonal antibody, and application | |
| CN112415204B (en) | Method for detecting bacteria by using colloidal gold test strip containing bispecific antibody | |
| US9052314B2 (en) | Biomarkers for detecting the presence of bacteria | |
| CN116042532A (en) | Mouse anti-NDM carbapenemase hybridoma cell strain, monoclonal antibody and application | |
| CN109971726B (en) | Hybridoma cell strain, antibody produced by hybridoma cell strain and preparation method of antibody | |
| AU2021104199A4 (en) | Rapid immunoassay test strip for Ralstonia solanacearum and preparation method and application thereof | |
| CN105132282B (en) | Campylobacter jejuni immuno-PCR detection kit | |
| CN113583119A (en) | Anti-staphylococcus aureus nanobody Nb56, application and kit | |
| CN113150122A (en) | Preparation method of high-throughput whole rabbit-derived monoclonal antibody | |
| CN114085289B (en) | Construction method and application of semisynthetic single-domain antibody library | |
| CN116003606B (en) | TIGIT nano antibody and preparation method and application thereof | |
| CN115724982B (en) | Monoclonal antibody for detecting adulterated common cow milk in buffalo milk, and preparation method and application thereof | |
| CN117088977B (en) | Canine C reactive protein monoclonal antibody, detection test strip and application | |
| CN114277001B (en) | Hybridoma cell strain secreting anti-alpha-conotoxin monoclonal antibody and application thereof | |
| CN116948032B (en) | Humanized CD4 monoclonal antibody and preparation method and application thereof | |
| Schots et al. | Production of monoclonal antibodies | |
| CN117701508A (en) | Hybridoma cell strain secreting specific antibody, erythrocyte B antibody and application | |
| CN117801102A (en) | Cat serum amyloid A monoclonal antibody, detection test strip and application | |
| RU2425874C1 (en) | CULTIVATED HYBRID CELL STRAIN OF Mus musculus L ANIMALS - PRODUCER OF MONOCLONAL ANTIBODIES SPECIFIC TO O-ANTIGENE OF CHOLERA VIBRIO SEROGROUP O1 | |
| CN116003583A (en) | Monoclonal antibody and immunodetection reagent for novel coronavirus Omicron mutant RBD protein | |
| CN117451988A (en) | Bovine rotavirus signal enhanced colloidal gold immunochromatography test strip and preparation method and application thereof | |
| CN116121198A (en) | Hybridoma cell strain secreting anti-human M blood group antigen IgG1 monoclonal antibody and application | |
| CN116925211A (en) | Salmonella typhimurium-resistant antibody, immunomagnetic beads marked by Salmonella typhimurium-resistant antibody and application of salmonella typhimurium-resistant antibody | |
| CN116284370A (en) | Multimeric glycosylated hemoglobin monoclonal antibody and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |