CN109971726B

CN109971726B - Hybridoma cell strain, antibody produced by hybridoma cell strain and preparation method of antibody

Info

Publication number: CN109971726B
Application number: CN201910201070.6A
Authority: CN
Inventors: 刘卫晓; 金芜军; 张哲�; 高进; 董美; 王迪
Original assignee: Biotechnology Research Institute of CAAS
Current assignee: Biotechnology Research Institute of CAAS
Priority date: 2019-03-18
Filing date: 2019-03-18
Publication date: 2021-09-28
Anticipated expiration: 2039-03-18
Also published as: CN109971726A; CN113481170A

Abstract

The invention discloses hybridoma cell strains 1D 111A 5 and 2G41B8, antibodies generated by the hybridoma cell strains and a preparation method of the antibodies. The hybridoma cell strain is preserved in China general microbiological culture Collection center on 11-08 th month in 2018 with the preservation numbers of CGMCC No.16696 and CGMCC No. 16695. The indirect ELISA titer of the antibody obtained by purifying the ascites of the monoclonal antibody secreted by the cell strain is 1:768000 and 1:640000 respectively, the antibody subtypes are IgG2a and IgG1 respectively, the monoclonal antibody can specifically identify the prokaryotic expression recombinant Cry2A protein and the endogenous Cry2A protein in the transgenic rice, and the monoclonal antibody provides material and technical support for the detection of the protein in the transgenic rice.

Description

Hybridoma cell strain, antibody produced by hybridoma cell strain and preparation method of antibody

Technical Field

The invention relates to the technical field of bioengineering, in particular to hybridoma cell strains 1D 111A 5 and 2G41B8, antibodies generated by the hybridoma cell strains and a preparation method of the antibodies.

Background

Bacillus thuringiensis (Bt) is a widely existing gram-positive bacterium, and the insect-resistant crystal protein secreted by the bacterium is the main biopesticide at present; secreted insect-resistant proteins are divided into two classes according to amino acid sequence similarity: cry and Cry delta-endotoxins. Wherein the Cry proteins are toxic to larvae of a variety of insect pests (e.g., lepidoptera, diptera, coleoptera, nematodes, protists, and the like). Cry toxins have been transferred into crops to render them insect resistant. The Cry2A protein is one of the Cry toxins. The crops of the forward rotation Cry gene mainly comprise corn, potato, rice, cotton and the like.

The development and progress of transgenic technology has promoted the development of biology. The transgenic food can meet the requirements of people on yield, insect resistance and the like, but also brings potential threats to human life, for example, after some genes are introduced into a host, the food generates toxicity, the transgenic food generates allergens, people generate drug resistance, the nutritional value of the food is changed, and the like. When the research and the development and the commercialization of the transgenic food are carried out, in order to comprehensively evaluate the safety of the transgenic food, a consumer can rapidly distinguish the transgenic food from the natural food, and a proper method is established for identifying and detecting the transgenic ingredients in the transgenic food, so that the safety management of agricultural transgenic organisms can be promoted, the safety of people, animals and microorganisms can be guaranteed, the ecological environment can be protected, and the further research of the agricultural transgenic biotechnology can be promoted. In order to carry out rapid quantitative or qualitative analysis on the Cry2A protein in the transgenic rice or the derivatives thereof, the research and the obtaining of the monoclonal antibody against the Cry2A protein have great significance.

Disclosure of Invention

The invention aims to provide hybridoma cell strains 1D 111A 5 and 2G41B8, antibodies generated by the hybridoma cell strains and a preparation method of the antibodies, and monoclonal antibodies secreted by the hybridoma cell strains lay a foundation for realizing qualitative and quantitative detection of an insect-resistant protein Cry2A in transgenic rice.

In order to achieve the purpose, the invention provides a preparation method of a hybridoma cell strain, which comprises the following steps:

a) obtaining Cry2A recombinant protein through prokaryotic expression;

b) immunizing animals: cry2A recombinant protein is used as an antigen to immunize a BALB/c mouse;

c) cell fusion: collecting splenocytes from immunized BALB/c mice and fusing with SP2/0 cells;

d) cell establishment: subcloning by a limiting dilution method, and carrying out ELISA detection by subcloning for 5-7 days until hybridoma cell strains which stably secrete positive antibodies are screened out for amplification, re-culture and storage.

Preferably, the fusion ratio of mouse spleen cells to SP2/0 cells is 1:5-1: 10.

The invention also provides hybridoma cell strains prepared by the preparation method, which comprise hybridoma cell strains 1D 111A 5 and hybridoma cell strains 2G41B8, and are sequentially preserved in China general microbiological culture Collection center on 11 months and 08 days in 2018, wherein the preservation addresses are as follows: xilu No.1 Hospital No. 3, Beijing, Chaoyang, North. And E, postcode: 100101, and the preservation numbers are CGMCC No.16696 and CGMCC No.16695 in sequence.

The invention also provides the monoclonal antibody produced by the hybridoma cell strain, the biological preservation number of the hybridoma cell strain 1D 111A 5 is CGMCC No.16696, and the biological preservation number of the hybridoma cell strain 2G41B8 is CGMCC No. 16695.

The types of monoclonal antibodies produced by hybridoma cell line 1D 111A 5 and hybridoma cell line 2G41B8 are IgG2a and IgG1, respectively.

The titers of the monoclonal antibodies generated by the hybridoma cell line 1D 111A 5 and the hybridoma cell line 2G41B8 detected by indirect ELISA are 1:768000 and 1:640000 in sequence.

The invention also provides a preparation method of the monoclonal antibody, which comprises the steps of inoculating the hybridoma cell strain into the abdominal cavity of a mouse to prepare ascites, and then purifying by a Protein A-agarose affinity chromatography column to obtain the monoclonal antibody.

The invention also provides application of the monoclonal antibody in detection of Cry2A insect-resistant protein.

The invention also provides application of the monoclonal antibody in preparation of a reagent for detecting Cry2A insect-resistant protein by an ELISA method.

The invention also provides application of the monoclonal antibody in preparation of a reagent for detecting Cry2A insect-resistant protein by an ELISA double-antibody sandwich method.

Compared with the prior art, the invention has the following beneficial effects: the application utilizes high-purity insect-resistant protein Cry2A obtained by expression and purification of engineering strains as an antigen, and 2 hybridoma cell strains 1D 111A 5 and 2G41B8 which secrete specific and sensitive monoclonal antibodies of Cry2A are prepared by a hybridoma technology, the indirect ELISA titers of antibodies obtained by purifying ascites of monoclonal antibodies secreted by the cell strains are respectively 1:768000 and 1:640000, the antibody subtypes are IgG2a and IgG1, the monoclonal antibodies can specifically identify the recombinant Cry2A protein expressed by pronucleus and the endogenous Cry2A protein in transgenic rice, and the construction of mouse monoclonal antibody hybridoma cell strains secreting Cry2A insect-resistant protein provides material and technical support for detection of the protein in the transgenic rice.

Drawings

FIG. 1 is a Cry2A recombinant protein SDS-PAGE result.

FIG. 2 is a result chart of screening of western by Cry2A recombinant protein monoclonal antibody.

FIG. 3 is a SDS-PAGE result of the purified monoclonal antibodies of hybridoma cell lines 1D 111A 5 and 2G41B 8.

FIG. 4 shows the titer of monoclonal antibody produced by hybridoma cell line 1D 111A 5.

FIG. 5 shows the titer of monoclonal antibodies produced by hybridoma cell line 2G41B 8.

FIG. 6 is a Western result chart of Cry2A recombinant protein and Cry2A in transgenic rice detected by the specificity of monoclonal antibody generated by hybridoma cell strain 1D 111A 5.

FIG. 7 is a Western result chart of Cry2A recombinant protein and Cry2A in transgenic rice detected by monoclonal antibody specificity generated by hybridoma cell line 2G41B 8.

Detailed Description

The following detailed description of the present invention is provided in conjunction with the accompanying drawings, but it should be understood that the scope of the present invention is not limited to the specific embodiments.

The experimental procedures used in the following examples are conventional ones unless otherwise specified, and materials, reagents and the like used therein are commercially available.

EXAMPLE 1 hybridoma cell acquisition and preparation of monoclonal antibodies thereto

1. Preparation of immune antigens

1.1 recombinant protein Cry2A expression strain construction, thallus culture and lysis

Cry2A encodes gene amplification: transgenic rice T1C-19 genome DNA is used as a template, Cry2A-NdeI-F: catatgaacaacgtgctgaacagc and Cry2A-XhoI-R: ctcgagttagtagagtggcggcag are used as primers, high-fidelity Fastpfu is used for PCR amplification, amplified PCR products are identified by (1.0%) agarose gel electrophoresis, target band gel cutting is recovered, a Universal DNA purification recovery kit (Tiangen) is used for recovery, the recovered products are subjected to enzyme digestion by restriction enzymes Nde I and XhoI, gel recovery and pET28a plasmid fragments subjected to the same enzyme digestion and gel recovery treatment are connected at 4 ℃ overnight, Tranns 10 competent cells (Beijing holotype gold) are transformed, clones are selected for colony PCR identification, and positive clones are sequenced by Beijing Liuhe Huada gene company.

Coli BL21(DE3) competent cells transformed with the correctly identified recombinant expression vector pET28a-Cry2A were plated on LB plates containing kanamycin (50. mu.g/mL) and cultured overnight at 37 ℃. The next day, a single clone was picked from the plate and inoculated into liquid LB medium containing the same concentration of kanamycin, and cultured overnight at 37 ℃. The obtained expression strain bacterial liquid and a 50% glycerol solution are mixed uniformly in equal volume and are frozen and stored at the temperature of minus 80 ℃.

The stored recombinant protein Cry2A expression strain is subjected to recovery culture, and the bacterial liquid is spread on an LB plate containing kanamycin (50 mu g/mL) and cultured overnight at 37 ℃. Single colonies were picked and inoculated in liquid LB (kanamycin 50. mu.g/mL) medium overnight at 37 ℃. The next day, the cells were inoculated at 1% inoculum size and cultured at 37 ℃ to OD₆₀₀About 0.8, 1mM IPTG was added to induce protein expression overnight at 16 ℃. After induction, the bacterial liquid is subjected to ice bath, the bacterial liquid is centrifuged at 4000rpm for 10min at 4 ℃, the thalli is collected, the supernatant is discarded, and the thalli is washed by PBS and then suspended by lysis solution (50mM Tris pH7.5, 300mM NaCl, 5% Glycerol and 20mM imidazole); sonication (2s on/4s off, Amp: 45%, Time: 3 m)in); centrifuging at 15000rpm for 1hr at 4 deg.C, and collecting supernatant.

1.2 recombinant protein purification

Mixing the supernatant of the thallus lysate with Ni Sepharose 6FF Beads (GE Healthcare) balanced by the lysate, combining for 2-3hrs at 4 ℃, centrifuging at 3000rpm for 3min, and discarding the supernatant; ni Sepharose 6FF beads bound to protein were washed 2-3 times with a wash solution (50mM Tris pH7.5, 300mM NaCL, 5% Glycerol and 50mM imidazole); then eluted with an eluent (50mM Tris pH7.5, 300mM NaCL, 5% Glycerol and 200mM imidazole). Collecting the eluent to obtain the crude pure protein solution.

The protein sample obtained by affinity purification is dialyzed to a protein storage solution (50mM Tris pH7.5, 300mM NaCl, 5% Glycerol), and further purified by Superdex 200 Incase 10/30GL (GE healthcare) equilibrated by the same solution, the protein peak components are collected and the purity of the protein sample is detected by SDS-PAGE, which can be obtained by figure 1, and finally the electrophoretically pure Cry2A protein with the molecular weight of about 70kDa is obtained by gel filtration.

2. Immunizing animals

Using Cry2A recombinant protein qualified by quality control in the step 1.2 as antigen to immunize 8 SPF-grade BALB/c female mice (purchased from the research center of experimental animals in Hubei province, with the license number of SCXK (Eo) 2015-0018), mixing the antigen with equal volume of complete Freund's adjuvant (prime) and incomplete Freund's adjuvant (boost) and emulsifying, fully mixing until the water-in-oil state is used for subcutaneous multipoint immunization, carrying out 2-3 times of boost immunization, carrying out 2 weeks at each immunization interval, then carrying out titer detection, carrying out abdominal cavity impact within 1 week after the period is more than 1:10000, directly dissolving the antigen of immunization dose into 250 mu L PBS, wherein the specific immunization times and immunization dose are shown in Table 1:

TABLE 1 immunization times and immunization doses

Immunization example: in one immunization, 50ug of antigen was dissolved in PBS and then mixed with adjuvant at 1:1 volume.

3. Cell fusion

Collecting positive control blood 3 days after the last impact, taking spleen, and preparing into single cell suspension; treating SP2/0 cells at log phase, mixing with splenocytes at a certain ratio (1:5-1:10), allowing 50% PEG1450 to act for 1min, diluting with basal medium DMEM, centrifuging at low speed, gently suspending in HAT medium containing 20% fetal calf serum, mixing, and making into suspension at 2 × 10⁷Plating into a prepared feeder cell plate, and placing in 5% CO₂The culture was carried out at 37 ℃.

4. Cell establishment

1) Detecting a fusion plate:

the cells of the fusion plate are detected when the cells of the fusion plate change liquid grow to more than 1 ten thousand cells with medium size, and the ELISA quality control is qualified (namely the negative control OD)₄₅₀<0.2, positive control OD₄₅₀>1.0) followed by selection of positive wells (general OD)₄₅₀Not less than 0.5) as subcloning.

2) Subcloning method and detection:

high detection Positive value (OD) in picked out fusion plate₄₅₀>2.0) is subjected to limited dilution, 60 percent of monoclonal holes in each plate are counted to be used as subclones, the monoclonal holes with higher positive values are selected each time for limited dilution, ELISA detection can be carried out each time for 5-7 days by subcloning, and the monoclonal cell strains capable of stably secreting positive antibodies are screened out to be subjected to expanded culture.

3) Establishing a cell strain:

expanding and culturing cell strains which are screened in a subcloning stage and stably secrete positive antibodies in a 24-well plate, collecting supernatants after expansion for antigen detection, verifying the stability by adopting ELISA gradient dilution and western-blotting, obtaining that monoclonal antibodies secreted by Cry2A monoclonal antibody hybridoma cell strains 1D 111A 5 and 2G41B8 can specifically detect endogenous samples and recombinant proteins Cry2A through a graph 2, collecting cells and expanding the cells in a culture dish with the length of more than 10cm, collecting the supernatants again, detecting the titer of the antibodies in the supernatants, selecting OD (optical density) and screening₄₅₀>2.0 cell lines 2 were cultured on the cellsIn the bottle, the hybridoma cell strain 1D 111A 5 and the hybridoma cell strain 2G41B8 which are frozen are preserved in China general microbiological culture Collection center (CGMCC for short) in 11 and 08 days 2018 in sequence, and the preservation numbers are CGMCC No.16696 and CGMCC No.16695 in sequence.

4) Cell line cryopreservation identification one cell line in the same batch must be recovered for identification after cell line cryopreservation is finished, and the identification standard is as follows:

firstly, resuscitating the number of living cells to be more than or equal to 100 ten thousand cells/branch; ② viable cells in the viable cells are more than or equal to 50 ten thousand per strain; ③ the revived cells can not have other microorganisms (such as bacteria, fungi, mycoplasma, etc.) except the cells of the cell strain; fourthly, after the cells are revived to grow to a certain number, the grown cells are selected to be used as a monoclonal counting plate, and whether the monoclonal antibody secretion ability is full positive or has antibody secretion is detected; fifthly, the cell culture supernatant also needs to be used as ELISA (OD)₄₅₀>2.0) to determine whether positive antibodies are secreted and simultaneously carry out western-blotting identification, and as can be seen from fig. 3, monoclonal antibodies secreted by Cry2A monoclonal antibody hybridoma cell lines 1D 111A 5 and 2G41B8 can specifically detect endogenous samples and recombinant proteins Cry 2A.

5 preparation of ascites

Injecting the mice with pristane or liquid paraffin in the abdominal cavity, inoculating the hybridoma cell strain 1D 111A 5 and hybridoma cell strain 2G41B8 in the abdominal cavity of the two mice after one week, performing cell line determination, performing amplification culture, and selecting 10% fetal calf serum culture medium when the cell density reaches 1 × 10⁶-2×10⁶at/mL, the pellet was collected by centrifugation at 800rpm, resuspended in PBS, and then intraperitoneally injected into mice (liquid paraffin), and after 7 to 10 days, ascites were collected and prepared for purification.

6 antibody purification

The collected ascites is purified by a Protein A-agarose affinity chromatography column after being pretreated, and the method comprises the following specific steps:

1) buffer solution: the starting buffer was pH7.0, 20mM phosphate buffer; the elution buffer was glycine hydrochloride at pH2.70.1 mM.

2) Preparing a collecting pipe: take 1.5mL centrifuge tubes, add 70. mu.L of Tris-HCl pH9.01M to each centrifuge tube.

3) Sample preparation: the resulting sample precipitated with 50% SAS was dialyzed overnight against the starting buffer and filtered through a 0.22 μm microfiltration membrane.

4) And (3) purification process: the Protein A-Sepharose affinity column (HiTrap Protein A1 mL, Pharmacia Biotech) was equilibrated with enough starting buffer (8-10 mL). Taking 15-25mL of a sample to be purified (containing 10.2-21.1mg of protein per milliliter of sample) to load on a column at a flow rate of 0.5mL/min, then sequentially washing with 7-8mL of an initial buffer solution, 6-7mL of an elution buffer solution and 5mL of the initial buffer solution at the same flow rate, and collecting eluent in 1mL of each tube.

5) Purity and Activity identification the purity of the purified monoclonal antibody (McAb) was identified by SDS-PAGE, as shown in FIG. 3, and from FIG. 4, it can be seen that hybridoma cell lines 1D 111A 5 and 2G41B8 monoclonal antibodies were purified to remove almost all of the contaminating proteins, and had 2 specific main bands (55kDa and 30 kDa).

Example 2 subclass identification and potency assay of monoclonal antibodies

The purified monoclonal antibody is subjected to ELISA detection with standard anti-BALB/c mouse IgG1, IgG2a, IgG2b, IgG3 and IgM antibodies of sigma company, and the detection result shows that: the monoclonal antibody type is IgG2b, the recombinant protein Cry2A is used as an antigen, the titer of the purified monoclonal antibody is detected by an indirect ELISA method, and as can be seen from FIG. 4, the titer of the purified 1D 111A 5 monoclonal antibody is 1:768000 by ELISA determination; as can be seen from FIG. 5, the titer of the purified 2G41B8 monoclonal antibody was 1:640000 as determined by ELISA.

TABLE 2 concentration and subtype of monoclonal antibody produced by hybridoma cell line 1D 111A 5

Monoclonal antibody hybridoma cell numbering	Antibody (IgG) concentration	Subtypes of antibodies
			1D11 1A5	3.0mg/mL	IgG2a

TABLE 3 concentration and subtype of monoclonal antibody produced by hybridoma cell line 2G41B8

Monoclonal antibody hybridoma cell numbering	Antibody (IgG) concentration	Subtypes of antibodies
			2G4 1B8	2.5mg/mL	IgG1

Example 3 detection of monoclonal antibody specificity

Respectively extracting endogenous proteins of transgenic rice and transformed parents thereof, running SDS-PAGE gel, using purified monoclonal antibodies (1D 111A 5 and 2G41B 8) as primary antibodies for membrane transformation, using Alexa FlurorTM 680 coat anti-mouse IgG (H + L) (Invitrogen) as secondary antibodies, using an Odyssey-enriched 740image (9120, Li-CORbiosciences, Lincolin, NE) infrared scanner western detection result, and obtaining the purified 1D 111A 5 monoclonal antibody which can specifically identify Cry2A and recombinant protein Cry2A in endogenous samples according to a graph 6; as can be seen from FIG. 7, the purified monoclonal antibody 2G41B8 can specifically recognize Cry2A and the recombinant protein Cry2A in the endogenous sample.

The method for extracting the transgenic rice protein comprises the following steps:

quickly freezing tissue with liquid nitrogen, grinding, adding 1mL (generally 0.5g and 1-2mL) of protein extract, mixing at 4 deg.C for 30 min, (centrifuging at 12,000rpm at 4 deg.C for 15min, collecting supernatant), and making into protein extract with formula shown in Table 4:

TABLE 4 protein extract formula

The foregoing descriptions of specific exemplary embodiments of the present invention have been presented for purposes of illustration and description. It is not intended to limit the invention to the precise form disclosed, and obviously many modifications and variations are possible in light of the above teaching. The exemplary embodiments were chosen and described in order to explain certain principles of the invention and its practical application to enable one skilled in the art to make and use various exemplary embodiments of the invention and various alternatives and modifications as are suited to the particular use contemplated. It is intended that the scope of the invention be defined by the claims and their equivalents.

Claims

1. The hybridoma cell strain is preserved in China general microbiological culture Collection center (CGMCC) on 11 months and 08 days in 2018, and the preservation number is CGMCC No. 16695.

2. The monoclonal antibody produced by the hybridoma cell strain of claim 1, wherein the hybridoma cell strain is inoculated into an abdominal cavity of a mouse to prepare ascites, and then Protein A-agarose affinity chromatography column purification is performed to obtain the monoclonal antibody.

3. Use of the monoclonal antibody of claim 2 for detecting Cry2A insect resistant protein.

4. The use according to claim 3, characterized in that the monoclonal antibody is used for preparing a reagent for detecting Cry2A insect-resistant protein by an ELISA method.