CN112384632A

CN112384632A - Method for sequencing polynucleotides

Info

Publication number: CN112384632A
Application number: CN201880095214.8A
Authority: CN
Inventors: 廖莎; 陈奥; 章文蔚; 徐崇钧
Original assignee: Shenzhen Huada Zhizaojichuang Technology Co ltd
Current assignee: Qingdao Huada Zhizao Technology Co ltd
Priority date: 2018-10-11
Filing date: 2018-10-11
Publication date: 2021-02-19
Also published as: WO2020073274A1

Abstract

A method is provided for determining the sequence of a target single-stranded polynucleotide, comprising monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent label which triggers a different luminescent kinetics or type, wherein each incorporated nucleotide is identified by detecting the luminescent kinetics or type of luminescence of a chemiluminescent reaction in which the chemiluminescent label is involved and subsequently removing the chemiluminescent label.

Description

Method for sequencing polynucleotides

Technical Field

The present invention relates to a method for sequencing a polynucleotide by monitoring the sequential incorporation of nucleotides labeled with a chemiluminescent label, wherein the monitoring comprises detecting the kinetics of luminescence or the type of luminescence of the chemiluminescent reaction in which the chemiluminescent label is involved for each incorporated nucleotide.

Background

Over the past 10 years, the second generation gene sequencing technology has gradually developed from the emerging technology to the mainstream sequencing means, and gradually becomes an important detection tool in the clinical field, and plays an increasingly important role in the fields of infectious disease defense and control, genetic disease diagnosis, noninvasive prenatal screening and the like. In order to further expand the sequencing market, the sequencing instrument is civilized, and the development of a low-cost miniaturized sequencing instrument gradually becomes a development trend in the sequencing field. As a classic means of the second-generation sequencing technology, three sequencing methods based on four channels, two channels and a single channel are thousands of years, but compared with the three methods, single-channel sequencing gradually becomes a development trend in the sequencing field due to the advantages of less material consumption, lower cost, easier realization of miniaturization and portability of instruments and the like. The current products based on single color channel on the market mainly include the sequencer of ion torrent series, 454 sequencer and Iseq100 newly introduced by illumina corporation.

In the current sequencing technology based on single channel, the ion torrent series instrument has limited application range due to high error rate of sequencing of polymer structure, and the 454 Roche instrument gradually exits the sequencing market due to low sequencing accuracy and high sequencing cost. Iseq100 of Illumia corporation is based on monochromatic fluorescence technology and semiconductor technology, realizes a miniaturized sequencer, and maintains high sequencing quality. However, since the optical signal is excited by the laser, the instrument needs to be equipped with an additional laser, thereby increasing the volume of the instrument. In addition, in order to avoid the background value generated by the excitation light, special treatment is required to be performed on the semiconductor chip to filter out the background generated by the excitation light, and the treatment causes high cost, thereby increasing the sequencing cost.

Thus, there remains a need in the art for improved sequencing techniques that are less costly to sequence and maintain a higher sequencing quality.

Summary of The Invention

The present invention relates to the labeling of nucleotides with chemiluminescent labels and sequencing of polynucleotides by monitoring the sequential incorporation of such labeled nucleotides. More specifically, the invention relates to monitoring the sequential incorporation of nucleotides by detecting the luminescence kinetics or luminescence pattern of the chemiluminescent reaction in which the chemiluminescent label of each incorporated nucleotide participates.

In one aspect, the invention relates to a method for determining the sequence of a target single-stranded polynucleotide, comprising monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent label that elicits a different luminescent kinetics, wherein each incorporated nucleotide is identified by detecting the luminescent kinetics of a chemiluminescent reaction in which the chemiluminescent label is involved and subsequently removing the chemiluminescent label.

In a specific embodiment, the ribose or deoxyribose moiety of each of the nucleotides comprises a protecting group attached through a 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of each nucleotide so as to expose a 3' -OH group.

In a specific embodiment, the chemiluminescent label and the protecting group are removed under the same conditions.

In a specific embodiment, the nucleotide is selected from nucleotide A, G, C and T or U.

In particular embodiments, detection of the luminescent kinetics of a chemiluminescent reaction in which a chemiluminescent label is involved comprises contacting the chemiluminescent label with a suitable substrate to trigger the chemiluminescent reaction, and detecting the luminescent kinetics of the light emitted thereby.

In a specific embodiment, the chemiluminescent markers are selected from the group consisting of biochemical luminescent markers that elicit different luminescent kinetics and any combination thereof.

In a specific embodiment, the chemiluminescent label is selected from the group consisting of luciferases that elicit different luminescence kinetics and any combination thereof.

In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics.

In one aspect, the invention relates to a method for determining the sequence of a target single-stranded polynucleotide, comprising monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide, wherein the nucleotides are each attached to a chemiluminescent label that triggers a different luminescent type, wherein each incorporated nucleotide is identified by detecting the luminescent type of the chemiluminescent reaction in which the chemiluminescent label is involved and subsequently removing the chemiluminescent label.

In particular embodiments, detection of the luminescent kinetics of a chemiluminescent reaction in which a chemiluminescent label is involved comprises contacting the chemiluminescent label with a suitable substrate to trigger the chemiluminescent reaction, and detecting the type of luminescence emitted thereby.

In a specific embodiment, the chemiluminescent label is selected from the group consisting of biochemical chemiluminescent labels eliciting different types of luminescence, and any combination thereof.

In particular embodiments, the chemiluminescent label is selected from the group consisting of luciferases that elicit different luminescence types and any combination thereof.

In a specific embodiment, the chemiluminescent label is a combination of two luciferases that elicit different luminescence types.

In particular embodiments, the lighting types include a flash type, a glow type, and a mixed type.

In one aspect, the invention relates to a method for determining the sequence of a target single-stranded polynucleotide, comprising (a) providing one or more nucleotides, wherein the nucleotides are each attached to a different chemiluminescent label, wherein the chemiluminescent label attached to each type of nucleotide exhibits different luminescent kinetics when detected than the chemiluminescent labels attached to the other types of nucleotides; (b) incorporating one nucleotide onto the complementary strand of the target single-stranded polynucleotide; (c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of nucleotide incorporated; (d) chemiluminescent labels for removing the nucleotides of (b); and (e) optionally repeating steps (b) - (d) one or more times to determine the sequence of the target single-stranded polynucleotide.

In a specific embodiment, detecting the chemiluminescent label of the nucleotide of (b) comprises contacting the chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the kinetics of the luminescence of the light emitted thereby.

In a specific embodiment, the ribose or deoxyribose moiety of each of the nucleotides comprises a protecting group attached through a 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of the nucleotide so as to expose the 3' -OH group.

In particular embodiments, each nucleotide is contacted with the target single-stranded polynucleotide sequentially, unincorporated nucleotides are removed prior to addition of the next nucleotide, and wherein detection and removal of the chemiluminescent label is performed after addition of each nucleotide or after addition of all four nucleotides.

In particular embodiments, one, two, three, or all four nucleotides are contacted simultaneously with the target single-stranded polynucleotide, and unincorporated nucleotides are removed prior to detection, wherein detection and removal of the chemiluminescent label is performed after addition of the one, two, three, or all four nucleotides.

In one aspect, the invention relates to a method for determining the sequence of a target single-stranded polynucleotide, comprising (a) providing one or more nucleotides, wherein the nucleotides are each attached to a different chemiluminescent label, wherein the chemiluminescent label attached to each type of nucleotide exhibits a different type of luminescence when detected than the chemiluminescent labels attached to the other types of nucleotides; (b) incorporating one nucleotide onto the complementary strand of the target single-stranded polynucleotide; (c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of nucleotide incorporated; (d) chemiluminescent labels for removing the nucleotides of (b); and (e) optionally repeating steps (b) - (d) one or more times to determine the sequence of the target single-stranded polynucleotide.

In a specific embodiment, detecting the chemiluminescent label of the nucleotide of (b) comprises contacting the chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the type of light emitted thereby.

In particular embodiments, one, two, three, or all four nucleotides are contacted simultaneously with the target single-stranded polynucleotide and unincorporated nucleotides are removed prior to detection, wherein detection and removal of the chemiluminescent label is performed after addition of the one, two, three, or all four nucleotides.

In various aspects, the attachment between the nucleotide and the chemiluminescent label comprises an attachment mediated by affinity interaction.

In particular embodiments, affinity interactions include antigen-antibody interactions and biotin-avidin (e.g., streptavidin) interactions.

In particular embodiments, the chemiluminescent label is attached to the nucleotide by affinity interaction between the members by attaching the chemiluminescent label to one of the members involved in the affinity interaction and attaching the nucleotide to the other member involved in the affinity interaction.

In a specific embodiment, the member attached to the nucleotide is biotin and the member attached to the chemiluminescent label is avidin (e.g., streptavidin).

In a specific embodiment, the member attached to the nucleotide is digoxigenin and the member attached to the chemiluminescent label is an anti-digoxigenin antibody.

In a specific embodiment, the member attached to the nucleotide is digoxigenin and the member attached to the chemiluminescent label is avidin (e.g., streptavidin), wherein digoxigenin and avidin are affinity bound by an anti-digoxigenin antibody attached to biotin.

In a specific embodiment, in the nucleotides, a first nucleotide is attached to a first chemiluminescent label, a second nucleotide is attached to a second chemiluminescent label, a third nucleotide is attached to both the first and second chemiluminescent labels, and a fourth nucleotide is not attached to any chemiluminescent label.

In a specific embodiment, in the nucleotides, a first nucleotide is attached to the first luciferase, a second nucleotide is attached to the second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to any luciferase.

In other aspects, the invention also relates to a kit comprising: (a) one or more nucleotides selected from nucleotides A, G, C and T or U, wherein the nucleotides are each attached to a different chemiluminescent label, wherein the chemiluminescent label attached to each type of nucleotide exhibits a different luminescent kinetics and/or luminescent type upon detection than the chemiluminescent labels attached to the other types of nucleotides; and (b) packaging materials therefor.

In particular embodiments, the kit further comprises an enzyme and a buffer suitable for the enzyme to function.

In particular embodiments, the kit further comprises a suitable substrate for reaction with the chemiluminescent label.

Drawings

Fig. 1 shows examples of different luminescence kinetics.

FIG. 2 shows a flow diagram for sequencing a polynucleotide according to one embodiment of the present invention.

FIG. 3 shows a signal curve for sequencing a polynucleotide according to one embodiment of the present invention.

FIG. 4 shows a comparison of signal curves for sequencing polynucleotides according to one embodiment of the present invention.

Detailed Description

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. All patents, applications, and other publications mentioned herein are incorporated by reference in their entirety. If a definition set forth herein conflicts or disagrees with a definition set forth in a patent, application, or other publication incorporated by reference, the definition set forth herein controls.

As used herein, the term "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or analogs thereof. Polynucleotides may be single-stranded, double-stranded, or contain both single-stranded and double-stranded sequences. The polynucleotide molecules may be derived from double stranded DNA (dsDNA) forms (e.g., genomic DNA, PCR and amplification products, etc.), or may be derived from single stranded forms of DNA (ssdna) or RNA and may be converted to dsDNA forms, and vice versa. The exact sequence of the polynucleotide molecule may be known or unknown. The following are illustrative examples of polynucleotides: a gene or gene fragment (e.g., a probe, primer, EST, or SAGE tag), genomic DNA, a genomic DNA fragment, an exon, an intron, messenger RNA (mrna), transfer RNA, ribosomal RNA, ribozyme, cDNA, recombinant polynucleotide, synthetic polynucleotide, branched polynucleotide, plasmid, vector, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probe, primer, or amplified copy of any of the foregoing.

The polynucleotide may comprise a nucleotide or nucleotide analog. Nucleotides generally contain a sugar (e.g., ribose or deoxyribose), a base, and at least one phosphate group. The nucleotide may be abasic (i.e., lacking bases). Nucleotides include deoxyribonucleotides, modified deoxyribonucleotides, ribonucleotides, modified ribonucleotides, peptide nucleotides, modified phosphate sugar backbone nucleotides, and mixtures thereof. Examples of nucleotides include, for example, Adenosine Monophosphate (AMP), Adenosine Diphosphate (ADP), Adenosine Triphosphate (ATP), Thymidine Monophosphate (TMP), Thymidine Diphosphate (TDP), Thymidine Triphosphate (TTP), cytidine diphosphate (CMP), Cytidine Diphosphate (CDP), Cytidine Triphosphate (CTP), Guanosine Monophosphate (GMP), Guanosine Diphosphate (GDP), Guanosine Triphosphate (GTP), Uridine Monophosphate (UMP), Uridine Diphosphate (UDP), Uridine Triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP), deoxythymidine diphosphate (dTTP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP TP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), Deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP), and deoxyuridine triphosphate (dUTP). Nucleotide analogs comprising modified bases may also be used in the methods described herein. Exemplary modified bases that can be included in a polynucleotide, whether having a natural backbone or a similar structure, include, for example, inosine, xanthine (xathanine), hypoxanthine (hypoxathanine), isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2-aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halouracil, 15-halocytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azacytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halogenated adenine or guanine, 8-amino adenine or guanine, 8-thio adenine or guanine, 8-sulfanyl adenine or guanine, 8-hydroxy adenine or guanine, 5-halogen substituted uracil or cytosine, 7-methyl guanine, 7-methyl adenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine and the like. As is known in the art, certain nucleotide analogs cannot be incorporated into polynucleotides, for example, nucleotide analogs such as adenosine 5' -phosphosulfate.

The term "nucleotide a" as used herein refers to a nucleotide containing adenine (a) or a modification or analog thereof, e.g., ATP, dATP. "nucleotide G" refers to a nucleotide containing guanine (G) or a modification or analog thereof, e.g., GTP, dGTP. "nucleotide C" refers to a nucleotide containing cytosine (C) or a modification or analog thereof, e.g., CTP, dCTP. "nucleotide T" refers to a nucleotide containing thymine (T) or a modification or analog thereof, e.g., TTP, dTTP. "nucleotide U" refers to a nucleotide containing uracil (U) or a modification or analog thereof, e.g., UTP, dUTP.

Labelling of nucleotides

The present invention relates to labeling nucleotides with chemiluminescent labels, thereby allowing for the discrimination of different nucleotides.

As used herein, the term "chemiluminescent label" refers to any compound that can be attached to a nucleotide that can trigger a chemiluminescent reaction by contact with a suitable substrate to produce a detectable light signal without the need for excitation light. In general, any component that participates in a chemiluminescent reaction may be used as a chemiluminescent label as described herein, and correspondingly, the other components that participate in the chemiluminescent reaction are referred to herein as substrates for the chemiluminescent label. Examples of suitable chemiluminescent labels commonly used include, but are not limited to, peroxidase, alkaline phosphatase, luciferase, aequorin, functionalized iron-porphyrin derivatives, luminol, isoluminol, acridinium esters, sulfonamides, and the like. The substrate for the chemiluminescent label will depend on the particular chemiluminescent label used, for example the substrate for alkaline phosphatase may be AMPPD (adamantyl 1, 2-dioxan aromatic phosphate), the substrate for luciferase may be luciferin, and the substrate for acridinium ester may be sodium hydroxide and H₂O ₂Mixtures of (a) and (b), and the like. For a detailed description of chemiluminescent labels and their corresponding substrates see, for example, Larry j. kricka,chemilesence and BioluminanceTechniques, CLIN. CHEM.37/9, 1472. 1481(1991) and Tsuji, A. et al, eds (2005) Bioluminanceand cheminescence: Progress and perspectives. world Scientific: [ s.l ].].ISBN 978-981-256-118-3.596pp.。

In a preferred embodiment, the chemiluminescent label as used herein is a biochemical chemiluminescent label.

As used herein, the term "chemiluminescent label" refers to any compound that can be attached to a nucleotide that can trigger a bioluminescent reaction by contact with a suitable substrate to produce a detectable light signal without the need for excitation light. Bioluminescence is one type of chemiluminescence that is light produced by a chemical reaction that occurs in the body or in the secretions of certain types of organisms. Examples of the chemiluminescent label may include, for example, luciferase, aequorin, glucose dehydrogenase, glucose oxidase, and the like. The substrate for the chemiluminescent label will depend on the particular chemiluminescent label used, for example the substrate for luciferase may be luciferin and the substrate for aequorin may be calcium. A detailed description of the Chemiluminescent markers and their corresponding substrates can be found, for example, in Larry J.Kricka, Chemimencent and Bioluminescence Techniques, CLIN.CHEM.37/9, 1472-.

In a preferred embodiment, the biochemical luminescent marker as used herein is luciferase. In particular embodiments, the luciferase is selected from the group consisting of a daphnia magna (Gaussia) luciferase, a Renilla (Renilla) luciferase, a dinoflagellate luciferase, a firefly luciferase, a fungal luciferase, a bacterial luciferase, and a glowworm (varula) luciferase.

As used herein, "labeling a nucleotide with a chemiluminescent label" means attaching a chemiluminescent label to a nucleotide. Specific ways of attaching chemiluminescent labels to nucleotides are known to those skilled in the art, for example, see the relevant description in the following documents (all incorporated herein by reference): sambrook et al, Molecular Cloning, A Laboratory Manual, 2 nd edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.,1989), Chapter 10; U.S. Pat. nos. 4,581,333,5,283,174,5,547,842,5,656,207 and 5,658,737. In one embodiment, the chemiluminescent label may be attached directly to the nucleotide by a covalent bond. In another embodiment, the chemiluminescent label may be attached to the nucleotide by a linking group.

In a preferred embodiment, the chemiluminescent label is attached to the nucleotide by affinity interaction. As is well known to those skilled in the art, "affinity interaction" generally refers to the specific interaction between a biomolecule (e.g., a protein molecule, e.g., an enzyme, an antibody) and a substance specifically recognized by it. Affinity interactions may include, for example, antigen-antibody interactions and biotin-avidin (e.g., streptavidin) interactions. An example of an antigen-antibody interaction may be, for example, a digoxin-anti-digoxin antibody interaction.

In embodiments utilizing affinity interactions, a chemiluminescent label may be attached to one of the members involved in the affinity interaction and the nucleotide is attached to the other member involved in the affinity interaction, thereby attaching the chemiluminescent label to the nucleotide through the affinity interaction between the members.

In exemplary embodiments that utilize digoxin-anti-digoxin antibody interactions, digoxin can be linked to a nucleotide and a chemiluminescent label linked to an anti-digoxin antibody, thereby attaching the chemiluminescent label to the nucleotide through digoxin-anti-digoxin antibody interactions.

In exemplary embodiments that utilize biotin-avidin (e.g., streptavidin) interactions, biotin can be linked to the nucleotide and a chemiluminescent label linked to avidin (e.g., streptavidin), thereby attaching the chemiluminescent label to the nucleotide via the biotin-avidin (e.g., streptavidin) interaction. In another embodiment, the invention also relates to multiple labeling of nucleotides, i.e. more than one chemiluminescent label is attached to the same nucleotide. In a preferred embodiment, more than one chemiluminescent label is attached to the same nucleotide by different affinity interactions. This may be achieved, for example, by simultaneously linking members involved in different affinity interactions to the nucleotide and separately linking different chemiluminescent labels to be attached to the nucleotide to other members involved in the different affinity interactions, thereby enabling attachment of more than one chemiluminescent label to the nucleotide by the different affinity interactions. In a preferred embodiment, two different chemiluminescent labels are attached to the same nucleotide by different affinity interactions.

In an exemplary embodiment of attaching two different chemiluminescent labels to a nucleotide, the nucleotide may be linked simultaneously to one of the members involved in the first affinity interaction and one of the members involved in the second affinity interaction, and the first chemiluminescent label linked to the other member involved in the first affinity interaction, and the second chemiluminescent label linked to the other member involved in the first affinity interaction, such that the first and second chemiluminescent labels are attached to the nucleotide by the first and second affinity interactions.

In one embodiment, the first affinity interaction is a digoxin-anti-digoxin antibody interaction and the second affinity interaction is a biotin-avidin (e.g., streptavidin) interaction. In particular embodiments, the nucleotide may be linked to both digoxin and biotin, and the first chemiluminescent label linked to an anti-digoxin antibody, and the second chemiluminescent label linked to an avidin (e.g., streptavidin), such that the first and second chemiluminescent labels are attached to the nucleotide via digoxin-anti-digoxin antibody interaction and biotin-avidin (e.g., streptavidin) interaction.

In another specific embodiment, the nucleotide can be linked to both digoxin and biotin, and the first chemiluminescent label linked to an anti-digoxin antibody, and the second chemiluminescent label linked to an avidin (e.g., streptavidin), such that the first and second chemiluminescent labels are attached to the nucleotide via digoxin-anti-digoxin antibody interaction and biotin-avidin (e.g., streptavidin) interaction.

Furthermore, it is also possible to attach one chemiluminescent label to a nucleotide by combining different affinity interactions. In an exemplary embodiment, the chemiluminescent label may be attached to the nucleotide by, for example, attaching the nucleotide to one of the members involved in the first affinity interaction, attaching one of the members involved in the second affinity interaction to the other member involved in the first affinity interaction, and attaching the chemiluminescent label to the other member involved in the second affinity interaction.

In a specific embodiment, a chemiluminescent label may be attached to a nucleotide, for example, by attaching the nucleotide to digoxin, biotin to an anti-digoxin antibody, and a chemiluminescent label to an avidin (e.g., streptavidin), for example, such that the chemiluminescent label is attached to the nucleotide via digoxin-anti-digoxin antibody interaction and biotin-avidin (e.g., streptavidin) interaction.

As used herein, a "linkage" between a chemiluminescent label or nucleotide and a member involved in an affinity interaction may be any suitable form of linkage known in the art. Such linkage may include, for example, direct linkage or indirect linkage, such as via a linker, and may also include, for example, non-covalent linkage (e.g., linkage mediated by hydrogen bonding, affinity interactions, or the like or) and covalent linkage, and may also be accomplished, for example, by forming a recombinantly expressed fusion protein.

Luminescence kinetics of chemiluminescent reactions

The present invention relates to the detection of a nucleotide labeled with a chemiluminescent label by detecting the kinetics of luminescence of the chemiluminescent reaction in which the chemiluminescent label is involved.

As used herein, "the luminescence kinetics of a chemiluminescent reaction" refers to the time-varying profile of the intensity of light emitted by the chemiluminescent reaction. This can be characterized, for example, by plotting the intensity of the light emitted by the chemiluminescent reaction over time.

In the prior art, different chemiluminescent labels are typically detected and distinguished by detecting the light emitted by the chemiluminescent reaction at a specific wavelength. However, the inventors have found that detection of the luminescence kinetics of a chemiluminescent reaction can also be used to detect and distinguish between different chemiluminescent labels. Such different chemiluminescent labels each elicit different luminescence kinetics. As used herein, "induces" different luminescence kinetics means that the light emitted by the chemiluminescent reaction in which the chemiluminescent label participates has different luminescence kinetics.

Such detection methods of the invention are advantageous because chemiluminescent labels with similar emission wavelengths but different emission kinetics can be distinguished.

Thus, in a specific embodiment, the present invention relates to a method of identifying a nucleotide comprising labeling the nucleotide with chemiluminescent labels that elicit different luminescent kinetics, and detecting the luminescent kinetics of the chemiluminescent reaction in which the chemiluminescent labels participate. The invention also relates to nucleotides labelled with chemiluminescent labels which elicit different luminescent kinetics.

Thus, in a specific embodiment, a first nucleotide may be labeled with a first chemiluminescent label that elicits a first luminescence kinetics, a second nucleotide may be labeled with a second chemiluminescent label that elicits a second luminescence kinetics, and a third nucleotide may be labeled with a third chemiluminescent label that elicits a third luminescence kinetics, and the fourth nucleotide is not labeled at all, such that the four nucleotides may be identified by detecting the respective luminescence kinetics of the chemiluminescent labels.

In another embodiment, the invention also relates to the multiple labeling of nucleotides with a combination of chemiluminescent labels that elicit different luminescent kinetics. For example, chemiluminescent labels that elicit different luminescent kinetics can be attached to the same nucleotide by different affinity interactions as described above. Such a solution is advantageous because a combination of chemiluminescent labels eliciting different luminescence kinetics will elicit luminescence kinetics that differ from the luminescence kinetics elicited by each chemiluminescent label in the combination, thereby allowing for a reduction in cost.

In a specific embodiment, the invention relates to double labeling of nucleotides with a combination of two chemiluminescent labels that elicit different luminescent kinetics. In particular embodiments, a first nucleotide may be labeled with a first chemiluminescent label that elicits a first luminescent kinetics, a second nucleotide may be labeled with a second chemiluminescent label that elicits a second luminescent kinetics, and a third nucleotide may be double-labeled with the first and second chemiluminescent labels, and a fourth nucleotide without any labeling, such that the four nucleotides may be identified by detecting the respective luminescent kinetics of the chemiluminescent labels, wherein the double-labeling of the first and second chemiluminescent labels may elicit different luminescent kinetics than the first and second luminescent kinetics.

In a preferred embodiment, the nucleotide is selected from nucleotide A, G, C and T/U.

Luminescence type of chemiluminescent reaction

In a further embodiment, the invention relates to the detection of a nucleotide labeled with a chemiluminescent label by detecting the type of luminescence of the chemiluminescent reaction in which the chemiluminescent label is involved.

As used herein, the "type of luminescence of the chemiluminescent reaction" is divided according to the duration of light emitted by the chemiluminescent reaction, which generally includes a flash type and a glow type. Flash-type light emission times are within seconds, such as an acridinium ester system. Glow-type luminescence time ranges from several minutes to several tens of minutes, such as horseradish peroxidase-luminol system, alkaline phosphatase-AMPPD system, xanthine oxidase-luminol system, and the like. In the present invention, a light emission type between a flash type and a glow type is also referred to as a mixed type. Mixed-type luminescence is typically produced by mixing together flash-type luminescence and glow-type luminescence. For example, when a chemiluminescent label of the glow-initiating type is mixed with a chemiluminescent label of the glow-initiating type and simultaneously contacted with its substrate and emitted, a mixed luminescent column type intermediate between the flash type and the glow type is produced. Typical examples of the emission characteristic spectrum of the flash type, glow type, and mixed type are shown in fig. 1.

Detection of chemiluminescent labels by detecting the type of luminescence of the chemiluminescent reaction is advantageous because chemiluminescent labels with similar kinetics of luminescence but significantly different types of luminescence can be distinguished. Such detection is also particularly suitable for detecting multiple labels of chemiluminescent labels, since a combination of chemiluminescent labels having different luminescence types may result in a luminescence type that is significantly different from the individual chemiluminescent labels.

Thus, in a specific embodiment, the present invention relates to a method of identifying a nucleotide comprising labeling the nucleotide with a chemiluminescent label that triggers a different luminescent type, and detecting the luminescent type of the chemiluminescent reaction in which the chemiluminescent label is involved. The invention also relates to nucleotides labelled with chemiluminescent labels which elicit different types of luminescence.

In particular embodiments, a first nucleotide may be labeled with a first chemiluminescent label that elicits a first luminescence type, a second nucleotide may be labeled with a second chemiluminescent label that elicits a second luminescence type, and a third nucleotide may be double-labeled with the first and second chemiluminescent labels, and a fourth nucleotide may not be labeled at all, such that the four nucleotides may be identified by detecting the respective luminescence types of the chemiluminescent labels, wherein the double-labeling of the first and second chemiluminescent labels may elicit a luminescence type that is different from the first and second luminescence types.

In a specific embodiment, the first emission type is a flash type and the second emission type is a glow type. In particular embodiments, the dual label-triggered luminescence type of the first and second chemiluminescent labels is intermediate between the first luminescence type (e.g., scintillation type) and the second luminescence type (e.g., glow type), which are referred to herein as mixed types.

Sequencing of polynucleotides

The nucleotides labeled with chemiluminescent labels that elicit different luminescent kinetics, as well as the nucleotides labeled with chemiluminescent labels that elicit different luminescent types, of the present invention can be used in various nucleic acid sequencing methods. Preferably, nucleotides of the invention labeled with chemiluminescent labels that elicit different luminescent kinetics, as well as nucleotides labeled with chemiluminescent labels that elicit different luminescent types, are suitable for sequencing by synthesis. Sequencing-by-synthesis as used herein is a variety of sequencing-by-synthesis methods well known in the art. Basically, sequencing by synthesis involves first hybridizing a nucleic acid molecule to be sequenced to a sequencing primer, followed by polymerization of labeled nucleotides as described herein at the 3' end of the sequencing primer in the presence of a polymerase using the nucleic acid molecule to be sequenced as a template. Following polymerization, the labeled nucleotides are identified by detecting the label. After removing the label (i.e., chemiluminescent label as described herein) from the labeled nucleotides, the next cycle of sequencing by polymerization begins.

In addition nucleic acid sequencing methods can also be performed using the nucleotides described herein, the method disclosed in U.S. patent No. 5302509.

The method for determining the sequence of a target polynucleotide can be performed by: denaturing the target polynucleotide sequence, contacting the target single-stranded polynucleotides with different nucleotides, respectively, to form complements of the target nucleotides, and detecting incorporation of the nucleotides. The method utilizes polymerization such that a polymerase extends the complementary strand by incorporating the correct nucleotide complementary to the target. The polymerization reaction also requires special primers to initiate polymerization.

For each round of reaction, incorporation of the labeled nucleotide is performed by a polymerase, and the incorporation event is then determined. Many different polymerases exist and the most suitable polymerase is readily determined by one of ordinary skill in the art. Preferred enzymes include DNA polymerase I, Klenow fragment, DNA polymerase III, T4 or T7DNA polymerase, Taq polymerase or vent polymerase. Polymerases engineered to have specific properties may also be used.

The sequencing method is preferably performed on target polynucleotides arrayed on a solid support. The plurality of target polynucleotides may be immobilized on the solid support by linker molecules, or may be attached to particles, such as microspheres, which may also be attached to a solid support material.

The polynucleotides may be attached to the solid support by a variety of methods, including the use of biotin-streptavidin interactions. Methods for immobilizing polynucleotides on a solid support are well known in the art and include lithographic techniques and spotting each polynucleotide at a specific location on the solid support. Suitable solid supports are well known in the art and include glass slides and beads, ceramic and silicon surfaces, and plastic materials. The support is generally planar, although microbeads (microspheres) may also be used, and the latter may also be attached to other solid supports by known methods. The microspheres may be of any suitable size and are typically 10-100 nm in diameter. In a preferred embodiment, the polynucleotide is directly attached to a flat surface, preferably to a flat glass surface. The linkage is preferably by means of a covalent bond. The array used is preferably a single molecule array comprising polynucleotides located in distinct optically distinguishable regions, for example as described in international application No. WO 00/06770.

The conditions necessary to carry out the polymerization are well known to those skilled in the art. In order to carry out the polymerase reaction, it is generally first necessary to anneal to the target polynucleotide a primer sequence which is recognized by the polymerase and which serves as a starting site for subsequent extension of the complementary strand. The primer sequence may be added as a separate component to the target polynucleotide. Alternatively, the primer and target polynucleotide may each be part of a single-stranded molecule, with the primer portion and the target portion forming an intramolecular duplex, i.e., hairpin loop structure. The structure may be immobilised to the solid support at any site on the molecule. Other conditions necessary to carry out the polymerase reaction are well known to those skilled in the art and include temperature, pH, buffer composition.

Subsequently, the labeled nucleotides of the invention are contacted with the target polynucleotide to enable polymerization. The nucleotides may be added sequentially, i.e., each type of nucleotide (A, C, G or T/U) is added separately, or simultaneously.

Allowing the polymerization step to proceed for a time sufficient to incorporate one nucleotide.

Unincorporated nucleotides are then removed, for example, by subjecting the array to a washing step, and detection of incorporated labels can then be performed.

Detection can be carried out by conventional methods, for example, by contacting the synthesized nucleic acids with the corresponding substrates according to the specific chemiluminescent labels carried by the nucleotides, and detecting the kinetics or type of luminescence of the light emitted thereby.

After detection, the label can be removed using suitable conditions.

The use of labeled nucleotides of the invention is not limited to DNA sequencing techniques, and other formats including polynucleotide synthesis, DNA hybridization analysis, and single nucleotide polymorphism studies can be performed using the nucleotides of the invention. Any technique involving interaction between nucleotides and enzymes can be used with the molecules of the invention. For example, the molecule may be used as a substrate for reverse transcriptase or terminal transferase.

In a specific embodiment, the labeled nucleotides of the invention also have a 3' protecting group. In some embodiments of the invention, the protecting group and the chemiluminescent label are typically two different groups on the 3' blocked labeled nucleotide, but in other embodiments the protecting group and the chemiluminescent label may be the same group.

As used herein, the term "protecting group" means a group that prevents a polymerase (which incorporates a nucleotide containing the group onto a polynucleotide strand being synthesized) from continuing to catalyze the incorporation of another nucleotide after the nucleotide containing the group is incorporated onto the polynucleotide strand being synthesized. Such protecting groups are also referred to herein as 3' -OH protecting groups. Nucleotides comprising such protecting groups are also referred to herein as 3' blocked nucleotides. The protecting group may be any suitable group that can be added to a nucleotide, provided that the protecting group prevents additional nucleotide molecules from being added to the polynucleotide chain while being easily removed from the sugar portion of the nucleotide without destroying the polynucleotide chain. Furthermore, nucleotides modified with protecting groups need to be resistant to polymerases or other suitable enzymes for incorporating the modified nucleotides into a polynucleotide chain. Thus, the desired protecting groups exhibit long-term stability, can be incorporated efficiently by polymerases, prevent secondary or further incorporation of nucleotides, and can be removed under mild conditions, preferably aqueous conditions, without disrupting the polynucleotide structure.

The prior art has described a variety of protecting groups which meet the above description. For example, WO 91/06678 discloses that 3' -OH protecting groups include esters and ethers, -F, -NH₂,-OCH ₃,-N ₃,-OPO ₃,-NHCOCH ₃2-nitrophenylcarbonate, 2, 4-sulfenyl-dinitro and tetrahydrofuran ether. Metzker et al (Nucleic Acids Research,22(20):4259-4267,1994) disclose the synthesis and use of eight 3' -modified 2-deoxyribonucleoside 5 ' -triphosphates (3 ' -modified dNTPs). WO2002/029003 describes the use of allyl protecting groups to cap 3' -OH groups on growing strands of DNA in polymerase reactions. Superior foodAlternatively, various protecting groups reported in international application publications WO2014139596 and WO2004/018497 may be used, including those protecting groups exemplified in figure 1A of WO2014139596 and those 3' hydroxy protecting groups (i.e. protecting groups) defined in the claims, for example, and those protecting groups exemplified in figures 3 and 4 of WO2004/018497 and those protecting groups defined in the claims, for example. The above references are all incorporated herein by reference in their entirety.

The skilled person will understand how to attach suitable protecting groups to the ribose ring in order to block the interaction with the 3' -OH. The protecting group may be attached directly to the 3' position or may be attached to the 2' position (the protecting group being of sufficient size or charge to block the interaction at the 3' position). In addition, the protecting groups may be attached at the 3' and 2' positions and may be cleaved to expose the 3' OH group.

After successful incorporation of a 3 'blocked nucleotide into a nucleic acid strand, the sequencing protocol requires removal of the protecting group to create a useable 3' -OH site for continuous strand synthesis. Reagents that can remove protecting groups from modified nucleotides as used herein depend largely on the protecting group used. For example, removal of the ester protecting group from the 3' hydroxyl functionality is typically achieved by basic hydrolysis. The ease of removal of the protecting group varies widely; generally, the greater the electronegativity of the substituents on the carbonyl carbons, the greater the ease of removal. For example, a highly electronegative trifluoroacetate group is capable of rapid cleavage from the 3' hydroxyl group in methanol at pH7 (Cramer et al, 1963) and is therefore unstable during polymerization at this pH. The phenoxyacetate group is cleaved in less than 1 minute, but requires a significantly higher pH, for example with NH-/methanol (Reese and Steward, 1968). A wide variety of hydroxyl protecting groups can be selectively cleaved using chemical methods other than alkaline hydrolysis. 2, 4-dinitrophenylthio-groups can be cleaved rapidly by treatment with nucleophiles such as thiophenol and thiosulfates (Letsinger et al, 1964). Allyl ether is cleaved by treatment with hg (ii) in acetone/water (Gigg and Warren, 1968). Tetrahydrothiopyranyl ethers are removed under neutral conditions using Ag (I) or Hg (II) (Cohen and Steele, 1966; Cruse et al, 1978). Photochemical deblocking can be used with photochemically cleavable protecting groups. Several protecting groups are available for this process. The use of o-nitrobenzyl ether as a protecting group for the 2' -hydroxy functionality of ribonucleosides is known and proven (Ohtsuka et al, 1978); it was removed by irradiation at 260 nm. The alkyl o-nitrobenzyl carbonate protecting group is also removed by irradiation at pH7 (Cama and Christensen, 1978). Enzymatic cleavage blocking of the 3' -OH protecting group is also possible. It has been demonstrated that T4 polynucleotide kinase can convert the 3 '-phosphate terminus to the 3' -hydroxy terminus and can then be used as a primer for DNA polymerase I (Henner et al, 1983). This 3 '-phosphatase activity was used to remove the 3' protecting group of those dNTP analogs that contain a phosphate as a protecting group.

Other reagents that can remove a protecting group from a 3 'blocked nucleotide include, for example, phosphines (e.g., tris (hydroxymethyl) phosphine (THP)), which can, for example, remove an azide-containing 3' -OH protecting group from a nucleotide (see, for this application of phosphines, for example, the description in WO2014139596, the entire contents of which are incorporated herein by reference). Other reagents which can remove a protecting group from a 3' blocked nucleotide also include, for example, the corresponding reagents for removing 3' -allyl, 3, 4-dimethoxybenzyloxymethyl or fluoromethoxymethyl as protecting groups for 3' -OH as described in the specification of WO2004/018497, pages 114 and 116.

In embodiments of the invention, the chemiluminescent label is preferably removed after detection along with the protecting group.

In certain embodiments, chemiluminescent labels may be incorporated into the protecting group, allowing the 3' blocked nucleotide to be removed along with the protecting group after it is incorporated into the nucleic acid strand. For example, radioactive materials such as C may be added¹⁴Or P³²Incorporation into a protecting group. Alternatively, the protecting group may contain a group which does not fluoresce by itself but which can react with another substance. For example, the protecting group may be made to contain a metal binding ligand such as a carboxylic acid group, which may be reacted with an added rare earth metal ion such asThe europium or terbium ions react to produce a fluorescent substance.

In other embodiments, the chemiluminescent label may be attached to the nucleotide separately from the protecting group using a linking group. Such chemiluminescent labels may be attached, for example, to the purine or pyrimidine base of the nucleotide. In certain embodiments, the linking group used is cleavable. The use of a cleavable linker ensures that the label can be removed after detection, which avoids any signal interference with any subsequently incorporated labeled nucleotides. In other embodiments, a non-cleavable linker may be used because subsequent nucleotide incorporation is not required after incorporation of the labeled nucleotide into the nucleic acid strand, and thus removal of the label from the nucleotide is not required.

In further embodiments, the chemiluminescent label and/or linking group may be of a size or structure sufficient to block incorporation of other nucleotides into the polynucleotide strand (that is, the label itself may serve as a protecting group). The blocking may be due to steric hindrance or may be due to a combination of size, charge and structure.

Cleavable linkers are well known in the art and conventional chemical methods can be employed to attach the linker to the nucleotide base and chemiluminescent label. The linker may be attached at any position of the nucleotide base, provided that Watson-Crick base pairing is still possible. For purine bases, it is preferred if the linking group is attached through the 7 position of the purine or preferred deazapurine analogue, through an 8-modified purine, through an N-6 modified adenine or an N-2 modified guanine. In the case of pyrimidines, the linkage is preferably via positions 5 on cytosine, thymine and uracil and the N-4 position on cytidine.

The use of the term "cleavable linking group" does not imply that the entire linking group needs to be removed (e.g., from the nucleotide base). When the chemiluminescent label is attached to the base, the nucleoside cleavage site may be located at a position on the linking group which ensures that a portion of the linking group remains attached to the nucleotide base after cleavage.

Suitable linkers include, but are not limited to, disulfide linkers, acid labile linkers (including dialkoxybenzyl linkers, Sieber linkers, indole linkers, t-butyl Sieber linkers), electrophilically cleavable linkers, nucleophilically cleavable linkers, photocleavable linkers, linkers that cleave under reducing conditions, oxidizing conditions, safety-catch linkers, and linkers that cleave by an elimination mechanism. Suitable linking groups may be modified with standard chemical protecting groups, as disclosed in the following references: greene & Wuts, Protective Groups in Organic Synthesis, John Wiley & Sons. Guillier et al disclose other suitable cleavable linkers for solid phase synthesis (chem. Rev.100: 2092-2157, 2000).

The linking group can be cleaved by any suitable means, including contact with an acid, base, nucleophile, electrophile, radical, metal, reducing or oxidizing agent, light, temperature, enzyme, and the like, suitable cleavage modes for the various cleavable linking groups being described below by way of example. Typically, the cleavable linking group can be cleaved under the same conditions as the protecting group, such that only one treatment is required to remove the chemiluminescent label and protecting group.

Electrophilically cleavable linking groups are typically cleaved by protons and include acid-sensitive cleavage. Suitable electrophilically cleavable linking groups include modified benzyl systems such as trityl, p-hydrocarbyloxybenzyl and p-hydrocarbyloxybenzylamide. Other suitable linking groups include t-butyloxycarbonyl (Boc) groups and acetal systems. For the preparation of suitable linker molecules, it is also contemplated to use thiophilic metals such as nickel, silver or mercury in the cleavage of thioacetals or other sulfur-containing protecting groups. Nucleophilically cleavable linking groups include groups that are labile in water (i.e., capable of simple cleavage at basic pH), such as esters, and groups that are labile to non-aqueous nucleophiles. Fluoride ions can be used to cleave siloxane bonds in groups such as Triisopropylsilane (TIPS) or tert-butyldimethylsilane (TBDMS). Photolytic linking groups are widely used in sugar chemistry. Preferably, the light required to activate cleavage does not affect other components in the modified nucleotide. For example, if a fluorophore is used as the label, it is preferred that the fluorophore absorbs light of a different wavelength than the light required to cleave the linker molecule. Suitable linking groups include those based on O-nitrobenzyl compounds and nitroveratryl compounds. Linking groups based on benzoin chemistry may also be used (Lee et al, J.org.chem.64:3454-3460, 1999). Various linking groups are known which are susceptible to reductive cleavage. Catalytic hydrogenation using palladium-based catalysts has been used to cleave benzyl and benzyloxycarbonyl groups. Disulfide bond reduction is also known in the art. Oxidation-based methods are well known in the art. These methods include oxidation of the hydrocarbyloxybenzyl group and oxidation of the sulfur and selenium linkages. It is also within the scope of the present invention to use iodine solutions (aquous iododine) to cleave disulfides and other sulfur or selenium based linkers. Safe-handle linkers are those which cleave in two steps. In a preferred system, the first step is the generation of reactive nucleophilic centers, followed by a second step involving intramolecular cyclization, which results in cleavage. For example, the levulinate linkage may be treated with hydrazine or photochemical procedures to release the active amine which is then cyclized to cleave the ester elsewhere in the molecule (Burgess et al, J.org.chem.62:5165-5168, 1997). Elimination reactions can also be used to cleave the linking group. Base-catalyzed elimination of groups such as fluorenylmethyloxycarbonyl and cyanoethyl and palladium-catalyzed reductive elimination of allyl systems can be used.

In certain embodiments, the linking group may comprise a spacer unit. The length of the linker is not critical as long as the chemiluminescent label is maintained a sufficient distance from the nucleotide so as not to interfere with the interaction between the nucleotide and the enzyme.

In certain embodiments, the linking group may consist of a functional group similar to the 3' -OH protecting group. This would allow for the removal of the chemiluminescent label and the protecting group with only a single treatment. Particularly preferred linking groups are azide-containing linking groups that are cleavable by a phosphine.

The reagents that can remove the chemiluminescent label from the modified nucleotide as used herein will depend in large part on the chemiluminescent label used. For example, in the case where the chemiluminescent label incorporates a protecting group, the chemiluminescent label is removed using the protecting group removing reagent described above. Alternatively, where the chemiluminescent label is attached to the base of the nucleotide through a cleavable linker, the chemiluminescent label is removed using a reagent that cleaves the linker as described above. In a preferred embodiment, the same reagent is used to remove the chemiluminescent label and protecting group from the modified nucleotide, for example where the linking group consists of a functional group similar to the 3' -OH protecting group.

An exemplary embodiment of the invention

In a specific embodiment, the invention relates to a method for distinguishing four nucleotides by using different luminescence types (flash and glow) so as to realize gene sequencing. The method does not need an additional excitation light source, and can meet the development of a low-cost portable sequencer. In this method, the characteristics of two different luciferases and substrates thereof generating different luminescence forms are utilized to distinguish different nucleotides according to different luminescence curves. Sources of such luciferases include, but are not limited to, firefly, gaussia, Renilla, and the like. The luciferase may be linked to four deoxynucleotide derivatives in an affinity interaction manner.

In a more specific embodiment, the present invention relates to a method for determining the sequence of a target single-stranded polynucleotide comprising

(a) Providing four nucleotides, wherein a first nucleotide is attached to a first luciferase, a second nucleotide is attached to a second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to any luciferase, wherein the first luciferase and the second luciferase exhibit different kinetics of luminescence or types of luminescence when reacted with their substrates; in a preferred embodiment, the substrates of the first and second luciferases are the same, for example selected from coelenterazine;

(b) incorporating one nucleotide onto the complementary strand of the target single-stranded polynucleotide;

(c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of nucleotide incorporated;

(d) chemiluminescent labels for removing the nucleotides of (b); and

(e) optionally repeating steps (b) - (d) one or more times to determine the sequence of the target single-stranded polynucleotide.

Examples

1. Sequencing library construction

(1) The following DNA sequences were designed:GATATCTGCAGGCATAGAATGAATATTATTGAATCAATAATTAAAGTCGGAGGCCAAGCGGTCTTAGGAAGACAAACTAGTACGTCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTTTACAACTACGATAATGGGCTGGATACATGGAATGATTATAGATATATTAAGGAATAATGTTAATTAATGCCTAAATTAATTAATCTAAGGGGGTTAATACT TCAGCCTGTGATATCfor the convenience of library construction, identical oligonucleotide sequences such as underlined fonts at both ends of the sequence are added, and a linker sequence such as an italicized sequence of BGI-SEQ500 is inserted in the middle. The above sequence was submitted to Kinry Biotech, Inc. and the synthesized sequence was inserted into pUC57 vector for unlimited use and transformed into E.coli.

(2) Appropriate amounts of E.coli containing known libraries were cultured and plasmids were extracted, and the following pair of primers were designed: GATATCTGCAGGCAT, GATATCACAGGCTGA, the known sequence was amplified and the PCR product was purified using magnetic beads as follows (Table I) and scheme II). Adding the purified PCR product into split oligo (ATGCCTGCAGATATCGATATCACAGGCTGA) to perform cyclization library building according to BGIseq-500 SE50 cyclization library building kit and process for later use;

watch I (enzyme from BGI)

Table two:

2. amplification of library sequences

A96-well streptavidin-coated plate from Thermo fisher was purchased, 100ul of 1uM 5' -end biotin-modified primer (RCA) GCCATGTCGTTCTGTGAGCCAAGG was incubated with one of the wells at normal temperature for 30min, the reaction solution was removed, 6ng of the library constructed in example 1 and 20ul of DNB preparation buffer I in BGISEQ-500 kit were added, primer hybridization was performed with the biotin-modified primer at 60 ℃ for 5min, 40ul of DNB polymerase I and 4ul of DNB polymerase II in BGISEQ-500 sequencing kit were added, the reaction was performed at 30 ℃ for 60min, the reaction was terminated by heating to 65 ℃, and the reaction solution was carefully removed. Adding 100ul of 5uM sequencing primer GCTCACAGAACGACATGGCTACGATCCGACTT, hybridizing at normal temperature for 30min, and carefully removing the reaction solution;

3. sequencing

(1) Acme Bioscience outsourced synthesis of 4 dNTPs as shown:

dATP-Biotin

dCTP-Biotin-digoxin

dGTP

dTTP-digoxin

(2) Preparation of reagents:

the following reagents required in the sequencing reaction were prepared

Polymerization reaction solution: 50mM Tris-HCl, 50mM NaCl, 10mM (NH4)₂SO ₄0.02mg/ml polymerase BG9(BGI), 3mM MgSO₄1mM EDTA, 1uM each of the above four dNTPs;

polymerization buffer: 50mM Tris-HCl, 50mM NaCl, Twen200.05%;

elution buffer: 5XSSC, Twen200.05%;

antibody reaction solution: TBST buffer, 1uM anti-digoxin-s-biotin (Abcam);

antibody eluent: TBST buffer

Autoluminescence enzyme reaction solution 1: TBST buffer, 2ug/ml SA-gluc (M2) -glow (avidity);

autoluminescence-enzyme reaction liquid 2: TBST buffer, 2ug/ml SA-gluc (8990) -flash (avidity)

Substrate luminescent liquid: 50mM tris-HCl 0.5mM NaCl buffer was prepared and 50 Xcoelenterazine (nonolight) was diluted to 1X;

excision buffer: 20mM THPP, 0.5M NaCl, 0.05% tween 20;

(3) sequencing reaction:

the sequencing flow is shown in FIG. 2.

a. Polymerization: adding 100ul polymerase reaction solution into the well of the library amplified in the step (1), raising the temperature of an enzyme-labeling instrument to 55 ℃, reacting for 3min to polymerize four dNTPs onto the amplified temperature control, carefully removing the reaction solution, adding 100ul elution reaction solution, gently blowing and beating for several times, and removing the elution reaction solution

b. Binding of the autoluminescence enzyme 1: adding 100ul of autoluminescence enzyme reaction solution 1, incubating at 35 deg.C for 30min to bind SA-gluc (M2) -glow to dNTP-biotin, removing reaction solution, adding eluent, gently blowing for several times, and removing eluent;

c. binding of the autoluminescence enzyme 2: adding 100ul antibody reaction solution, incubating at 35 deg.C for 3min to bind anti-digoxin-s-s-biotin to dNTP-digoxin, removing reaction solution, adding 200ul antibody eluate, gently blowing for several times, and removing antibody eluate; adding 100ul of self-luminous enzyme 2 reaction solution, reacting at 35 ℃ for 2min to enable SA-gluc (8990) -flash to be combined on dNTP-digoxin by combining with anti-digoxin-s-biotin, and removing the reaction solution; adding 200ul of eluent, slightly blowing and beating for several times, and removing the eluent;

d. self-luminescence detection: setting parameters of an enzyme-labeling instrument, adding substrate luminescent liquid, and detecting a self-luminescent curve; reading corresponding bases according to the signal curve graph;

e. cutting; removing the self-luminous reaction solution, adding 200ul of elution buffer solution, gently blowing and beating for several times, removing the elution buffer solution, adding 100ul of excision reaction solution, reacting at 55 ℃ for 3min, and removing the excision reaction solution; adding 200ul of elution buffer solution for cleaning, and repeating the cleaning for three times;

f. repeating the steps a-e, and performing next cycle sequencing;

(4) sequencing results

The a.10bp sequencing signal curve is shown in FIG. 3 and FIG. 4:

b. and (3) analyzing a sequencing result:

comparing the signal change curves of all cycles, as shown in the following chart, it can be judged according to the form of signal drop of each cycle:

nucleotide A, cycle 1, cycle 4, cycle 5, cycle 8;

nucleotide T, cycle 2, cycle 7

Nucleotide C, cycle 3, cycle 6, cycle 9

Nucleotide G cycle 10

[ 28.11.2018 corrected according to rule 26 ] and the base sequence of the first 10bp of the library to be tested: TACAACTACG are matched.

Claims

A method for determining the sequence of a target single-stranded polynucleotide comprising monitoring the sequential incorporation of nucleotides complementary to the target single-stranded polynucleotide,

wherein the nucleotides are each attached to a chemiluminescent label that elicits a different luminescent kinetic or type,

wherein each incorporated nucleotide is identified by detecting the kinetics or type of luminescence of the chemiluminescent reaction in which the chemiluminescent label is involved and subsequently removing the chemiluminescent label.
The method of claim 1, wherein the ribose or deoxyribose moiety of each of the nucleotides comprises a protecting group attached through a 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of each nucleotide so as to expose a 3' -OH group,

for example, the chemiluminescent label and the protecting group are removed under the same conditions,

for example, the nucleotide is selected from nucleotide A, G, C and T or U.
The method of claim 1 or 2, for example, the detection of the luminokinetics of a chemiluminescent reaction in which the chemiluminescent label is involved comprises contacting the chemiluminescent label with a suitable substrate to trigger the chemiluminescent reaction, and detecting the luminokinetics of the light emitted thereby,

for example, the chemiluminescent label is selected from the group consisting of biochemical chemiluminescent labels eliciting different luminescent kinetics and any combination thereof,

for example, the chemiluminescent label is selected from the group consisting of luciferases eliciting different luminescence kinetics and any combination thereof,

for example, the chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics,

for example, detection of the luminescence kinetics of a chemiluminescent reaction in which the chemiluminescent label is involved comprises contacting the chemiluminescent label with a suitable substrate to trigger the chemiluminescent reaction, and detecting the type of luminescence emitted thereby,

for example, the chemiluminescent label is selected from the group consisting of biochemical chemiluminescent labels eliciting different types of luminescence, and any combination thereof,

for example, the chemiluminescent label is selected from the group consisting of luciferases that elicit different luminescence types and any combination thereof,

for example, the chemiluminescent label is a combination of two luciferases that elicit different luminescence types,

for example, the lighting types include a flash type, a glow type, and a mixed type,

for example, in the nucleotides a first nucleotide is attached to a first chemiluminescent label, a second nucleotide is attached to a second chemiluminescent label, a third nucleotide is attached to both the first and second chemiluminescent labels, and a fourth nucleotide is not attached to any chemiluminescent label,

for example, in the nucleotides, a first nucleotide is attached to a first luciferase, a second nucleotide is attached to a second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to any luciferase.
The method of any one of claims 1-3, attaching a chemiluminescent label to the nucleotide by affinity interaction,

for example, the affinity interaction includes antigen-antibody interaction and biotin-avidin (such as streptavidin) interaction,

for example, by attaching a chemiluminescent label to one of the members involved in the affinity interaction and a nucleotide to the other member involved in the affinity interaction, thereby attaching the chemiluminescent label to the nucleotide through the affinity interaction between the members,

for example, the member attached to the nucleotide is biotin, the member attached to the chemiluminescent label is avidin (e.g., streptavidin),

for example, the member linked to the nucleotide is digoxigenin, the member linked to the chemiluminescent label is an anti-digoxigenin antibody,

for example, the member attached to the nucleotide is digoxigenin and the member attached to the chemiluminescent label is avidin (e.g., streptavidin), wherein digoxigenin and avidin are affinity bound by an anti-digoxigenin antibody attached to biotin.
A method for determining the sequence of a target single-stranded polynucleotide comprising

(a) Providing one or more nucleotides, wherein the nucleotides are each attached to a different chemiluminescent label, wherein the chemiluminescent label attached to each type of nucleotide exhibits a different luminescent kinetics or luminescent type upon detection than the chemiluminescent labels attached to the other types of nucleotides;

(b) incorporating one nucleotide onto the complementary strand of the target single-stranded polynucleotide;

(c) detecting the chemiluminescent label of the nucleotide of (b) to determine the type of nucleotide incorporated;

(d) chemiluminescent labels for removing the nucleotides of (b); and

(e) optionally repeating steps (b) - (d) one or more times to determine the sequence of the target single-stranded polynucleotide.
The method of claim 5, wherein the ribose or deoxyribose moiety of each of the nucleotides comprises a protecting group attached through a 2' or 3' oxygen atom, wherein the protecting group is modified or removed after incorporation of the nucleotide so as to expose a 3' -OH group,

for example, the chemiluminescent label and the protecting group are removed under the same conditions,

for example, the nucleotide is selected from nucleotide A, G, C and T or U.
The method of claim 5 or 6, e.g., said detecting a chemiluminescent label of the nucleotide of (b) comprises contacting said chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the kinetics of the luminescence of the light emitted thereby,

for example, the chemiluminescent label is selected from the group consisting of biochemical chemiluminescent labels eliciting different luminescent kinetics and any combination thereof,

for example, the chemiluminescent label is selected from the group consisting of luciferases eliciting different luminescence kinetics and any combination thereof,

for example, the chemiluminescent label is a combination of two luciferases that elicit different luminescence kinetics,

for example, said detecting the chemiluminescent label of the nucleotide of (b) comprises contacting said chemiluminescent label with a suitable substrate to trigger a chemiluminescent reaction, and detecting the type of luminescence emitted thereby,

for example, the chemiluminescent label is selected from the group consisting of biochemical chemiluminescent labels eliciting different types of luminescence, and any combination thereof,

for example, the chemiluminescent label is selected from the group consisting of luciferases that elicit different luminescence types and any combination thereof,

for example, the chemiluminescent label is a combination of two luciferases that elicit different luminescence types,

for example, the lighting types include a flash type, a glow type, and a mixed type,

for example, in the nucleotides a first nucleotide is attached to a first chemiluminescent label, a second nucleotide is attached to a second chemiluminescent label, a third nucleotide is attached to both the first and second chemiluminescent labels, a fourth nucleotide is not attached to any chemiluminescent label,

for example, in the nucleotides, a first nucleotide is attached to a first luciferase, a second nucleotide is attached to a second luciferase, a third nucleotide is attached to both the first luciferase and the second luciferase, and a fourth nucleotide is not attached to any luciferase.
The method of any one of claims 5-7, attaching a chemiluminescent label to the nucleotide by affinity interaction,

for example, the affinity interaction includes antigen-antibody interaction and biotin-avidin (such as streptavidin) interaction,

for example, by attaching a chemiluminescent label to one of the members involved in the affinity interaction and a nucleotide to the other member involved in the affinity interaction, thereby attaching the chemiluminescent label to the nucleotide through the affinity interaction between the members,

for example, the member attached to the nucleotide is biotin, the member attached to the chemiluminescent label is avidin (e.g., streptavidin),

for example, the member linked to the nucleotide is digoxigenin, the member linked to the chemiluminescent label is an anti-digoxigenin antibody,

for example, the member attached to the nucleotide is digoxigenin and the member attached to the chemiluminescent label is avidin (e.g., streptavidin), wherein digoxigenin and avidin are affinity bound by an anti-digoxigenin antibody attached to biotin.
The method of any one of claims 5-8, wherein each nucleotide is contacted with the target single-stranded polynucleotide sequentially, unincorporated nucleotides are removed prior to addition of the next nucleotide, and wherein the detection and removal of the chemiluminescent label is performed after addition of each nucleotide or after addition of all four nucleotides.
The method of claim 9, wherein one, two, three, or all four nucleotides are simultaneously contacted with the target single-stranded polynucleotide and unincorporated nucleotides are removed prior to detection, wherein detection and removal of the chemiluminescent label is performed after addition of the one, two, three, or all four nucleotides.
A kit, comprising: (a) one or more nucleotides selected from nucleotides A, G, C and T or U, wherein the nucleotides are each attached to a different chemiluminescent label, wherein the chemiluminescent label attached to each type of nucleotide exhibits a different type of luminescence or luminescence upon detection than the chemiluminescent labels to which the other type of nucleotide is attached; and (b) packaging materials therefor.
The kit of claim 11, further comprising an enzyme and a buffer suitable for the enzyme to function.
The kit of claim 11 or 12, further comprising a suitable substrate for reaction with the chemiluminescent label.