CN112410453B - DNA molecular marker for mustard cytoplasm identification, screening method and application thereof - Google Patents
DNA molecular marker for mustard cytoplasm identification, screening method and application thereof Download PDFInfo
- Publication number
- CN112410453B CN112410453B CN202011370103.9A CN202011370103A CN112410453B CN 112410453 B CN112410453 B CN 112410453B CN 202011370103 A CN202011370103 A CN 202011370103A CN 112410453 B CN112410453 B CN 112410453B
- Authority
- CN
- China
- Prior art keywords
- mustard
- indel
- cytoplasm
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of molecular marker development, and discloses a DNA molecular marker for mustard cytoplasm identification, a screening method and application thereof, wherein 4 specific variation sites (namely, mt _ Indel _65565, mt _ SNP _79573, cp _ Indel _9198 and cp _ Indel _ 27345) are found in mustard mitochondria (mt) and chloroplast (cp) genomes, and the DNA molecular markers (mt _ Indel, mt _ SNP, cp _ Indel _1 and cp _ Indel _ 2) developed based on the specific variation sites. The results of the mitochondrion marking and the chloroplast marking of the mustard cytoplasm are consistent, and the mustard cytoplasm is divided into three cytoplasm types of C1, C2 and C3. The invention establishes a method for rapidly identifying the mustard from the cytoplasmic aspect, and has practical values in mustard type identification, mustard cytoplasm source and donor identification and mustard seed purity identification.
Description
Technical Field
The invention belongs to the technical field of molecular marker development, and particularly relates to a DNA molecular marker for mustard cytoplasm identification, a screening method and application thereof.
Background
Mustard (Brassica juncea (L.) czern. et Coss.) is an important oil crop (Brassica juncea), vegetable (potherb mustard, kohlrabi, mustard tuber, etc.) and seasoning crop (mustard) in the world. Mustard is divided into root mustard, seed mustard, leaf mustard, stem mustard and other subspecies according to the utilized parts. These subspecies of mustard are widely cultivated in china. When the obtained new germplasm of the mustard needs to be identified in the breeding of the mustard, phenotype observation is often relied on, so that the test progress is delayed, the breeding period is prolonged, the accuracy is low, and misjudgment is easily caused. When the progeny of the interspecies mustard cross is not clear of the cytoplasmic donor of the parent, great confusion can be caused to the breeder. In the production process, the mustard with different purposes and the mustard and other brassica plants (such as Chinese cabbage, cabbage type rape and cabbage type rape) are easy to be subjected to 'powder stringing', so that the biological mixing of the mustard is caused, the seeds of the mustard with different purposes and the seeds of the other brassica plants are very similar in external form, the mechanical mixing has great influence on the germplasm purity, and even the reduction of the production performance and the germplasm degradation can be caused. At present, there is no report on the specificity differentiation of mustard germplasm by a molecular marker technology. Therefore, it is important to establish a method for rapidly identifying the mustard type, the cytoplasm source and the purity of the donor parent and seeds.
Through the above analysis, the existing problems and defects are:
(1) the obtained new mustard germplasm cannot be directly identified in mustard breeding practice.
(2) Biological and mechanical mixing in the mustard breeding process has great influence on the germplasm purity, and even causes the reduction of production performance and germplasm degradation.
(3) At present, no report exists for specifically distinguishing mustard germplasm by a molecular marker technology.
The difficulty in solving the above problems and defects is: 1. the prior mustard germplasm identification always remains the identification on plant morphology and does not extend to the genome level. 2. Human breeding activities mainly aim at harvesting and preserving seeds, biological and mechanical contamination generated in the breeding process is inevitable, and a method for directly identifying the purity of the seeds is necessary. 3. Molecular marker technology also relies on the development of genomic technology, and the development of suitable molecular markers is directly restricted by the absence of a complete and comprehensive cytoplasmic genome.
The significance for solving the problems and the defects is as follows: 1. the development of a suitable molecular marker can enable a breeder to quickly identify unknown mustard germplasm, so that the time of the breeder is greatly saved; 2. three different cytoplasms, C1, C2 and C3, can be distinguished by cytoplasmic-specific molecular markers, and strong selection of cytoplasms is provided by different Brassica juncea subspecies. Therefore, the method is of great significance for seed purity identification. 3. The invention develops a specific marker based on the difference site of mustard cytoplasm genomes (mitochondria and chloroplasts), is the first method related to mustard cytoplasm identification, and has important significance for mustard breeding practice.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides a DNA molecular marker for mustard cytoplasm identification, a screening method and application thereof.
The invention is realized by the fact that the mustard cytoplasm identified DNA molecular marker is two mitochondrial genome-specific variation sites existing between different mustard subspecies: mt _ Indel _65565 and mt _ SNP _79573 and two chloroplast genome specific mutation sites: cp _ Indel _9198, and cp _ Indel _ 27345.
Further, the DNA molecular marker for mustard cytoplasm identification is based on 4 cytoplasm genome specific variation sites to develop a mitochondrial genome molecular marker primer mt _ Indel and a primer mt _ SNP, and chloroplast genome molecular marker primers cp _ Indel _1 and cp _ Indel _ 2;
the upstream sequence of the primer pair mt _ Indel is SEQ ID NO: 1, the downstream sequence is SEQ ID NO: 2; the primer pair mt _ SNP primer sequence is SEQ ID NO: 3, the downstream sequence is SEQ ID NO: 4; the upstream sequence of the primer pair cp _ Indel _1 is SEQ ID NO: 5, the downstream sequence is SEQ ID NO: 6; the upstream sequence of the primer pair cp _ Indel _2 is SEQ ID NO: 7, the downstream sequence is SEQ ID NO: 8.
the invention also aims to provide a screening method of the mustard cytoplasm identified DNA molecular marker, which comprises the following steps:
firstly, carrying out Blast comparison on mitochondrial genome sequences and chloroplast genome sequences of root mustard "kohlrabi", oil mustard "Sichuan yellow seeds" and leaf mustard "potherb mustard" at an NCBI website;
secondly, developing a polymorphic marker mt _ Indel based on mt _ Indel _ 65565; the potherb mustard and the kohlrabi have a 125bp band, and the Sichuan yellow seed band is 156 bp;
thirdly, developing a dCAPS molecular marker mt _ SNP based on mt _ SNP _ 79573; the SNP base of the Szechwan yellow seed and the turnip is C, the PCR product can be specifically cut off by restriction endonuclease Ear1, and agarose gel electrophoresis can show two bands after the PCR product is cut; the base of potherb mustard is A, which can not be cut by enzyme, and only one band of PCR product is formed after electrophoresis;
fourthly, developing a specificity mark cp _ Indel _1 based on cp _ Indel _ 9198; the turnip can amplify a 203bp band, but the potherb mustard and the Sichuan yellow seeds can not generate the band;
fifthly, developing a polymorphism mark cp _ Indel _2 based on cp _ Indel _ 27345; a 208bp band is amplified from Sichuan yellow seeds, and the amplified bands of potherb mustard and kohlrabi are 228 bp;
sixthly, dividing mustard mitochondrial genomes into three categories based on 2 mitochondrial genome DNA molecular markers: the SNP base is C, and the genome without 31bp insertion mitochondria is named as mt 1; the base is C, and the 31bp inserted mitochondrial genome is named as mt 2; the base is A, and the genome without 31bp inserted mitochondria is named as mt 3;
seventhly, the mustard chloroplast genomes are also divided into three groups based on 2 chloroplast genome DNA molecular markers: the chloroplast genome with 7bp insertion and no 20bp deletion is called cp 1; the chloroplast genome without 7bp insertion and with 20bp deletion is called cp 2; the chloroplast genome without 7bp insertion and 20bp deletion is named cp 3;
and eighthly, based on the molecular marker typing results of the mitochondrial and chloroplast genome DNA, finding that the mitochondrial genome type and the chloroplast genome type can be in one-to-one correspondence, and then distinguishing the mustard cytoplasm into three types, namely C1, C2 and C3.
Further, the first step is implemented by using a mustard mitochondrial genome sequence GeneBank ID number: JF920288 is a reference genome, a 31bp long repetitive sequence 5'-CCTCTCCTTTCAGTCGAGTTTGTGTTCACAA-3' is added between nucleotides (nt)65564 to nt 65565 in the mitochondrial genome of 'Sichuan yellow seed', and the mitochondrial genome of 'potherb mustard' is subjected to base transversion (C → A) in nt 79573, so that two variation sites, namely Indel _65565 and SNP _79573, exist between different mustard mitochondrial genomes; also as the genome sequence of mustard chloroplast, GeneBank ID number: KT581449 is a reference genome, a 7bp long repetitive sequence 5 '-CTTTTTA-3' is inserted between nt9197 and nt9198 of the root mustard, and a 20bp long sequence 5'-TGGATATAGACTCATGAAAG-3' is deleted between nt27345 and nt27366 of the root mustard, so that two variable sites namely cp _ Indel _9198 and cp _ Indel _27345 exist in different leaf mustard chloroplast genomes;
the sequence of the second-step primer mt _ Indel is SEQ ID NO: 1 and SEQ ID NO: 2;
the sequence of the third step primer mt _ SNP is SEQ ID NO: 3 and SEQ ID NO: 4;
the sequence of the fourth step primer cp _ Indel _1 is SEQ ID NO: 5 and SEQ ID NO: 6;
the sequence of the primer cp _ Indel _2 in the fifth step is SEQ ID NO: 7 and SEQ ID NO: 8.
further, the amplification system of the first step to the fifth step is as follows: the total volume is 10ul, containing 5ul 2X Fast LongTaq PCR PreMix (innovagene, Changsha, China), 0.2ul each of 10uM forward and reverse primers, 100ng DNA template, and supplementing to 10ul with sterilized double distilled water;
the second-step amplification reaction conditions are as follows: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 20s, and 32 cycles; extending at 72 ℃ for 5min, storing at 4 ℃, loading 4ul of PCR product during electrophoresis, performing electrophoresis separation by adopting 2.5% agarose gel, and separating at 4V/cm for 60 min;
the third step adopts restriction endonuclease Ear1(NEB), and the enzyme cutting system is as follows: 10ul of amplification product, 7.5ul of sterilized double distilled water, 2ul of 10 XNEB Buffer, 10-20U of endonuclease, and 10-12 h of enzyme digestion at 37 ℃;
the third step of amplification reaction conditions are as follows: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; extending for 5min at 72 ℃, storing at 4 ℃, loading the enzyme digestion product to 6-8 ul during electrophoresis, and carrying out electrophoresis separation by adopting 1.6% agarose gel;
the fourth step of amplification reaction conditions are as follows: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 20s for 35 cycles; extending at 72 ℃ for 5min, storing at 4 ℃, loading 4ul of PCR products during electrophoresis, and performing electrophoresis separation by adopting 1.6% agarose gel;
the conditions of the fifth step amplification reaction are as follows: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 20s, and 32 cycles; extending at 72 deg.C for 5min, storing at 4 deg.C, loading PCR product to 3ul, separating by electrophoresis with 3.0% agarose gel, and separating at 4V/cm for 60 min.
The invention also aims to provide a method for identifying cytoplasm in mustard breeding, which uses the DNA molecular marker identified by the mustard cytoplasm.
The invention also aims to provide a mustard germplasm typing method which uses the DNA molecular marker identified by the mustard cytoplasm.
Another object of the present invention is to provide a method for identifying an unknown mustard sample by using the cytoplasmic DNA marker of mustard.
The invention also aims to provide a mustard cytoplasm donor parent detection method, which uses the DNA molecular marker identified by the mustard cytoplasm.
The invention also aims to provide a mustard seed purity identification method, which uses the DNA molecular marker identified by the mustard cytoplasm.
By combining all the technical schemes, the invention has the advantages and positive effects that: the invention aims to overcome the defects of the prior art and obtain a scheme for quickly and accurately identifying mustard germplasm, cytoplasm donor parent detection and seed purity at the early stage. According to the strict adherence of mitochondrial genome to maternally inherited characteristics, the invention provides the use of cytoplasm-specific DNA molecular markers for a mustard germplasm typing method: (1)2, the molecular marker of the mitochondrial genome and the molecular marker of the chloroplast genome can distinguish different germplasms of mustard, and an unknown mustard sample can be identified; (2) the source of the cytoplasm of the mustard hybrid progeny can be identified, and a new detection means is provided for detecting the mustard cytoplasm donor parent; (3) the method has important significance in identifying the purity of the mustard seeds. The invention simultaneously releases chloroplast and mitochondrial genomes of root mustard, oil mustard and leaf mustard and completes the assembly of the mitochondrial genomes of the root mustard; cytoplasmic molecular markers were developed by differences between cytoplasmic genomes of Brassica juncea subspecies.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings required to be used in the embodiments of the present application will be briefly described below, the drawings described below are only some embodiments of the present application, and it is obvious for those skilled in the art that other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a flow chart of the screening method of the DNA molecular marker identified by the mustard cytoplasm provided by the embodiment of the invention.
FIG. 2 is a graph of the results of typing of the mustard mitochondrial genome provided by the examples of the present invention;
in FIG. 2: m is a molecular weight standard; 1-3 are C1 cytoplasm, and are represented by root mustard "cabbage"; 4-6 are C2 cytoplasm, represented by oil-used mustard "Sichuan yellow seed"; 7-9 are C3 cytoplasm, represented by leaf mustard "potherb mustard".
FIG. 3 is a diagram showing the results of typing of chloroplast genomes provided by the examples of the invention;
in fig. 3: m is a molecular weight standard; 1-3 are C1 cytoplasm, represented by root mustard "kohlrabi"; 4-6 are C2 cytoplasm, and oil is represented by mustard "Sichuan yellow seed"; 7-9 are C3 cytoplasm, represented by leaf mustard "potherb mustard".
FIG. 4 is a schematic diagram showing the ratio of three cytoplasmic types of mustard for different purposes provided by an embodiment of the present invention;
in fig. 4: c1 type cytoplasm is represented by black bars; c2 type cytoplasm is represented by an off-white bar; c3-type cytoplasm is indicated by dark grey bars.
FIG. 5 is a graph showing the results of identifying cytoplasm of the forward and reverse cross generations of mustard "Sichuan yellow seed" (C2 type cytoplasm) and "Taojiang Dougua mustard" (C3 type cytoplasm) using mitochondrial markers mt _ Indel and mt _ SNP;
in FIG. 5, lanes 1 and 2 are "TAOJIANGTOUJIESHI", and lanes 3 and 4 are "TAOJIANGTOUJIESHI" X "Sichuan yellow seed" hybrid F 1 Lane 5 and 6 are hybrid F of "Taojiang Dougua mustard" x "Sichuan yellow seed 2 (ii) a 7. "Sichuan yellow seeds" in lane 8, and "Sichuan yellow seeds" x "punchongjie mustard" in lanes 9 and 10 1 Lanes 11 and 12 are hybrid F of "Sichuan yellow seed" x "Naojiang Dougua mustard 2 。
FIG. 6 is a graph showing the results of identifying cytoplasm of forward and reverse cross progeny of mustard "Sichuan yellow seed" (C2 type cytoplasm) and "Taojiang Dougua mustard" (C3 type cytoplasm) with chloroplast markers cp _ Indel _1 and cp _ Indel _ 2;
in FIG. 6, lanes 1 and 2 are "Chongjiang Dougua mustard" and lanes 3 and 4 are "Chongjiang Dougua mustard" x "Sichuan yellow seed" hybrid F 1 Lane 5 and 6 are hybrid F of "Taojiang Dougua mustard" x "Sichuan yellow seed 2 (ii) a 7. Lane 8 is "Sichuan yellow seed", lanes 9 and 10 are "Sichuan yellow seed" x "hybrid F of Taojiang Dougua mustard 1 Lanes 11 and 12 are hybrid F of "Sichuan yellow seed" x "Taojiang Dougua mustard 2 。
FIG. 7 is a graph showing the results of the identification of mitochondrial markers mt _ Indel and mt _ SNP for cytoplasm after the mustard "Sichuan yellow seed" (C2 type cytoplasm) and "Taojiang Dougua mustard" (C3 type cytoplasm) seeds provided by the example of the present invention are mixed according to different weight ratios:
in fig. 7: lane 1 is a 100% "yellow Sichuan yellow seed" seed sample, lane 2 is a 99% "yellow Sichuan yellow seed" + 1% "mahogany" seed sample, lane 3 is a 95% "yellow Sichuan yellow seed" + 5% "mahogany" seed sample, lane 4 is a 90% "yellow Sichuan yellow seed" + 10% "mahogany" seed sample, lane 5 is an 80% "yellow Sichuan yellow seed" + 20% "mahogany" seed sample, lane 6 is a 70% "yellow Sichuan yellow seed" + 30% "mahogany" seed sample, lane 7 is a 50% "yellow Sichuan yellow seed" + 50% "mahogany" seed sample, and lane 8 is a 100% "mahogany" seed sample.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Aiming at the problems in the prior art, the invention provides a DNA molecular marker for mustard cytoplasm identification, a screening method and application thereof, and the invention is described in detail by combining the attached drawings.
The DNA molecular marker for mustard cytoplasm identification provided by the invention exists in two mitochondrial genome specific variation sites between cytoplasm of different mustard subspecies: mt _ Indel _65565 and mt _ SNP _79573 and two chloroplast genome specific mutation sites: cp _ Indel _9198, and cp _ Indel _ 27345.
As shown in FIG. 1, the screening method of the DNA molecular marker identified by the mustard cytoplasm provided by the invention comprises the following steps:
s101: performing Blast comparison on mitochondrial genome sequences of root mustard "kohlrabi", oil mustard "Sichuan yellow seed" and leaf mustard "potherb mustard" at an NCBI website (https:// blast.ncbi.nlm.nih.gov);
s102: developing a polymorphic marker mt _ Indel based on mt _ Indel _ 65565; potherb mustard and kohlrabi have a 125bp band, and Sichuan yellow seed has a 156bp band;
s103: developing a dCAPS molecular marker mt _ SNP based on mt _ SNP _ 79573; the SNP base of the Szechwan yellow seed and the turnip is C, the PCR product can be specifically cut off by restriction endonuclease Ear1, and agarose gel electrophoresis can show two bands after the PCR product is cut; the base of potherb mustard is A, which can not be cut by enzyme, and only one band of PCR product is formed after electrophoresis;
s104: developing a specificity mark cp _ Indel _1 based on cp _ Indel _ 9198; the turnip can amplify a 203bp band, but the potherb mustard and the Sichuan yellow seeds can not generate the band;
s105: developing a polymorphic marker cp _ Indel _2 based on cp _ Indel _ 27345; a 208bp band is amplified from Sichuan yellow seeds, and the amplified bands of potherb mustard and kohlrabi are 228 bp;
s106: mustard mitochondrial genomes are classified into three categories based on 2 mitochondrial genome DNA molecular markers: the SNP base is C, and the genome without 31bp insertion mitochondria is named as mt 1; the base is C, and the 31bp inserted mitochondrial genome is named as mt 2; the base is A, and the genome without 31bp inserted mitochondria is named as mt 3;
s107: mustard chloroplast genomes were also classified into three groups based on 2 chloroplast genome DNA molecular markers: the chloroplast genome with 7bp insertion and no 20bp deletion is called cp 1; the chloroplast genome without 7bp insertion and with 20bp deletion is called cp 2; the chloroplast genome without 7bp insertion and 20bp deletion is named cp 3;
s108: based on the molecular marker typing results of the mitochondrial and chloroplast genome DNA, the mitochondrial genome types and the chloroplast genome types are all found to be in one-to-one correspondence, so that the mustard cytoplasm is divided into three types, namely C1, C2 and C3.
Those skilled in the art can also use other steps to perform the screening method of the DNA molecular marker identified by the mustard cytoplasm provided by the present invention, and the screening method of the DNA molecular marker identified by the mustard cytoplasm provided by the present invention in fig. 1 is only one specific example.
The technical scheme of the invention is further described in the following with the accompanying drawings of the specification.
Sichuan yellow seed (Sichuan of China, source) was introduced in 1998 from the institute of agriculture and forestry, metropolis (then "second academy of agriculture"); potherb mustards (CR 2493; UK, source, 1990) were introduced from the German IPK germplasm resources repository; root-mustard (Japanese Dalbou; cultivation of Beijing Jinwanghui seed, Ltd.) was purchased from Beijing in China in 2017; myrtle mustard (leaf mustard) was collected from farmers in the county of myrtle, Hunan province in 2018.
The invention develops a mitochondrial genome molecular marker primer mt _ Indel, a primer mt _ SNP and chloroplast genome molecular marker primers cp _ Indel _1 and cp _ Indel _2 based on 4 cytoplasmic genome specific mutation sites. The nucleotide sequence is 5 '→ 3':
the amino acid sequence of SEQ ID NO: 1: mt _ Indel: forward primer (F): aggacctttagtaccgtaccc, respectively; SEQ ID NO: 2: reverse primer (R): ccgaggtatttcttactcgac are provided.
The amino acid sequence of SEQ ID NO: 3: mt _ SNP: forward primer (F): ctacagcactctcggactgat, respectively; SEQ ID NO: 4: reverse primer (R): ggttgtttaagaagagagaatcg are provided.
SEQ ID NO: 5: cp _ Indel _ 1: forward primer (F): ctaaattgtcccctttttacttttta, respectively; the amino acid sequence of SEQ ID NO: 6: reverse primer (R): ggatttgaacctataccaaaggt are provided.
The amino acid sequence of SEQ ID NO: 7: cp _ Indel _ 2: forward primer (F): cctaaagttttacctatcagat, respectively; the amino acid sequence of SEQ ID NO: 8: reverse primer (R): ggcaattcttcatctaatcta is added.
The invention provides a method for developing the cytoplasmic genomic DNA molecular marker, which comprises the following steps:
(1) the mitochondrial genome sequences of root mustard "kohlrabi", oil mustard "Sichuan yellow seed" and leaf mustard "potherb mustard" are subjected to Blast comparison at an NCBI website (https:// blast.ncbi.nlm.nih.gov), a mustard mitochondrial genome sequence (GeneBank ID number: JF920288) is used as a reference genome, a 31bp long repeated sequence (5'-CCTCTCCTTTCAGTCGAGTTTGTGTTCACAA-3') is added between nucleotides (nt) 65564-nt 65565 on the mitochondrial genome of the "Sichuan yellow seed" (and base transversion occurs on the mitochondrial genome of the "potherb mustard" at nt 79573 (C → A), and two variation sites, namely Indel _65565 and SNP _79573, exist between different mustard mitochondrial genome groups; similarly, with the mustard chloroplast genome sequence (GeneBank ID No.: KT581449) as a reference genome, a 7bp long repetitive sequence (5 '-CTTTTTA-3') is inserted between nt9197 and nt9198 in the "kohlrabi", and a 20bp long sequence (5'-TGGATATAGACTCATGAAAG-3') is deleted between nt27345 and nt27366 in the "Sichuan yellow seed", so that two mutation sites, namely cp _ Indel _9198 and cp _ Indel _27345, exist in different mustard chloroplast genomes.
(2) Developing a polymorphic marker mt _ Indel based on mt _ Indel _ 65565; potherb mustard and cabbage have one 125bp band, and Sichuan yellow seed has 156bp band. The sequence of the primer mt _ Indel is SEQ ID NO: 1 and SEQ ID NO: 2.
(3) developing a dCAPS (dCAPS marker indicates fragment length polymorphism obtained by digesting a PCR product by a restriction endonuclease in an experiment) molecular marker mt _ SNP based on mt _ SNP _ 79573; the SNP base of the Szechwan yellow seed and the turnip is C, the PCR product can be specifically cut off by restriction endonuclease Ear1, and agarose gel electrophoresis can show two bands after the PCR product is cut; "potherb mustard" has base A, it can not cut enzyme, only has one band of PCR product after electrophoresis. The sequence of the primer mt _ SNP is SEQ ID NO: 3SEQ ID NO: 4.
(4) developing a specificity mark cp _ Indel _1 based on cp _ Indel _ 9198; the "root mustard" can amplify a 203bp band, while the "potherb mustard" and "Sichuan yellow seed" can not amplify the band. The sequence of the primer cp _ Indel _1 is SEQ ID NO: 5 and SEQ ID NO: 6.
(5) developing a polymorphism mark cp _ Indel _2 based on cp _ Indel _ 27345; a208 bp band is amplified from "Sichuan yellow seeds", while the amplified bands of "potherb mustard" and "turnip" are 228bp in size. The sequence of the primer cp _ Indel _2 is SEQ ID NO: the amino acid sequence of SEQ ID NO: 7 and 8.
(6) And dividing mustard mitochondrial genomes into three categories based on 2 mitochondrial genome DNA molecular markers (figure 2): the SNP base is C, and the genome without 31bp insertion mitochondria is named as mt 1; the base is C, and the 31bp inserted mitochondrial genome is named as mt 2; the genome was named mt3, the base is A, and the inserted mitochondrial genome of no 31bp is named.
(7) Mustard chloroplast genomes were also classified into three groups based on 2 chloroplast genome DNA molecular markers (fig. 3): the chloroplast genome with 7bp insertion and no 20bp deletion is called cp 1; the chloroplast genome without 7bp insertion and with 20bp deletion is called cp 2; the chloroplast genome without 7bp insertion and 20bp deletion is named cp 3.
(8) Based on the molecular marker typing results of the mitochondrial and chloroplast genome DNA, the mitochondrial genome types and the chloroplast genome types are all found to be in one-to-one correspondence, so that the mustard cytoplasm is divided into three types, namely C1, C2 and C3. Example studies of the cytoplasmic types of leaf mustard below showed that all 29 root mustard were of the C1 cytoplasmic type, all 172C 2 cytoplasmic type were of the oil mustard, and both leaf and stem mustard were of the C3 cytoplasmic type.
The primer sequences are shown in table 1:
in the present invention, the amplification system of steps (2), (3), (4) and (5) is: the total volume is 10ul, containing 5ul 2 Xfast LongTaq PCR PreMix (Innovagene, Changsha, China), 0.2ul each of 10uM forward and reverse primers, 100ng DNA template, and supplementing to 10ul with sterilized double distilled water.
In the present invention, step (3) employs the restriction endonuclease Ear1 (NEB). The enzyme digestion system is as follows: 10ul of amplification product, 7.5ul of sterilized double distilled water, 2ul of 10 XNEB Buffer, 10-20U of endonuclease, and 10-12 h of enzyme digestion at 37 ℃.
In the present invention, the amplification reaction conditions in step (2) are: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 20s, for 32 cycles; extending for 5min at 72 ℃, and storing at 4 ℃. During electrophoresis, 4ul of PCR product is loaded, and 2.5% agarose gel is adopted for electrophoretic separation, and separation is carried out for 60min at 4V/cm.
In the present invention, the amplification reaction conditions in step (3) are: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 30s, and 35 cycles; extending for 5min at 72 ℃, and storing at 4 ℃. And (3) loading 6-8 ul of the enzyme digestion product during electrophoresis, and performing electrophoretic separation by adopting 1.6% agarose gel.
In the invention, the amplification reaction conditions in step (4) are as follows: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 57 ℃ for 30s, and extension at 72 ℃ for 20s for 35 cycles; extending at 72 deg.C for 5min, and storing at 4 deg.C. During electrophoresis, 3ul of PCR product was loaded and separated by electrophoresis using 1.6% agarose gel.
In the present invention, the amplification reaction conditions in step (5) are: denaturation at 94 deg.C for 5 min; denaturation at 94 ℃ for 30s, annealing at 54 ℃ for 30s, and extension at 72 ℃ for 20s, for 32 cycles; extending at 72 deg.C for 5min, and storing at 4 deg.C. During electrophoresis, 3ul of PCR product is loaded, and 3.0% agarose gel is adopted for electrophoretic separation, and separation is carried out for 60min at 4V/cm.
The application of the method for identifying cytoplasm by using DNA molecular markers in mustard breeding; the invention provides an application of a cytoplasm-specific DNA molecular marker in a mustard germplasm typing method.
The technical solution of the present invention is further described with reference to the following specific examples.
The invention completes sequencing and assembling of mitochondrial genomes and chloroplast genomes of leaf mustard such as root mustard "kohlrabi", oil mustard "Sichuan yellow seeds" and leaf mustard "potherb mustard". The comparative analysis shows that mustard mitochondrial genome has two specific variation sites, namely mt _ Indel _65565 and mt _ SNP _79573, and is characterized in that when mustard mitochondrial genome sequence (GeneBank ID No.: JF920288) is taken as reference genome, 31bp long repetitive sequence (5'-CCTCTCCTTTCAGTCGAGTTTGTGTTCACAA-3') is added between nucleotides (nt)65564 and nt 65565 in the "Sichuan yellow seed" mitochondrial genome, and the "potherb mustard" mitochondrial genome is subjected to base transversion (C → A) in nt 79573. Comparative analysis also finds that mustard chloroplast genome has two specific mutation sites, namely cp _ Indel _9198 and cp _ Indel _27345, and is characterized in that when mustard chloroplast genome sequence (GeneBank ID number: KT581449) is taken as a reference genome, a 7bp long repetitive sequence (5 '-CTTTTTA-3') is inserted into a "kohlrabi" from nt9197 to nt9198, and a 20bp long sequence (5'-TGGATATAGACTCATGAAAG-3') is deleted from a "Sichuan yellow seed" from nt27345 to nt 27366.
Example 1: mustard cytoplasm genome type identification
Specific experiments are as follows: gathering mustard germplasm of germplasm resource libraries such as oil crop institute of Chinese agricultural science institute, Germany IPK, Holland CGN and the like, and collecting through field investigation to obtain 474 parts of mustard germplasm resources, wherein the mustard germplasm resources comprise 325 parts of oil mustard, 106 parts of leaf mustard, 14 parts of stem mustard and 29 parts of root mustard. All the materials are planted in a hoeing experimental base of Hunan agricultural university in 2018 months.
Extracting leaf total DNA (including nuclear genome DNA, mitochondria and chloroplast genome DNA) of the mustard germplasm at the seedling stage by using a CTAB (cetyl triethyl ammonium bromide) method, and identifying all mustard germplasm by using specific molecular markers, steps and a typing method of cytoplasm (mitochondria and chloroplasts) genomes in the steps (2), (3), (4) and (5) in the invention.
The 474 mustard germplasms can be identified by the cytopoietic (mitochondrial and chloroplast) genotypic types, and the identification results are shown in figure 4: 29 parts of root mustard is C1 type cytoplasm, 172 parts of C2 type cytoplasm is oil mustard, and 120 parts of leaf mustard and stem mustard belong to C3 cytoplasm types. Therefore, the effect of distinguishing different types of mustard can be achieved by specific markers of the cytoplasmic (mitochondrial and chloroplast) genome, namely mt _ Indel, mt _ SNP or cp _ Indel _1 and cp _ Indel _ 2.
Example 2: mustard hybrid progeny cytoplasmic donor parent identification
Using mustard "Sichuan yellow seed" (C2 type cytoplasm) and "Taojiang Dougua mustard" (C3 type cytoplasm) to make forward and backward cross-breeding so as to obtain hybrid F 1 And F 2 And (4) generation.
The DNA extraction method of example 1 was used to extract "Sichuan yellow seed", "Taojiang Dougua mustard" and its positive and negative cross hybrid F 1 、F 2 Total DNA of leaves of seedlings of the generation plants. Cytoplasmic typing of the hybrid parents and their hybrid progeny was also performed as in example 1; the mitochondrial genome typing results are shown in figure 5: orthogonal F of ' Taojiang Dougua mustard ' x ' Sichuan yellow seed 1 And F 2 The cytoplasm of the progeny is consistent with that of the 'Taojiang Dougua mustard' cytoplasm, and the cytoplasm of the hybrid progeny of the 'Sichuan yellow seed' x 'Taojiang Dougua mustard' is consistent with that of the 'Sichuan yellow seed'. Also shown in FIG. 6 is the chloroplast genome typing results, with cp _ Indel _1 tagging being strapless, and cp _ Indel _2 tagging also being consistent with mitochondrial cytoplasmic typing results. Therefore, the present invention enables accurate detection of the cytoplasmic donor parent.
Example 3: purity identification of mustard seeds
The seed purity identification scheme is characterized in that a sample to be detected is uniformly mixed by using Szechwan yellow seeds (C2 type cytoplasm) and Naojiang Dougua mustard (C3 type cytoplasm) according to the mass purity ratio of seeds in a table 2; extracting the total DNA of the sample to be detected by adopting the DNA extraction method in the embodiment 1, and identifying the mixed seed sample by adopting the genome typing method in the embodiment 1; the results of the identification are shown in FIG. 7: the results show that seed samples with less than 1% confounding can be detected with this marker.
Table 2: mustard seed purity identification proportioning scheme
The above description is only for the purpose of illustrating the present invention, and the scope of the present invention is not limited thereto, and any modifications, equivalents and improvements made by those skilled in the art within the technical scope of the present invention as explained in the spirit and principle of the present invention should be covered within the scope of the present invention.
<110> Hunan agriculture university
<120> mustard cytoplasm identification DNA molecular marker, screening method and application thereof
<160> 8
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
aggacctttagtaccgtaccc
<210> 2
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
ccgaggtatttcttactcgac
<210>3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>3
ctacagcactctcggactgat
<210> 4
<211>23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
ggttgtttaagaagagagaatcg
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
ctaaattgtcccctttttacttttta
<210> 6
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
ggatttgaacctataccaaaggt
<210> 7
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
cctaaagttttacctatcagat
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
ggcaattcttcatctaatcta
Gene sequence table
Claims (5)
1. The DNA molecular marker combination for mustard cytoplasm identification is characterized in that the DNA molecular marker combination for mustard cytoplasm identification is divided into two groups, one group is mt _ Indel _65565 and mt _ SNP _79573, and the other group is cp _ Indel _9198 and cp _ Indel _ 27345;
the mt _ Indel _65565 is the mitochondrial reference genome sequence GeneBank ID number: the insertion/deletion of 31bp long repetitive sequence 5'-CCTCTCCTTTCAGTCGAGTTTGTGTTCACAA-3' of JF920288 nucleotide between nt 65564-nt 65565,
the mt _ SNP _79573 is a gene sequence containing a mitochondrial reference genome sequence GeneBank ID number: nucleotide sequence of polymorphism C/A at JF920288nt 79573;
the cp _ Indel _9198 is a chloroplast reference genome sequence GeneBank ID number: the insertion/deletion of a 7bp long repetitive sequence 5 '-CTTTTTTA-3' of KT581449 nucleotide between nt 9197-nt 9198,
the cp _ Indel _27345 is a chloroplast reference genome sequence GeneBank ID number: KT581449 nucleotide is inserted/deleted in a 20bp long segment of sequence 5'-TGGATATAGACTCATGAAAG-3' between nt 27345-nt 27366.
2. The mustard cytoplasm identified DNA molecule marker combination of claim 1, wherein the amplification primer pair of mt _ Indel _65565 and mt _ SNP _79573 are mt _ Indel and mt _ SNP, respectively, and the amplification primer pair of cp _ Indel _9198 and cp _ Indel _27345 are cp _ Indel _1 and cp _ Indel _2, respectively;
the upstream sequence of the primer pair mt _ Indel is SEQ ID NO: 1, the downstream sequence is SEQ ID NO: 2; the primer pair mt _ SNP primer sequence is SEQ ID NO: 3, the downstream sequence is SEQ ID NO: 4; the upstream sequence of the primer pair cp _ Indel _1 is SEQ ID NO: 5, the downstream sequence is SEQ ID NO: 6; the upstream sequence of the primer pair cp _ Indel _2 is SEQ ID NO: 7, the downstream sequence is SEQ ID NO: 8.
3. a method for identifying cytoplasm in mustard breeding, which is characterized in that the method for identifying cytoplasm in mustard breeding uses the DNA molecular marker combination identified by the mustard cytoplasm in any group of claim 1.
4. A method for detecting a mustard cytoplasm donor parent, wherein the method for detecting a mustard cytoplasm donor parent uses the combination of DNA molecular markers identified by any one of the group of mustard cytoplasm as claimed in claim 1.
5. A method for identifying the purity of mustard seeds, which is characterized by using the DNA molecular marker combination identified by the mustard cytoplasm according to any group of claim 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011370103.9A CN112410453B (en) | 2020-11-30 | 2020-11-30 | DNA molecular marker for mustard cytoplasm identification, screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011370103.9A CN112410453B (en) | 2020-11-30 | 2020-11-30 | DNA molecular marker for mustard cytoplasm identification, screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112410453A CN112410453A (en) | 2021-02-26 |
| CN112410453B true CN112410453B (en) | 2022-09-06 |
Family
ID=74830508
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011370103.9A Active CN112410453B (en) | 2020-11-30 | 2020-11-30 | DNA molecular marker for mustard cytoplasm identification, screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112410453B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1849880A (en) * | 2006-06-05 | 2006-10-25 | 华中农业大学 | Selective breeding for potherb mustard cytoplasm male sterile line |
| CN1868260A (en) * | 2006-06-05 | 2006-11-29 | 华中农业大学 | Method for breeding male sterile series of envelopped senvy cytoplasm |
| CN108220473A (en) * | 2018-02-06 | 2018-06-29 | 北京市农林科学院 | It is marked using chloroplaset InDel and differentiates CMS-S maize material |
| CN111154908A (en) * | 2020-01-20 | 2020-05-15 | 中国农业科学院油料作物研究所 | KASP labeled primer for identifying Brassica crop Cam and Pol cytoplasm types and application thereof |
-
2020
- 2020-11-30 CN CN202011370103.9A patent/CN112410453B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1849880A (en) * | 2006-06-05 | 2006-10-25 | 华中农业大学 | Selective breeding for potherb mustard cytoplasm male sterile line |
| CN1868260A (en) * | 2006-06-05 | 2006-11-29 | 华中农业大学 | Method for breeding male sterile series of envelopped senvy cytoplasm |
| CN108220473A (en) * | 2018-02-06 | 2018-06-29 | 北京市农林科学院 | It is marked using chloroplaset InDel and differentiates CMS-S maize material |
| CN111154908A (en) * | 2020-01-20 | 2020-05-15 | 中国农业科学院油料作物研究所 | KASP labeled primer for identifying Brassica crop Cam and Pol cytoplasm types and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| Genomic insights into the origin, domestication;Lei Kang;《nature genetics》;20210930;第53卷;第1392–1402页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112410453A (en) | 2021-02-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111733274B (en) | SNP locus, primer set and method for identifying cauliflower Zhe nong piny flower 80-day variety | |
| CN110241251B (en) | InDel markers for simultaneously identifying cytoplasmic male sterility restorer genes Rf1 and Rf2 of cotton | |
| CN110512025B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| CN115029465B (en) | KASP and dCAPS markers coseparated with rape seed secondary dormancy main effect QTL and application thereof | |
| CN107988409A (en) | Differentiate Rice Salt gene OsRR22 wild types or specific C APS marks, primer and the primer purposes of mutant | |
| CN108251554B (en) | Molecular marker closely linked with peach drooping branch gene and application thereof | |
| CN111926104B (en) | SSR molecular marker for identifying authenticity of sugarcane and festuca arundinacea filial generation and method thereof | |
| CN107475418B (en) | Molecular marker closely linked with tillering character of millet, primer and application | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN110184378B (en) | Molecular identification method of cytoplasmic male sterility restoring gene of triple-split cotton | |
| CN112410453B (en) | DNA molecular marker for mustard cytoplasm identification, screening method and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN106676176B (en) | Method for performing SSR (simple sequence repeat) analysis on tetraploid alfalfa by utilizing multiple PCR (polymerase chain reaction) | |
| CN106399495B (en) | SNP marker closely linked with soybean short stalk character and application thereof | |
| CN110643728B (en) | Method for improving breeding efficiency of poplar crossbreeding | |
| CN111254216B (en) | CAPS marker and method for identifying soybean RN type CMS restoring gene | |
| CN113564161A (en) | Molecular marker closely linked with bacterial wilt resistance of cultivated peanuts and application | |
| CN108285928B (en) | InDel molecular marker of corn ear row number related gene GRMZM2G098557 and application | |
| TWI447227B (en) | Method and kit for identifying phalaenopsis varieties | |
| CN111088385A (en) | Method for identifying sex of female and male heteroplant in early growth stage | |
| KR102290111B1 (en) | Primer Sets for Detecting SSR markers for Grouping of Pyropia yezoensis Cultivas, and Method for Grouping of Pyropia yezoensis Cultivas Using the Composition | |
| CN117721238B (en) | SSR molecular marker primer for distinguishing phoebe and application thereof | |
| CN117683938B (en) | KASP molecular marker closely linked with tomato fruit width and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |