PCR primer combination and detection method for pathogens of citrus yellow dragon disease and yellow vein clearing disease
Technical Field
The invention relates to the field of plant disease detection, in particular to a PCR primer combination and a detection method of citrus yellow dragon disease germs and yellow vein clearing virus.
Background
Orange (Mandarin orange)Citrus reticulata BlancoAlso named as broad-peel orange and yellow orange, the orange is rich in nutrition, has good color, flavor and taste, can be eaten fresh, can be processed into various processed products mainly containing fruit juice, and can be widely planted in the area with the north latitude of less than 35 degrees.
Citrus is susceptible to a variety of diseases, with citrus greening disease and yellow vein clearing disease being the most common.
Huanglongbing is a genus of phloem bacterium (Huanglongbing)Candidatus Liberibacter) The citrus destructive disease caused by the citrus can infect various Rutaceae plants such as citrus, Hovenia, kumquat and Murraya paniculata. The psyllid of citrus and the nursery stock with disease or the scion with disease are the main cause of long-distance disease transmission, a new disease-free area is often changed into a diseased area, the citrus is planted with seedlings by cuttage or grafting for a long time, large-area diseased plants are easy to spread, and for commercial planting, the disease is usually found in the citrus, and only the whole plant can be directly destroyed.
CYVCV is a new member of the genus citrus of the family alphaviridae, and although 80% of plant viral diseases depend on vector insect transmission, no insects have been found that mediate the transmission of the virus between citrus. Once the disease occurs, the disease can be rapidly spread in a short time, the main spreading mode is grafting spreading, the virus spreading efficiency is high, and long-distance spreading of the seedlings with virus can be realized. Therefore, the cultivation of seedlings without CLas and CYVCV diseases and the early discovery of plants with CLas and CYVCV are the key points for the prevention and control of the CLas and CYVCV of the oranges.
Although citrus plants infected by CLas and CYVCV can show obvious characteristics, it is not excluded that plants with good phenotype do not contain CLas and CYVCV, infected plants can show symptoms after incubation periods with different lengths, and when the symptoms are obvious, the control difficulty and economic loss are large. The identification of diseased plant materials at the present stage is difficult, DNA and RNA of a sample to be detected need to be respectively extracted for detecting whether the citrus is infected with yellow dragon disease and yellow vein disease, the detection process is complex, the efficiency is low, and the detection cost is high; in addition, the existing detection technology has high probability of false positive and false negative of the detection result. The method utilizes the PCR technology to carry out the CLas and CYVCV detection, only needs to separately extract the RNA of the sample to be detected for detection, greatly improves the detection efficiency, and shortens the detection time and the detection cost; meanwhile, the design of the CLas and CYVCV specific primers is subjected to double detection, so that the generation of false positive can be eliminated, and the design of the internal reference CtACT specific primer is subjected to detection, so that the generation of false negative in a detection result can be eliminated. At present, although detection research on citrus diseases is more, no report on simultaneous detection of CLas and CYVCV on citrus is found.
Disclosure of Invention
In light of the above-identified deficiencies in the art, the present invention provides primer combinations and assays for detecting citrus CLas and CYVCV. The technical scheme of the invention is as follows:
a strain of Trichosanthes longirostris (Bull. ex Fr.) SingCandidatus Liberibacter asiaticusCLas and yellow vein clearing disease Virus: (Citrus yellow vein clearing virusCYVCV) containing 3 specific primers for the 16s xanthomonas oryzae, and the specific information is as follows:
CLas 16s F118:TTGGAGAGAGATGAGCCTG
CLas 16s R866:AAGGGCTGGTAAGGTTCTG
CLas 16s R958:ACCCAACATCTCACGACAC
3 specific primers of citrus yellow vein clearing virus coat protein, wherein the specific information is as follows:
CYVCV CP F41:CATTTCCACATTACTGCGAG
CYVCV CP F163:AAACAACCACTTCACCCG
CYVCV CP R488:TCTATGTTCAAGATGCGGAC
the specific primers of the 2 citrus universal reference gene CtACT have the following specific information:
CtACT F460:GATCATATGGAGGTGCTATCAC
CtACT R580:TGAAGATGGTTCAGCAAGTAG
a method for simultaneously detecting pathogenic bacteria of citrus huanglongbing and yellow vein clearing virus by using the primer combination comprises the following steps:
(1) extracting total RNA of a sample to be detected, and performing reverse transcription to obtain cDNA.
(2) The primer combination of claim 1 is adopted, and cDNA of a sample to be detected is taken as a template to carry out PCR reaction, so as to obtain an amplification product.
(3) Detecting 1-6 microliter of amplification product by 1% agarose electrophoresis, if positive bands with the sizes of 840 bp, 748 bp, 447 bp, 325 bp or 120 bp appear at the same time, indicating that the sample cDNA can be used and contains CLas and CYVCV at the same time; if a positive band with the size of 840 bp, 748 bp or 120 bp appears, the sample cDNA is available and contains the CLas; if positive bands with the size of 447 bp, 325 bp or 120 bp appear, the sample cDNA is available and contains CYVCV; if only 120 bp is present, it indicates that the sample cDNA is available, but CLas and CYVCV are not detected.
The PCR reaction system is 20 mu L and comprises: mu.L of cDNA template, 1. mu.L of each of different upstream and downstream primers, 10. mu.L of 2 XTaq PCR Mix reaction solution, and ddH2O to a total volume of 20. mu.L.
In the PCR system, primers can be used for detecting the citrus CLas by using CLas16s specific primers, namely CLas16s F118, CLas16s R866, and CLas16s R958 as a combination, CyVCV coat protein specific primers, namely CYVCV CP F41, CYVCV CP F163 and CYVCV CP R488, for detecting citrus CYVCV, and reference primers, namely CtACT F460 and CtACT R580, for detecting the quality of passion fruit cDNA; CLas16s F118, CLas16s R866, CLas16s R958, CYVCV CP F41, CYVCV CP F163, CYVCV CP R488, CtACT F460 and CtACT R580 are combined to simultaneously detect the quality of the synthesis of the citrus CLas, the citrus CYVCV and the cDNA (FIG. 1). The above primer combinations can be selected according to actual needs.
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 45 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 10 min and final storage at 4 ℃.
The invention has the advantages that:
according to the invention, 3 CLas and CYVCV specific primers are designed from the conserved regions of the sequence of the CLas and CYVCV coding genes respectively to form 4 pairs of primer combinations, so that the elimination effect on false positive amplification products (figure 1) can be generated while the specific detection on the CLas and CYVCV of the citrus is improved, the cDNA synthesis quality can be detected by increasing the design 1 on the CtACT primer for citrus internal reference, and the elimination effect on false negative amplification products (figure 1) can be generated. The detection method can detect that the sensitivity of the citrus CLas and the CYVCV is equivalent to 10-5 g diseased leaf tissue (50 ng diseased leaf RNA), namely CLas, CYVCV and CtACT specific bands can be amplified after the sample template is diluted by 10000 times, and CYVCV specific bands can be amplified after the sample cDNA is diluted by 100000 times (figure 2).
Drawings
FIG. 13 shows the amplification effect of the CLas and 3 CYVCV-specific primers each consisting of 2 primer sets and 1 pair of reference gene CtACT. 1 to 5 are each H2O is template, contains CLas, CYVCV, CLas, CYVCV and internal reference CtACT, and M is DNA Marker 2000.
FIG. 2 shows the amplification effect of 1-6 times of cDNA to 100000 times of diluted solution, where M is DNA Marker 2000.
FIG. 3 Citrus leaf test. 3-A is healthy citrus leaf, 3-B is citrus leaf containing CLas, 3-C is citrus leaf containing CYVCV, and 3-D is citrus leaf containing both CLas and CYVCV.
Detailed Description
The present invention is explained below by way of specific tests, it being understood that the following examples are given by way of illustration and description only and are not to be construed as limiting the present invention in any way.
Example one
Plant material
Test material the test material was from healthy citrus leaves provided by sanming citrus plantation (fig. 3-a), contained cras citrus leaves (fig. 3-B), contained CYVCV citrus leaves (fig. 3-C), and contained both cras and CYVCV citrus leaves (fig. 3-D). The present example uses materials containing both CLas and CYVCV citrus leaves (FIG. 3-D).
Total RNA extraction and cDNA synthesis of leaf to be detected
0.05-0.1g of citrus leaves to be tested are cut, 1 mL of Trizol reagent (Invitrogen) is adopted to extract total RNA, 1% of agarose is adopted to detect the quality of the RNA, and an ultramicro spectrophotometer is adopted to detect the concentration of the RNA. First Strand cDNA Synthesis was performed using the RevertAID Fisrst Strand cDNA Synthesis Kit (Fermentas) with 5. mu.g of total RNA (10. mu.L system).
Primer synthesis
Conserved nucleotide sequences are designed according to the sequence of the CLas16s and CYVCV coat protein, and specific primers are designed by using Primer 5.0. The primers were synthesized by Beijing Liuhe Huada Gene science and technology, Inc. The primer sequences and the expected target fragment sizes are shown in Table 1.
TABLE 1 primer sequences, expected target fragment sizes
PCR amplification and detection
The PCR reaction system is as follows: mu.L of cDNA template, 1. mu.L of each of the primary detection primers described in Table 1, 10. mu.L of 2 XTaq PCR Master Mix (Thermo Fisher Scientific) reaction solution, and dd H2O to a total volume of 20. mu.L.
The PCR reaction conditions are as follows: pre-denaturation at 94 ℃ for 4 min; denaturation at 94 ℃ for 20 s, annealing at 55 ℃ for 45 s, and extension at 72 ℃ for 30 s for 40 cycles; extension at 72 ℃ for 10 min.
After 20. mu.L of the reaction solution was amplified for about 2 hours in a Bio-rad MyCycle PCR apparatus, 6. mu.L of the reaction solution was subjected to electrophoresis detection on 1% agarose to detect the amplification resultThe pictures were observed by the Biosens SC805 BIOTOP gel imaging system. The results are shown in FIG. 1, where 1 is represented by H in FIG. 12O is a template, and the amplification is carried out without bands; in FIG. 1, 2 is a CLas and CtACT 3 pair specific primer combination, and 840 bp, 748 bp CLas specific fragments and 120 bp internal reference CtACT gene fragments are obtained by amplification simultaneously; FIG. 1 shows 3 specific primer combinations of CYVCV and CtACT 3 pairs, which are amplified simultaneously to obtain 447 bp, 325 bp CYVCV specific fragments and 120 bp internal reference CtACT gene fragments; in FIG. 1, 4 is a combination of CLas, CYVCV and CtACT 5 pairs of specific primers, which not only amplifies 120 bp internal reference CtACT gene fragments, but also simultaneously amplifies 840 bp, 748 bp CLas specific fragments and 447 bp, 325 bp CYVCV specific fragments. In summary, the primers shown in Table 1 were used to perform double detection by using the PCR reaction system and conditions, thereby eliminating the possibility of false positive. The results show that the tested leaves are infected with CLas and CYVCV.
Example two
Plant material
Using the material containing both the CLas and CYVCV citrus leaves (figure 3-D).
Total RNA extraction and cDNA synthesis of leaf to be detected
The method is the same as the first embodiment.
Primer synthesis
Primer design and synthesis as in example one, the specific primer mix combinations were tested as 5 pairs in table 1.
PCR amplification and detection
The PCR reaction system and reaction conditions were the same as in example one.
After 20. mu.L of the reaction solution was amplified for about 2 hours in a Bio-rad MyCycle PCR instrument, 6. mu.L of the reaction solution was subjected to electrophoresis on 1% agarose to detect the amplification result, and the image was taken on an image system of Biosens SC805 BIOTOP gel. As shown in FIG. 2, specific bands of 840 bp, 748 bp, 447 bp, 325 bp and 120 bp were amplified simultaneously with combinations of CLas16s F118, CLas16s R866, CLas16s R958, CYVCV CP F41, CYVCV CP F163, CYVCV CP R488, CtACT F460 and CtACT R580. The result shows that the sample to be tested contains CLas and CYVCV and the cDNA synthesis quality is available. In FIG. 2, 1-5 are bands for amplifying the CLas, CYVCV and CtACT target bands of the sample cDNA to be tested under the conditions of dilution of 1, 10, 100, 1000 and 10000 times respectively; FIG. 2 shows that the test sample cDNA can also amplify CYVCV band under 100000-fold dilution condition 6. The result shows that the specific primer combination not only can eliminate the generation of false positive and false negative, but also has high sensitivity.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Shanghai billulan Biotechnology GmbH
SANMING ACADEMY OF AGRICULTURAL SCIENCES
<120> PCR primer combination and detection method for pathogens of citrus yellow dragon disease and yellow vein clearing disease
<130> 8
<160> 8
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial sequence
<400> 1
ttggagagag atgagcctg 19
<210> 2
<211> 19
<212> DNA
<213> Artificial sequence
<400> 2
aagggctggt aaggttctg 19
<210> 3
<211> 19
<212> DNA
<213> Artificial sequence
<400> 3
acccaacatc tcacgacac 19
<210> 4
<211> 20
<212> DNA
<213> Artificial sequence
<400> 4
catttccaca ttactgcgag 20
<210> 5
<211> 18
<212> DNA
<213> Artificial sequence
<400> 5
aaacaaccac ttcacccg 18
<210> 6
<211> 20
<212> DNA
<213> Artificial sequence
<400> 6
tctatgttca agatgcggac 20
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence
<400> 7
gatcatatgg aggtgctatc ac 22
<210> 8
<211> 21
<212> DNA
<213> Artificial sequence
<400> 8
tgaagatggt tcagcaagta g 21