RU2794177C1 - Method for single-channel sequencing based on self-luminescence - Google Patents

Abstract

FIELD: biotechnology.

SUBSTANCE: invention relates to biotechnology, in particular, to a method for sequencing based on one fluorescent dye, in which a self-luminescence signal is used to establish differences of sequential inclusion of different nucleotides, thereby implementing determination of a polynucleotide sequence.

EFFECT: obtainment of a method for sequencing.

14 cl, 1 dwg, 2 tbl, 2 ex

Description

FIELD OF TECHNOLOGY

The present invention relates to the field of nucleic acid sequencing. In particular, the present invention relates to a self-luminescence-based single-channel sequencing method in which the self-luminescence signal is used to distinguish between the sequential incorporation of different nucleotides, thereby realizing polynucleotide sequencing.

BACKGROUND OF THE INVENTION

The DNA sequencing technology includes first generation DNA sequencing technology represented by the Sanger sequencing method and second generation DNA sequencing technology represented by Illumina Hiseq2500, Roche 454, ABI Solid, BGISEQ-500, etc. In 1977, Sanger invented the dideoxy end-terminated sequencing method and became the first generation of sequencing technology. In 2001, based on the first generation sequencing technology, the human genome project was completed. Sanger sequencing has the characteristics of a simple experimental operation, intuitive and accurate results, and a short experimental period. It has a wide range of applications in clinical gene mutation detection and genotyping, which require high timeliness of detection results. However, the disadvantages of the Sanger sequencing method are low productivity and high cost, which limit its use in large-scale gene sequencing. To overcome the shortcomings of the Sanger sequencing method, second generation sequencing technology has emerged. Compared with the first generation DNA sequencing technology, the second generation DNA sequencing technology has the characteristics of high sequencing throughput, low cost, high automation and single molecule sequencing. Taking Hiseq2500V2 sequencing technology as an example, data for 10-200 billion bases can be obtained in one experimental process, and the average cost of sequencing per base is less than 1/1000 of the sequencing cost of Sanger sequencing method, and the resulting sequencing results can be processed and analyzed directly through a computer. Thus, second generation DNA sequencing technology is very suitable for large scale sequencing.

Second-generation DNA sequencing technologies currently developed mainly include sequencing-by-ligation (SBL) technology and sequencing-by-synthesis (SBS) technology. Representative examples of these sequencing technologies include the SOLiD sequencing method developed at Applied Biosystems, the combinatorial probe-anchor ligation (cPAL) method independently developed at Complete Genomics, and the combinatorial probe-anchor synthesis (cPAS) method developed at Beijing Genomics Institute (BGI) , the Illumina sequencing method jointly developed by Illumina and Solexa Technology, etc. In these sequencing methods, Illumina and Complate Genomics adopt a light signal detection method, and in order to realize the identification and differentiation of 4 kinds of bases (A, T/U, C and G), it is usually necessary to use 4 kinds of fluorescent dyes to label respectively these 4 grounds. In this case, in order to read the fluorescent signal that each base carries, the sequencing device must be equipped with at least two monochromatic excitation light sources and at least two cameras, resulting in an expensive manufacturing cost and a large volume of the sequencing device.

In the past 10 years, second-generation gene sequencing technologies have gradually grown from emerging technologies to the mainstream of sequencing methods, and have gradually become important testing tools in the clinical field, thus playing an increasing role in the prevention and control of infectious diseases, diagnosis of genetic diseases, and non-invasive prenatal care. screening. In order to further expand the sequencing market and popularize sequencers, the development of cheap and miniaturized sequencers has gradually become a development trend in the field of sequencing. As the classical method of second generation sequencing technology, the three sequencing methods of quad-channel, dual-channel and single-channel basis have their own advantages; in comparison, single-channel sequencing has the advantages of less consumable consumption, lower cost, easier to obtain miniaturization and portable devices, and gradually become the development trend in the field of sequencing. At present, monochrome channel based products on the market mainly include ion flow series sequencers, 454 sequencers, and Illumina's latest Iseq100.

Among current single channel based sequencing technologies, the use of ion flow device series is limited due to the high error rate of polymer structure sequencing. Similarly, Roche's 454 device is also being phased out of the sequencing market due to insufficient sequencing accuracy and high sequencing costs. Illumina's Iseq100 is based on monochromatic fluorescence and semiconductor technology to realize sequencer miniaturization and maintain high quality sequencing. However, since the optical signal is emitted by a laser, the device is equipped with an additional laser, which increases the volume of the device. In addition, in order to remove the background value generated by the excitation light, special processing needs to be carried out on the semiconductor chip to filter out the background generated by the excitation light, and this processing may result in high costs and increased sequencing cost.

Thus, there is a need in the art for a low cost sequencing method that does not require an external excitation light source and does not require additional design to filter out the background generated by the laser light source.

SUMMARY OF THE INVENTION

In order to overcome the above technical problems, the inventors of the present invention developed a novel sequencing method in which a self-luminescence system signal is used to distinguish between the four bases A, (T/U), C and G. Thus, the luminescence signal used to carry out the sequencing method of the present of the invention is derived from bioluminescence or chemiluminescence, thus there is no need for an additional laser configuration, and no need for an additional design to filter out the background generated by the laser light source, thus reducing the cost of sequencing. The sequencing device used in the sequencing method of the present invention can even be conveniently carried for immediate/in situ detection. In addition, the 3'-hydroxyl of the deoxyribonucleotide used in the sequencing method of the present invention is modified and blocked. During the sequencing process, only one deoxyribonucleotide can be synthesized in each reaction, ensuring that only one deoxyribonucleotide is bound in each reaction, thus improving sequencing accuracy.

In one aspect, the present invention relates to a method for sequencing a nucleic acid molecule, comprising the following steps:

(1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support;

(2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label;

(3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced;

(4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand;

(5) allowing the duplex from the previous step to be contacted with two different luciferases and performing a ligation reaction where the two luciferases can be specifically ligated to a first molecular label and a second molecular label, respectively; then allowing the luciferases to undergo a fluorescent reaction in the presence of a substrate, and detecting the emitted fluorescence signal;

(6) removing the molecular label of each nucleotide;

(7) optionally, repeating steps (3) to (7) to obtain information about the sequence of the nucleic acid molecule.

In one embodiment of the present invention, self-luminescence detection of the nucleotide to be sequenced is performed by ligation of the luciferase and the nucleotide derivative, so that no additional excitation light source is needed. In a specific embodiment, the ligation of the luciferase and the nucleotide is carried out by specific binding of the label on the luciferase and the corresponding label on the derivative of the nucleotide. In a specific embodiment, the first nucleotide is ligated to the first luciferase, the second nucleotide is ligated to the second luciferase, the third nucleotide is ligated to the first luciferase and the second luciferase, and the fourth nucleotide is not ligated to any luciferase. The luminescence signals of the four bases are then detected by passing the respective substrates of the two luciferases; when the substrate of the first luciferase is passed through, the first and third nucleotides emit light; when the substrate of the second luciferase is passed through, the second and third nucleotides emit light, so that the bases can be identified according to the luminescence of four nucleotides.

Thus, in an exemplary embodiment, the method for sequencing a nucleic acid molecule of the present invention includes the following steps:

(1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support;

(2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label;

(3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced;

(4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand;

(5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding two different luciferases to carry out a ligation reaction, where the two luciferases can be specifically ligated to the first molecular label and the second molecular label, respectively;

(6) removing unbound luciferase by using an elution buffer;

(7) adding a first luciferase substrate and detecting a fluorescent signal at the same time;

(8) removing the solution from the reaction of the previous stage;

(9) adding a second luciferase substrate and detecting a fluorescent signal at the same time;

(10) removing the solution from the reaction of the previous stage;

(11) removing the molecular label and the 3' protecting group of each nucleotide;

(12) optionally, removing the solution from the reaction of the previous step;

(13) optionally, repeating steps (3) to (12) to obtain information about the sequence of the nucleic acid molecule.

In a specific embodiment, the ligation of two luciferases with nucleotides can also be performed separately. For example, the first luciferase labeled with the first method can be added first to allow it to undergo a ligation reaction with the nucleotide labeled with the first molecule, then the unbound first luciferase is removed by using an elution buffer, the substrate of the first luciferase is added, and a fluorescent signal is detected at the same time; then, the second luciferase labeled with the second method can be added to allow it to undergo a ligation reaction with the nucleotide labeled with the second molecule, then the unbound second luciferase is removed by using an elution buffer, the substrate of the second luciferase is added, and a fluorescent signal is detected at the same time . Specifically, the present invention relates to a method for sequencing a nucleic acid molecule, comprising the following steps:

(1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support;

(2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label;

(3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced;

(4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand;

(5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding the first luciferase to carry out a ligation reaction, where the first luciferase can specifically bind to the first molecular label;

(6) removing unbound first luciferase by using an elution buffer;

(7) adding a first luciferase substrate and detecting a fluorescent signal at the same time;

(8) removing the solution from the reaction of the previous stage;

(9) adding a second luciferase to carry out a ligation reaction, where the second luciferase can specifically bind to the second molecular label;

(10) removing unbound second luciferase by using an elution buffer;

(11) adding a second luciferase substrate and detecting a fluorescent signal at the same time;

(12) removing the solution from the reaction of the previous stage;

(13) optionally, removing the molecular label and the 3' protecting group of each nucleotide;

(14) optionally, repeating steps (3) - (13) or (3) - (11) one or more times to obtain information about the sequence of the nucleic acid molecule.

In a specific embodiment, the two luciferases may be the same, which can specifically bind to the first molecular tag and the second molecular tag, respectively, i.e. only one luciferase and substrate is used, and the first luciferase labeled by the first method and the second luciferase labeled by the second method , separately ligated to the nucleotide. For example, the first luciferase labeled with the first method is added first, allowed to undergo a ligation reaction with the nucleotide labeled with the first molecule, then the unbound first luciferase is removed using an elution buffer, a luciferase substrate is added, and a fluorescent signal is detected at the same time; then, the second luciferase labeled with the second method is added, allowed to undergo a ligation reaction with the nucleotide labeled with the second molecule, then the unbound second luciferase is removed using the elution buffer, the luciferase substrate is added, and the fluorescent signal is detected at the same time. Specifically, the present invention relates to a method for sequencing a nucleic acid molecule, comprising the following steps:

(1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support;

(2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label;

(3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced;

(4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand;

(5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding the first luciferase to carry out a ligation reaction, where the first luciferase can specifically bind to the first molecular label;

(6) removing unbound first luciferase by using an elution buffer;

(7) adding a luciferase substrate and detecting a fluorescent signal at the same time;

(8) removing the solution from the reaction of the previous stage;

(9) adding a luciferase denaturant reagent;

(10) removing the solution from the reaction of the previous stage;

(11) adding a second luciferase to carry out a ligation reaction, where the second luciferase can specifically bind to the second molecular label;

(12) removing unbound second luciferase by using an elution buffer;

(13) adding a luciferase substrate and detecting a fluorescent signal at the same time;

(14) optionally, removing the solution from the reaction of the previous step;

(15) optionally, removing the molecular label and the 3' protecting group of each nucleotide;

(16) optionally, repeating steps (3) - (15) or (3) - (13) one or more times to obtain information about the sequence of the nucleic acid molecule.

In another aspect, the present invention also provides a polynucleotide sequencing kit comprising:

(a) four compounds that are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label; And

(b) two luciferases that can specifically bind to the first molecular tag and the second molecular tag, respectively, and the two luciferases can be the same or different.

In some preferred embodiments, the kit of the present invention further comprises: a reagent and/or device for isolating a nucleic acid molecule from a sample; a reagent for pre-treatment of the nucleic acid molecule; a support for binding the nucleic acid molecule to be sequenced; a reagent for binding (eg, covalently or non-covalently binding) the nucleic acid molecule to be sequenced to the support; a primer for initiating a nucleotide polymerization reaction; a polymerase for conducting a nucleotide polymerization reaction; one or more buffer solutions; one or more wash solutions; or any combination of them.

DETAILED DESCRIPTION

Unless otherwise defined, all technical and scientific terms used in the present description have the same meaning, which is generally accepted by a person skilled in the field to which the present invention relates. The entire content of all patents, applications and other publications mentioned in the present description is given by reference. If the definitions given in the present description are in conflict or inconsistency with the definitions described in patents, applications and other publications, the contents of which are given in the present description by reference, the definitions described in the present description shall take precedence.

As used herein, the term "polynucleotide" refers to deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or analogues thereof. Polynucleotides can be single stranded, double stranded, or contain both single and double stranded sequences. Polynucleotide molecules may be derived from the double-stranded form of DNA (dsDNA) (e.g., genomic DNA, PCR and amplification products, etc.), or may be derived from the single-stranded form of DNA (ssDNA) or RNA, and may be converted to the dsDNA form, and vice versa. The exact sequence of a polynucleotide molecule may or may not be known. The following are illustrative examples of polynucleotides: gene or gene fragment (e.g. probe, primer, EST or SAGE tag), genomic DNA, genomic DNA fragment, exon, intron, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozyme, cDNA , recombinant polynucleotide, synthetic polynucleotide, branched polynucleotide, plasmid, vector, isolated DNA of any sequence, isolated RNA of any sequence, and nucleic acid probe, primer, or amplified copy of any of the above sequences.

Polynucleotides may include nucleotides or nucleotide analogs. A nucleotide typically contains a saccharide (ie, ribose or deoxyribose), a base, and at least one phosphate group. A nucleotide may be devoid of a nitrogenous base (ie free from a base). The nucleotide includes a deoxyribonucleotide, a modified deoxyribonucleotide, a ribonucleotide, a modified ribonucleotide, a peptide nucleotide, a modified peptide nucleotide, a modified phosphate-saccharide backbone nucleoside, and mixtures thereof. Examples of a nucleotide include, for example, adenosine monophosphate (AMP), adenosine diphosphate (ADP), adenosine triphosphate (ATP), thymidine monophosphate (TMP), thymidine diphosphate (TDP), thymidine triphosphate (TTP), cytidine monophosphate (CMP), cytidine diphosphate (CDP), cytidine triphosphate (CTP) , guanosine monophosphate (GMP), guanosine diphosphate (GDP), guanosine triphosphate (GTP), uridine monophosphate (UMP), uridine diphosphate (UDP), uridine triphosphate (UTP), deoxyadenosine monophosphate (dAMP), deoxyadenosine diphosphate (dADP), deoxyadenosine triphosphate (dATP), deoxythymidine monophosphate (dTMP) , deoxythymidine diphosphate (dTDP), deoxythymidine triphosphate (dTTP), deoxycytidine diphosphate (dCDP), deoxycytidine triphosphate (dCTP), deoxyguanosine monophosphate (dGMP), deoxyguanosine diphosphate (dGDP), deoxyguanosine triphosphate (dGTP), deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP) and deoxyuridine monophosphate (dUMP), deoxyuridine diphosphate (dUDP) and deoxyuridine diphosphate (dUDP) and . Nucleotide analogs containing modified bases can also be used in the methods described herein. Whether it has a natural backbone or a similar structure, an exemplary modified base that may be contained in a polynucleotide includes, for example, inosine, xatanin, hypoxatanin, isocytosine, isoguanine, 2-aminopurine, 5-methylcytosine, 5-hydroxymethylcytosine, 2 -aminoadenine, 6-methyladenine, 6-methylguanine, 2-propylguanine, 2-propyladenine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 15-halogenated uracil, 15-halogenated cytosine, 5-propynyluracil, 5-propynylcytosine, 6 -azouracil, 6-azocytosine, 6-azothymine, 5-uracil, 4-thiouracil, 8-halogenated adenine or guanine, 8-aminoadenine or 8-aminoguanine, 8-thioadenine or 8-thioguanine, 8-thioalkyladenine or 8-thioalkylguanine, 8-hydroxyadenine or 8-hydroxyguanine, 5-halogenated uracil or cytosine, 7-methylguanine, 7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, etc. . As is known in the art, specific nucleotide analogs, for example nucleotide analogs such as adenosine 5'-phosphoryl sulfate, cannot be included in a polynucleotide.

Generally speaking, nucleotides include nucleotides A, C, G, T, or U. As used herein, the term "nucleotide A" refers to a nucleotide containing adenine (A) or a modified form or analog thereof, such as ATP, dATP. "Nucleotide G" refers to a nucleotide containing guanine (G) or a modified form or analogue thereof, such as GTP, dGTP. "Nucleotide C" refers to a nucleotide containing cytosine (C) or a modified form or analogue thereof, such as CTP, dCTP. "Nucleotide T" refers to a nucleotide containing thymine (T) or a modified form or analogue thereof, such as TTP, dTTP. "Nucleotide U" refers to a nucleotide containing uracil (U) or a modified form or analogue thereof, such as UTP, dUTP.

Nucleotide labeling

The present invention relates to labeling a nucleotide using various labels, alone or in combination, so that various luciferases can be ligated to the nucleotide. As used herein, a molecular label for labeling a nucleotide and a label specifically binding to it can be any pairing molecules that can specifically bind to each other. Specific binding between the pairing members realizes the ligation of the nucleotide with luciferase. Illustrative pairing members include, but are not limited to: (a) a hapten or antigenic compound in combination with an appropriate antibody or binding portion or fragment thereof, such as digoxin anti-digoxin antibody, N3G anti-N3G antibody, FITC anti-FITC antibody; (b) an aptamer nucleic acid and a protein; (c) a non-immune binding pair (eg, biotin-avidin, biotin-streptavidin, biotin-neutravidin); (d) a hormone-binding protein; (e) a receptor agonist or antagonist of the receptor; (f) lectin carbohydrate; (g) an enzyme cofactor; (h) an enzyme inhibitor enzyme; and (i) a pair of complementary oligonucleotides or polynucleotides capable of forming a nucleic acid duplex.

In a specific embodiment, the first molecular label and the second molecular label are low molecular weight labels that are selected from biotin, digoxin, N3G, or FITC. The two luciferases can specifically bind to the first molecular tag and the second molecular tag, respectively. For example, in a particular embodiment, the first molecular label is biotin, then the first luciferase may be streptavidin-labeled luciferase; the second molecular label is digoxin, the second luciferase may be an anti-digoxin labeled luciferase that is different from the first luciferase, and the second luciferase can also be an anti-digoxin labeled luciferase that is the same as the first luciferase. The source of luciferase includes, but is not limited to, firefly, gaussia , Renilla , and other organisms. For example, streptavidin-labeled luciferase may be SA-Gluc: Gaussia princeps streptavidin-luciferase from Adivity Company. The luciferase labeled with an anti-digoxin antibody can be an anti-digoxin-Gluc antibody or an anti-digoxin-Nluc antibody.

As used herein, the expression "the first compound is associated with the first molecular label" means that all of the first compound is associated with the first molecular label, or part of the first compound is associated with the first molecular label, while the rest of the first compound is not associated with the molecular label. label. In the same way, the expression "the second compound is associated with the second molecular label" means that all of the second compound is associated with the second molecular label, or part of the second compound is associated with the second molecular label, while the rest of the second compound is not associated with the molecular label. The expression "the third compound is associated with the first molecular label and with the second molecular label" means that all of the third compound is associated with the first molecular label and the second molecular label, or part of the third compound is associated with the first molecular label and the second molecular label, while the rest the third compound is not associated with molecular labels.

Polynucleotide sequencing

Preferably, nucleotides ligated to various luciferases of the present invention are suitable for sequencing by synthesis. Sequencing-by-synthesis methods as used herein are various sequencing-by-synthesis methods well known in the art. In general, sequencing by synthesis involves first hybridizing the nucleic acid molecule to be sequenced with a sequencing primer and then, in the presence of a polymerase, polymerizing nucleotides ligated to various luciferases as described herein at the 3' end of the primer for sequencing using the nucleic acid molecule to be sequenced as a template. After polymerization, the nucleotide is identified by detecting a fluorescent signal emitted by luciferase. After removal of the luciferase from the labeled nucleotide, the next cycle of polymer sequencing is carried out.

The method for determining the sequence of a target polynucleotide can be carried out as follows: denaturing the sequence of the target polynucleotide, bringing the target polynucleotide into contact with different nucleotides, respectively, so as to form a nucleotide complementary to the target nucleotide, and detecting the included nucleotide. The method uses polymerization to allow the polymerase to extend the complementary chain by incorporating the correct nucleotides that are complementary to the target. The polymerization reaction also requires a special primer to initiate the polymerization.

For each cycle of the reaction, the incorporation of the nucleotide is carried out by the polymerase, and then the incorporation event is measured. There are many different polymerases, and it is easy for one skilled in the art to determine the most appropriate polymerase. Preferred enzymes include DNA polymerase I, Klenow fragment, DNA polymerase III, T4 or T7 DNA polymerase, Taq polymerase, or vent polymerase. It is also possible to use polymerases designed to have specific properties.

The sequencing method is preferably performed on a target polynucleotide arranged on a solid support. Through linker molecules, a plurality of target polynucleotides can be immobilized on a solid support, or can be attached to particles such as microspheres, and the particles can also be attached to a solid support material.

The polynucleotide can be attached to a solid support in a variety of ways, including using the biotin-streptavidin interaction. Methods for immobilizing polynucleotides on a solid support are well known in the art and include lithographic techniques and spotting each polynucleotide at a specific position on a solid support. Suitable solid substrates are known in the art and include glass plates and beads, ceramic and silicone surfaces, and plastic materials. The support is usually flat, although microbeads (microspheres) can also be used and the latter can also be attached to other solid supports in known ways. The microspheres may be of any suitable size and are typically 10-100 nanometers in diameter. In a preferred embodiment, the polynucleotide is directly attached to a flat surface, preferably a flat glass surface. The linking is preferably carried out in the form of a covalent bond. The array used is preferably a single molecule array that includes polynucleotides located in unique optically distinct regions, for example as described in International Patent Application No. WO00/06770.

The necessary conditions for polymerization are well known to the person skilled in the art. In order to carry out the polymerase reaction, typically the primer sequence must first hybridize to the target polynucleotide. The primer sequence is amenable to recognition by the polymerase and serves as an initiation site for subsequent extension of the complementary strand. The primer sequence can be added as an independent component relative to the target polynucleotide. In addition, each of the primer and the target polynucleotide may constitute part of a single stranded molecule, and the primer part and the target part form an intramolecular duplex, ie, a stem-loop structure. The structure can be immobilized on a solid substrate through any position of the molecule. Other conditions required for the polymerase reaction are well known to those skilled in the art, and these conditions include temperature, pH, and buffer composition.

Subsequently, the labeled nucleotides of the present invention are contacted with a target polynucleotide to allow polymerization. Nucleotides can be added sequentially, that is, each type of nucleotide (A, C, G or T/U) is added separately or added at the same time.

The polymerization steps are allowed to proceed for a period of time sufficient to incorporate one nucleotide.

Then, non-incorporated nucleotides are removed, for example, by removing the solution phase from the reaction system in the previous step, leaving the duplexes attached to the support.

Subsequently, two luciferases containing different luciferases can be added to carry out the ligation reaction. The two luciferases can specifically bind to molecular labels for nucleotide labeling, respectively, thus realizing ligation of the luciferase to the inserted nucleotide. Then, by adding appropriate luciferase substrates and detecting a fluorescent signal, identification of the included nucleotide is carried out. It is also possible to add two kinds of luciferases containing the same luciferase to carry out the ligation reaction. Luciferases can specifically bind to molecular labels for labeling nucleotides, respectively, thus realizing ligation of the luciferase to the included nucleotide. Then, by adding an appropriate luciferase substrate and detecting a fluorescent signal, the identification of the included nucleotide is realized.

In a specific embodiment, the four deoxyribonucleotide analogs are labeled with different small molecule labels, i.e., biotin (abbreviated as B) and digoxin (abbreviated as D), e.g., nucleotide A is labeled with B, nucleotide C is labeled with B and D, nucleotide T is labeled with D, and nucleotide G is not labeled. The 3'-hydroxyl groups of the four deoxyribonucleotide analogs labeled with different small molecules are all blocked to ensure that only one deoxyribonucleotide is bound during each sequencing reaction. During the sequencing reaction, a mixture of four labeled deoxyribonucleotide analogues and a sequencing polymerase is first introduced, under the action of the polymerase, one deoxyribonucleotide analogue is inserted into the 3' end of the growing nucleic acid chain, in accordance with the principle of complementary base pairing. By removing the solution phase from the reaction system in the previous step, leaving the duplex bound to the support, unbound deoxyribonucleotide analogs can be removed. Two luciferases are then added containing different luciferases, where the first luciferase is labeled using streptavidin that binds to nucleotide A or nucleotide C labeled using small molecule B and the second luciferase is labeled using an anti-digoxin antibody that binds to nucleotide C or T nucleotide labeled with small molecule D. After unbound luciferases are removed using elution buffer, the substrate of the first luciferase is added, the nucleotide ligated to the first luciferase emits light, and the signal is detected by a detector; the substrate of the second luciferase is added, the nucleotide ligated to the second luciferase emits light, and the signal is detected by a detector so that the luminescence shown in the following table is obtained and the base can be identified.

First detection Second detection A 1 0 C 1 1 G 0 0 T 0 1

In a particular embodiment, ligation of two luciferases containing different luciferases with labeled nucleotides and signal detection can be performed separately. First, a first luciferase that is labeled with streptavidin and binds to nucleotide A or nucleotide C labeled with small molecule B is added. , emits light, and the signal is detected by a detector. After removing the reaction solution, a second luciferase labeled with an anti-digoxin antibody is added that binds to the C nucleotide or the T nucleotide labeled with a small molecule D, and then the unbound second luciferase is removed using the elution buffer, the second luciferase substrate, nucleotide , ligated to the second luciferase, emits light and a signal is detected by a detector. Thus, the luminescence shown in the table above is obtained, and base identification can be carried out.

In another specific embodiment, ligation of two luciferases containing the same luciferase with labeled nucleotides and signal detection is performed separately. First, a first luciferase that is labeled with streptavidin and binds to nucleotide A or nucleotide C labeled with small molecule B is added. emits light, and the signal is detected by a detector. Then, a reagent is added that denatures the first luciferase; after removing the reaction solution, add a second luciferase that is labeled with an anti-digoxin antibody and binds to the C nucleotide or T nucleotide labeled with a small molecule D, then unbound second luciferase is removed by using an elution buffer, add the luciferase substrate, base, ligated with a second luciferase emits light and a signal is detected by a detector. Thus, the luminescence shown in the table above is obtained, and base identification can be carried out.

Fluorescence signal detection

The method for detecting a fluorescent signal is well known in the art. For example, it can be implemented by means of a device that detects the fluorescence wavelength. Such devices are well known in the art. For example, such a device may be a confocal scanning microscope that scans the surface of a solid support using a laser to visualize a fluorophore directly associated with the nucleic acid molecule to be sequenced. In addition, a sensitive 2-D detector, such as a charge-coupled detector (CCD), can be used, for example, to observe each received signal. You can also use, for example, other methods, such as near-field scanning optical microscopy (SNOM).

Deleting a label

After detection, suitable conditions can be used to remove the label attached to the nucleotides.

In a specific embodiment, the labeled nucleotides of the present invention also have a 3' protecting group. In some embodiments of the present invention, the protecting group and the label are usually two different groups on the 3' capped labeled nucleotide, but in other embodiments, the protecting group and the label may also be the same group.

As used herein, the term "protecting group" refers to a group that prevents a polymerase (which incorporates a group-containing nucleotide into a nascent polynucleotide strand) from non-stop catalyzing the incorporation of another nucleotide after the group-containing nucleotide has been incorporated into a nascent polynucleotide strand. Such a protecting group is also referred to herein as a 3'-OH protecting group. A nucleotide containing such a protecting group is also referred to herein as a 3'-blocked nucleotide. The protecting group may be any suitable group that can be added to a nucleotide, provided that the protecting group can prevent the incorporation of an additional nucleotide molecule into the polynucleotide chain and can be easily removed from the saccharide portion of the nucleotide without destroying the polynucleotide chain. In addition, a nucleotide modified with a protecting group must be resistant to polymerases or other suitable enzymes with respect to incorporation of the modified nucleotide into the polynucleotide chain. Thus, the ideal protecting group has long-term stability, can be efficiently incorporated by polymerase, prevents secondary or subsequent incorporation of nucleotides, and can be removed under mild conditions, preferably aqueous conditions, that do not degrade the structure of the polynucleotide.

The prior art describes a variety of protecting groups corresponding to the above description. For example, WO 91/06678 describes that 3'-OH protecting groups include esters and esters, -F, -NH ₂ , -OCH ₃ , -N ₃ , -OPO ₃ , -NHCOCH ₃ , 2-nitrophenyl carbonate, 2,4-hyposulfonyldinitro and tetrahydrofuran ether. Metzker et al. (Nucleic Acids Research, 22(20): 4259-4267, 1994) describes the synthesis and use of eight 3'-modified 2-deoxyribonucleoside-5'-triphosphates (3'-modified dNTPs). WO2002/029003 describes the use of an allyl protecting group to cap the 3'-OH group of a growing DNA strand in a polymerase reaction. Preferably, various protecting groups published in International Application Publications WO2014139596 and WO2004/018497 can be used, including, for example, the protecting groups illustrated in Figure 1A and the 3'-hydroxyl protecting groups (i.e., protecting groups) defined in WO2014139596, and for example the protecting groups illustrated in Figures 3 and 4 and the groups defined in WO2004/018497. The entire contents of the above references are incorporated herein by reference.

One skilled in the art will understand how to attach a suitable protecting group to the ribose ring to block interaction with the 3'-OH. The protecting group may be directly attached at the 3' position, or may be attached at the 2' position (the protecting group has sufficient size or charge to block interaction at the 3' position). In addition, the protecting group can be attached at the 3' and 2' positions, and can be cleaved off to expose the 3'-OH group.

After the successful incorporation of the 3'-blocked nucleotide into the growing nucleic acid strand, the sequencing method requires the removal of the protecting group to obtain a usable 3'-OH region for uninterrupted strand synthesis. Reagents that can remove protecting groups from modified nucleotides, as used herein, depend to a large extent on the protecting groups used. For example, removal of the ester protecting group from the 3'-hydroxyl group is usually carried out by alkaline hydrolysis. Ease of removing protecting groups varies greatly; in general, the greater the electronegativity of the substituent on the carbonyl carbon, the greater the ease of removal. For example, the highly electronegative trifluoroacetic acid group can be rapidly cleaved from the 3'-hydroxyl group at pH 7 in methanol (Cramer et al., 1963) because it is unstable during polymerization at this pH. The phenoxyacetate group is cleaved off within less than 1 minute, but a much higher pH is needed, eg using NH-/methanol (Reese and Steward, 1968). Various hydroxy protecting groups can be selectively cleaved off using chemical methods other than alkaline hydrolysis. The 2,4-dinitrophenylthio group can be rapidly cleaved off by treatment with nucleophiles such as thiophenol and thiosulfate (Letsinger et al., 1964). The allyl ester can be cleaved off by treatment with Hg(II) in acetone/water (Gigg and Warren, 1968). Tetrahydrothianyl ether can be removed under neutral conditions using Ag(I) or Hg(II) (Cohen and Steele, 1966; Cruse et al., 1978). Photochemical deblocking can be used with photochemically cleavable protecting groups. There are several protecting groups that can be used in this method. The use of o-nitrobenzyl ether as a protecting group for the 2'-hydroxyl functional group of a ribonucleoside is known and confirmed (Ohtsuka et al., 1978); and it is removed by irradiation at 260 nm. The alkyl carbonate protecting group of o-nitrobenzyl carbonate is also removed by irradiation at pH 7 (Cama and Christensen, 1978). Enzymatic deblocking of the 3'-OH protecting group is also possible. It has been shown that T4 polynucleotide kinase can convert the 3'-phosphate end to the 3'-hydroxy end, which can then be used as a primer for DNA polymerase I (Henner et al., 1983). This 3'-phosphatase activity is used to remove the 3'-protecting group of these dNTP analogs containing phosphate as a protecting group.

Other reagents that can remove protecting groups from 3'-blocked nucleotides include, for example, phosphines (for example, tris(hydroxymethyl)phosphine (THP)), which can, for example, remove an azide-containing 3'-OH protecting group from a nucleotide (for this use of phosphine, see, for example, WO2014139596, the entire content of which is incorporated herein by reference). Other reagents that can remove protecting groups from 3'-protected nucleotides also include, for example, the corresponding reagents described on pages 114-116 in WO2004/018497 for removing 3'-allyl, 3,4-dimethoxybenzyloxymethyl or fluoromethoxymethyl, used as a protective group 3'-OH.

In one embodiment of the present invention, the nucleotide label is preferably removed along with the protecting group after detection.

In specific embodiments, the label can be included in a protecting group, thus allowing its removal along with the protecting group after incorporation of the 3'-blocked nucleotide into the nucleic acid strand.

In other embodiments, the label can be attached to the nucleotide using a linking group and a protecting group separately. Such a label can, for example, be attached to the purine or pyrimidine base of the nucleotide. In specific embodiments, the linking group used is cleavable. The use of a cleavable linking group ensures that the label can be removed after detection, which eliminates any signal interference with any labeled nucleotides subsequently included. In other embodiments, a non-cleavable linking group can be used because once a labeled nucleotide has been incorporated into the nucleic acid strand, there is no need for subsequent incorporation of the nucleotide, thus there is no need to delabel the nucleotide.

In other embodiments, the label and/or linking group may be of a size or structure sufficient to block the incorporation of other nucleotides into the polynucleotide chain (ie, the label itself may serve as a protecting group). Blocking may be due to steric hindrance, or it may be due to a combination of size, charge and structure.

Cleavable linking groups are well known in the art, and conventional chemical methods can be used to attach the linking group to the nucleotide base and label. The linking group can be attached to any position of the nucleotide base, as long as Watson-Crick base pairing can still be performed. For purine bases, it is preferred that the linking group is attached via the 7 position of purines or preferred deazapurine analogs, via 8-modified purines, via N-6-modified adenines or N-2-modified guanines. For pyrimidines, the preferred linkage is through the 5 position of cytosine, thymine and uracil, and the N-4 position of cytidine.

The use of the term "cleavable linking group" does not mean that the entire linking group must be removed (eg, from the nucleotide base). When the label is attached to a base, the nucleoside cleavage site may be located at a position on the linking group, where the position may ensure that a portion of the linking group remains attached to the nucleotide base after cleavage.

Suitable linking groups include, but are not limited to, disulfide linking groups, acid labile linking groups (including dialkoxybenzyl linking groups, Sieber linking groups, indole linking groups, Sieber t-butyl linking groups), electrophilically cleavable linking groups, nucleophilically cleaving linking groups, photo-cleaving linking groups linking groups that can be cleaved off under reducing and oxidizing conditions, fused linking groups, and linking groups that can be cleaved off by elimination mechanisms. Suitable linking groups can be modified using standard chemical protecting groups as described in the following documents: Greene & Wuts, protecting groups in Organic Synthesis, John Wiley & Sons. In Guillier et al. other suitable leaving groups for solid phase synthesis have been described (Chem. Rev. 100:2092-2157, 2000).

The linking group can be cleaved off by any suitable method, including exposure to acids, bases, nucleophiles, electrophiles, free radicals, metals, reducing or oxidizing agents, light, temperature, enzymes, etc., and suitable methods for cleaving various cleavable linking groups are illustratively described. below. Generally, the cleavable linking group can be cleaved off under the same conditions as those for the protecting group, so that only one treatment is necessary to remove the label and the protecting group.

The linking group for electrophilic cleavage is typically cleaved off by a proton, which includes acid-sensitive cleavage. Suitable electrophilically cleavable linking groups include modified benzyl systems such as trityl, p-hydrocarbonyloxybenzyl ester, and p-hydrocarbonyloxybenzylamide. Other suitable linking groups include tert-butoxycarbonyl (Boc) groups and acetal systems. To obtain suitable binding molecules, the use of thiophilic metals such as nickel, silver or mercury in the elimination of thioacetals or other sulfur-containing protecting groups can also be considered. A linking group for nucleophilic cleavage includes a group that is unstable in water (ie, can be easily cleaved off at an alkaline pH), such as an ester, and a group that is unstable with respect to a non-aqueous nucleophile. Fluoride ions can be used to cleave silicon-oxygen bonds in groups such as triisopropylsilane (TIPS) or tert-butyldimethylsilane (TBDMS). Photolysable linking groups are widely used in saccharide chemistry. Preferably, the light required to activate the cleavage does not affect other components in the modified nucleotide. For example, if a fluorophore is used as a label, it is preferred that the fluorophore absorb light at a wavelength other than the light needed to cleave the binding molecule. Suitable linking groups include those based on O-nitrobenzyl compounds and nitroveratrol compounds. Linking groups based on benzoin chemistry can also be used (Lee et al., J. Org. Chem. 64:3454-3460, 1999). Many linking groups are known to be susceptible to reductive cleavage. Catalytic hydrogenation using palladium-based catalysts has been used to cleave benzyl and benzyloxycarbonyl groups. Restoration of the disulfide bond is also known in the art. Oxidation based methods are well known in the art. These methods include the oxidation of the hydrocarbonyloxybenzyl group and the oxidation of linking groups based on sulfur and selenium. Also included within the scope of the present invention is the use of aqueous iodine to cleave disulfide and other sulfur or selenium based linking groups. "Fused" linkers are linkers that are cleaved in two steps. In a preferred system, the first step is the preparation of a reactive nucleophilic center and the subsequent second step involves an intramolecular cyclization that results in cleavage. For example, the levulinate bond can be treated using hydrazine or photochemical methods to release the active amine, and the amine can then be cyclized to cleave the ester elsewhere in the molecule (Burgess et al., J. Org. Chem. 62: 5165-5168, 1997 ). Elimination reactions can also be used to cleave off linking groups. Base-catalyzed elimination of groups such as fluorenylmethoxycarbonyl and cyanoethyl and palladium-catalyzed reductive elimination of allyl systems can be used.

In specific embodiments, the linking group may contain a spacer unit. The length of the linking group is not important, provided that the label and nucleotide are kept at a sufficient distance so as not to interfere with the interaction between the nucleotide and the enzyme.

In specific embodiments, the linking group may consist of a functional group similar to the 3'-OH protecting group. This may allow that only one treatment is necessary to remove the label and the protecting group. A particularly preferred linking group is an azide-containing linking group which can be cleaved off with a phosphine.

Reagents that can remove a label from a modified nucleotide, as used herein, depend to a large extent on the label used. For example, in the case where a protecting group is included in the label, the deprotecting reagent described above is used to remove the label. Alternatively, when the label is attached to the base of the nucleotide via a cleavable linking group, the label is removed using a reagent that cleaves off the linking group as described above. In a preferred embodiment, the same reagent is used to remove the label and the protecting group from the modified nucleotide, for example, in the case where the linking group consists of a functional group similar to the 3'-OH protecting group.

Kit

The present invention also relates to a kit for sequencing a polynucleotide, which contains:

(a) four compounds that are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl group (-OH) at the 3'-position of ribose or deoxyribose of the four compounds is protected by a protecting group; And

the first compound is bound to the first molecular label,

the second compound is linked to the second molecular label,

the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label,

the fourth compound is not associated with any molecular label; And

(b) two different luciferases that can specifically bind to the first molecular tag and the second molecular tag, respectively.

In a specific embodiment, the molecular labels used to label the four compounds and the labels used to label the two luciferases are as defined above.

In some preferred embodiments, the kit of the present invention further comprises: a reagent and/or device for isolating a nucleic acid molecule from a sample; a reagent for pre-treatment of the nucleic acid molecule to be sequenced; a support for binding the nucleic acid molecule to be sequenced; a reagent for binding (eg, covalently or non-covalently binding) the nucleic acid molecule to be sequenced to the support; a primer for initiating a nucleotide polymerization reaction; a polymerase for conducting a nucleotide polymerization reaction; one or more buffer solutions; one or more wash solutions; or any combination of them.

In some preferred embodiments, the kit of the present invention further comprises a reagent and/or device for isolating a nucleic acid molecule from a sample. Methods for isolating nucleic acid molecules from samples are well known in the art. Thus, various reagents and/or devices for isolating nucleic acid molecules, such as cell disruption reagents, DNA precipitation reagents, DNA washing reagents, DNA dissolving reagents, RNA precipitation reagents, RNA washing reagents, dissolution reagents RNA, protein removal reagents, DNA removal reagents (for example, when the target nucleic acid molecule is RNA), RNA removal reagents (for example, when the target nucleic acid molecule is DNA), and any combination thereof, can be given the configuration of the kit according to the present invention, if necessary.

In some preferred embodiments, the kit of the present invention further comprises a nucleic acid molecule pretreatment reagent. In the kit of the present invention, the reagents used for the pretreatment of nucleic acid molecules are not subject to further restrictions, and can be selected according to actual needs. Reagents used to pretreat nucleic acid molecules include, for example, reagents for fragmenting nucleic acid molecules (e.g., DNase I), reagents for terminating nucleic acid molecules (e.g., a DNA polymerase such as T4 DNA polymerase, DNA- Pfu polymerase, Klenow DNA polymerase), linker molecules, label molecules, reagents for binding linker molecules to target nucleic acid molecules (e.g., a ligase such as T4 DNA ligase), reagents for repairing nucleic acid breaks (e.g., DNA- a polymerase that lacks 3'-5'-exonuclease activity but has 5'-3'-exonuclease activity), reagents for amplifying nucleic acid molecules (eg, DNA polymerase, primer, dNTP), reagents (eg, chromatographic columns) for separating and purifying nucleic acid molecules, and any combination thereof.

In some preferred embodiments, the kit of the present invention further comprises a scaffold for binding the nucleic acid molecule to be sequenced. The substrate may have any of the technical features and any combination thereof, as detailed above for the substrate.

For example, according to the present invention, the substrate can be made from various suitable materials. Such materials include, for example, inorganic materials, natural polymers, synthetic polymers, and any combination thereof. Specific examples include, but are not limited to, cellulose, cellulose derivatives (e.g., nitrocellulose), acrylic resin, glass, silica gel, polystyrene, gelatin, polyvinylpyrrolidone, vinyl-acrylamide copolymer, and polystyrene cross-linked, for example, using divinylbenzene (see , e.g. Merrifield Biochemistry 1964, 3, 1385-1390), polyacrylamide, latex, dextran, rubber, silicone, plastic, natural sponge, metal-plastic, cross-linked dextran (e.g. Sephadex™), agarose gel (Sepharose™) and other supports known to the person skilled in the art.

In some preferred embodiments, the support used to bind the nucleic acid molecule to be sequenced may be a solid support, including an inert substrate or matrix (eg, glass plate, polymer beads, etc.). The inert substrate or matrix is functionalized, for example, using intermediate materials containing reactive groups to allow covalent attachment of biomolecules such as polynucleotides. Examples of such a support include, but are not limited to, polyacrylamide hydrogels supported on an inert substrate such as glass, in particular the polyacrylamide hydrogels described in WO2005/065814 and US2008/0280773, where the full contents of patent applications are incorporated herein by reference. In such embodiments, biomolecules (eg, polynucleotides) can be directly covalently attached to an intermediate material (eg, a hydrogel), and the intermediate material itself can be non-covalently attached to a substrate or matrix (eg, a glass substrate). In some preferred embodiments, the substrate is a glass plate or silicon wafer that has been surface-modified with a layer of avidin, amino, acrylamidesilane, or aldehyde based chemistries.

According to the present invention, the substrate or solid substrate is not limited in size, shape and configuration. In some embodiments, the substrate or solid substrate is a planar structure such as a wafer, chip, microchip, and/or array. The surface of such a substrate may be in the form of a flat layer. In some embodiments, the substrate or its surface is non-planar, such as the inner or outer surface of a tube or container. In some embodiments, the support or solid support includes microspheres or beads. In specific preferred embodiments, the support used to bind the nucleic acid molecule to be sequenced is an array of beads or wells.

In some preferred embodiments, the kit of the present invention further comprises a reagent for binding (eg, covalently or non-covalently) the nucleic acid molecule to be sequenced to the support. Such a reagent includes, for example, reagents that activate or modify the nucleic acid molecule (eg, its 5' end), such as phosphoric acid, thiol, amine, carboxylic acid, or aldehyde; reagents that activate or modify the surface of the substrate, such as amino-alkoxysilane (eg, aminopropyltrimethoxysilane, aminopropyltriethoxysilane, 4-aminobutyltriethoxysilane, etc.); cross-linking agent such as succinic anhydride, phenyl diisothiocyanate (Guo et al., 1994), maleic anhydride (Yang et al., 1998), 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC), meta -maleimidobenzoic acid-N-hydroxysuccinimide (MBS), N-succinimidyl[4-iodoacetyl]aminobenzoic acid (SIAB), succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), N-γ-maleimidobutyryloxy-succinimide ester (GMBS), succinimidyl-4-(p-maleimidophenyl)butyrate (SMPB); and any combination of them.

In specific preferred embodiments, the kit of the present invention further comprises a primer to initiate the nucleotide polymerization reaction. According to the present invention, the primer is not subject to further restrictions provided that it can specifically hybridize to a region of the target nucleic acid molecule. In some exemplary embodiments, the primer may be 5-50 bp long, such as 5-10, 10-15, 15-20, 20-25, 25-30, 30-35, 35-40, 45, 45-50 bp In some illustrative embodiments, the primer may contain natural or non-natural nucleotides. In some illustrative embodiments, the primer contains or consists of naturally occurring nucleotides. In some exemplary embodiments, the primer contains a modified nucleotide, such as a locked nucleic acid (LNA). In specific preferred embodiments, the primer contains a universal primer sequence.

In specific preferred embodiments, the kit of the present invention further comprises a polymerase for carrying out the nucleotide polymerization reaction. According to the present invention, you can use a variety of suitable polymerase. In some exemplary embodiments, the polymerase may use DNA as a template for synthesizing a new strand of DNA (eg, DNA polymerase). In some exemplary embodiments, the polymerase may use RNA as a template for synthesizing a new strand of DNA (eg, reverse transcriptase). In some exemplary embodiments, the polymerase may use DNA or RNA as a template to synthesize a new RNA strand (eg, RNA polymerase). Thus, in specific preferred embodiments, the polymerase is selected from the group consisting of DNA polymerase, RNA polymerase and reverse transcriptase.

In specific preferred embodiments, the kit of the present invention further comprises one or more buffer solutions. Such buffers include, but are not limited to, DNase I buffer, DNA polymerase buffer, ligase buffer, nucleic acid molecule elution buffer, nucleic acid molecule dissolution buffer, nucleotide polymerization buffer ( e.g. PCR) and ligation buffer. The kit of the present invention may contain any one or more of the above buffer solutions.

In specific preferred embodiments, the kit of the present invention further comprises one or more wash solutions. Examples of such washing solutions include, but are not limited to, phosphate buffer, citrate buffer, Tris-HCl buffer, acetate buffer, carbonate buffer, and the like. The kit of the present invention may contain any one or more of the above washing solutions.

Beneficial Effects of the Present Invention

Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

(1) The method of the present invention uses only two molecular labels to realize four nucleotide labeling, and realizes self-luminescence using luciferase. Thus, for the sequencing device used in the sequencing method of the present invention, it is neither necessary to equip an excitation light source nor need additional design to filter out the background generated by the laser light source. On the one hand, the manufacturing cost of the sequencing apparatus is greatly reduced, which is beneficial for the promotion and application of the sequencing apparatus and the sequencing method; on the other hand, the volume of the sequencing device is greatly reduced, making the sequencing device lighter and easier to carry.

(2) The 3'-hydroxyl group of the deoxyribonucleotide used in the sequencing method of the present invention is modified and blocked. During the sequencing process, only one deoxyribonucleotide can be synthesized per reaction, which ensures that only one deoxyribonucleotide can be included per reaction, thus improving sequencing accuracy.

Although the specific embodiments of the present invention have been described in detail, one skilled in the art will appreciate that various modifications and changes can be made to the details, in accordance with all explanations that have been described, and these changes are included within the protection scope of the present invention. The entire scope of the present invention is given by the appended claims and any equivalents thereof.

BRIEF DESCRIPTION OF THE DRAWINGS:

Figure 1: Method for conjugating an antibody and Nluc, where the enzyme in the figure is Nluc and the antibody in the figure is an anti-digoxin antibody.

EXAMPLES

Example 1

1. Construction of the library for sequencing

For ease of library construction, oligonucleotide sequences (bold) are added at the two ends of the sequence, and a linker sequence (filled part) from BGISEQ-500 is inserted in the middle part, the bold italic part shows the first 10 bp. bases of the sequence to be sequenced. The above sequence was synthesized by GenScript Biotechnology Company, and for unlimited use of the sequence, the synthesized sequence was inserted into the pUC57 vector and transformed into E. coli cells.

(2) An appropriate amount of E. coli containing a known library was cultured and plasmids isolated; designed the following primer pairs: GATATCTGCAGGCAT (SEQ ID NO: 2, primer 1), GATATCACAGGCTGA (SEQ ID NO: 3, primer 2), the known sequence was amplified according to the following system (Table 1) and method (Table 2), and the product PCR was purified using magnetic beads. Composite oligonucleotide (ATGCCTGCAGATATCGATATCACAGGCTGA, SEQ ID NO: 4) was added to the purified PCR product and circularized and library constructed according to the instruction and method from the library construction kit using BGISEQ-500 SE50 (MGI) circularization for later use;

Table 1: (used BGI's own enzymes)

1 x 5X Precision Enzyme Reaction Solution 20 µl dNTP mix (each 10 mM) 5 µl High Precision Enzyme (1 U/µl) 1 µl Primer 1 (20 µM) 6 µl Primer 2 (20 µM) 6 µl Plasmid DNA template (20 ng/µl) 1 µl Water for molecular biology 61 µl Overall volume 100 µl

Table 2:

98°C 3 min; 98°C 20 s

60°C 15 s 33 cycles 72°C 30 s 72°C 5 minutes 4°C ∞

2. Amplification of Library Sequences

A streptavidin-coated 96-well plate was purchased from Thermo Fisher Company, and 100 µl of 1 µM 5'-modified biotin primer GCCATGTCGTTCTGTGAGCCAAGG (SEQ ID NO: 5) was incubated in one of the wells at room temperature for 30 minutes, the reaction liquid was discarded, 6 ng of the library constructed in section 1 above and 20 μl of DNB I preparation buffer in the BGISEQ-500 kit (manufactured by MGI) were added, primer hybridization using the above biotin-modified primer was carried out at 60°C in for 5 minutes, 40 µl of DNB polymerase I in the BGISEQ-500 sequencing kit (manufactured by MGI) and 4 µl of DNB polymerase II were added, the reaction was carried out at 30°C for 60 minutes, after heating to 65°C, the reaction was stopped, and the reaction solution was carefully discarded. 100 µl of 5 µM sequencing primer GCTCACAGAACGACATGGCTACGATCCGACTT (SEQ ID NO: 6) was added, hybridization was performed at room temperature for 30 minutes, and the reaction solution was carefully discarded;

3. Sequencing

(1) Four dNTPs as shown below were synthesized by Acme Bioscience as an external company:

dATP-linker-biotin

dCTP-linker-biotin-digoxin

dTTP-linker-digoxin

dGTP

(2) Preparation of two luciferases:

a. SA-Gluc (purchased from adivity)

b. Antibody (purchased from Abcam) conjugated to Nluc (purchased from adivity) to generate Ab-Nluc

The protein binding kit was purchased from Thermo and the antibody and Nluc were conjugated according to the instructions and method as shown in Figure 1.

(3) Getting Reagents:

Preparation of other reagents needed in the sequencing reaction

Polymerization reaction solution: 50 mM Tris-Hcl, 50 mM NaCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.02 mg/ml BG9 polymerase (BGI), 3 mM MgSO ₄ , 1 mM EDTA, 1 μM each the above four dNTPs

Elution buffer: 5XSSC, 0.05% Tween-20;

Enzyme Binding Reaction Solution: The above two enzymes were diluted in TBST buffer, and the final concentration of each of the two enzymes was 2 μg/ml;

Substrate 1 reaction solution: buffer 50 mM Tris-Hcl 0.5 mM Nacl was prepared and 50X coelenterazine (nanolight) was diluted to 1X;

Substrate 2 reaction solution: buffer 50 mM Tris-Hcl 0.5 mM Nacl was prepared and 50X substrate NLuc FLASH (nanolight) was diluted to 1X;

Cut buffer: 20 mM THPP, 0.5 M NaCl, 50 mM Tris-HCl, pH 9.0, 0.05% tween-20;

(4) Sequencing reaction:

Sequencing method:

a. Polymerization: 100 μl of the polymerase reaction solution was added to each well of the amplified library, the temperature of the microplate reader was raised to 55°C, and the reaction was carried out for 3 minutes, so that four dNTPs were polymerized on the amplified library. After carefully discarding the reaction solution, 100 µl of the elution reaction solution was added, carefully pipetted several times to remove the elution reaction solution;

b. Luciferase ligation: 100 µl enzyme binding reaction solution was added, incubated at 35°C for 30 minutes, so that SA-gluc was ligated with biotin-labeled dCTP and dATP derivatives, and Ab-Nluc was ligated with digoxin-labeled dCTP and dTTP derivatives , the reaction solution was discarded, the elution solution was added and carefully pipetted several times to remove the elution solution;

c. Enzyme 1 signal detection: Set appropriate parameters of the microplate reader, add Substrate 1 reaction solution, detect Enzyme 1 signal, and record the highest signal value;

d. Enzyme 2 signal detection: Substrate 1 reaction solution was removed, appropriate microplate reader parameters were set, Substrate 2 reaction solution was added, Enzyme 2 signal detection was performed, and the highest signal value was recorded;

e. cutting; Substrate 2 reaction solution was removed, 200 µl of elution buffer was added, after gently pipetting several times, the elution buffer was discarded, 100 µl of cutting reaction solution was added, the reaction was carried out at 55°C for 3 minutes, the cutting reaction solution was discarded; 200 μl of elution buffer was added for washing, and washing was repeated three times;

f. Steps a-e were repeated for the next sequencing run; and sequencing of only 10 bp was performed.

(5) Sequencing results

a. The signal values for the two types of luminescence were as follows:

Substrate signal 1 (W) Substrate signal 2 (W) cycle 1 0.1 210 cycle 2 188 0.12 cycle 3 173 169 cycle 4 206 0.11 cycle 5 198 0.13 cycle 6 176 171 cycle 7 0.13 186 cycle 8 203 0.15 cycle 9 166 159 cycle 10 0.12 0.16

b. Analysis of sequencing results:

According to the luminescence signal values, cycle 1 and cycle 7 had signals only when substrate 2 was introduced, so it could be concluded that biotin-dTTP was polymerized in these two cycles, and the first and seventh bases of the library to be tested were base T;

For cycle 2, cycle 4, cycle 5, and cycle 8, signals were observed only when substrate 1 was introduced, so it could be concluded that digoxin-dATP had undergone polymerization in these four cycles, and the second, fourth, fifth, and eighth bases of the library, to be tested were base A;

For cycle 3, cycle 6, and cycle 9, signals were observed when substrate 1 and substrate 2 were introduced, so it could be concluded that biotin-digoxin-dCTP was polymerized in these three cycles, and the third, sixth, and ninth bases of the library to be tested, were base C;

For run 10, no luminescence was observed when two substrates were introduced, so it could be concluded that cold G was polymerized in this run and the tenth base of the library was the G base.

In general, the first 10 bases of the sequence to be tested were: TACAACTACG (SEQ ID NO: 7), which was 100% identical to the TACAACTACG (SEQ ID NO: 7) base sequence of the first 10 bp. library to be tested.

Example 2

The construction of the library for sequencing and the amplification of the library sequences were the same as shown in Example 1.

Sequencing:

(1) Four dNTPs: as shown in example 1

(2) Production of luciferases and related proteins

a. SA-Gluc (purchased from adivity)

b. Antibody (purchased from Abcam), and according to the instructions for NHS-s-s-biotin from thermo fisher, the antibody was labeled using a biotin label to generate antibody-s-s-biotin.

(3) Obtaining reagents

Preparation of other reagents needed in the sequencing reaction

Polymerization reaction solution: 50 mM Tris-Hcl, 50 mM NaCl, 10 mM (NH ₄ ) ₂ SO ₄ , 0.02 mg/ml BG9 polymerase (BGI), 3 mM MgSO ₄ , 1 mM EDTA, 1 μM each the above four dNTPs

Elution buffer: 5XSSC, 0.05% Tween-20;

Enzyme binding reaction solution: The above two SA-Gluc proteins and antibody-s-s-biotin were diluted in TBST buffer, respectively, and the final concentration of each of the two proteins was 2 μg/ml;

Substrate reaction solution: buffer 50 mM Tris-HCl 0.5 mM NaCl was prepared and 50X coelenterazine (nanolight) was diluted to 1X;

Enzyme inactivation buffer: 5 mM DTT, 50 mM Tris-HCl, pH 9.0;

Cut buffer: 20 mM THPP, 50 mM Tris-HCl, pH 9.0, 0.5 M NaCl, 0.05% Tween-20;

(4) Sequencing reaction

a. Polymerization: 100 µl of polymerase reaction solution was added to each well of the amplified library, the temperature of the microplate reader was raised to 55°C, the reaction was carried out for 3 minutes to polymerize four dNTPs on the amplified library, the reaction solution was carefully removed, 100 µl of the reaction solution was added to elution and carefully pipetted several times, and the reaction solution for elution was removed;

b. Luciferase ligation: 100 µl SA-Gluc luciferase binding reaction solution was added, incubated for 30 min at 35°C, so that SA-gluc was ligated with biotin labeled dCTP and dATP derivatives, the reaction solution was removed, the elution solution was added and carefully pipetted several times and the elution solution removed;

c. First signal detection: the microplate reader was set to the appropriate parameters, the substrate reaction solution was added, the signal was detected, and the highest signal value was recorded;

d. Enzyme inactivation: The substrate reaction solution was removed, enzyme inactivation buffer was added and incubated at 35°C for 10 minutes, the reaction solution was removed, and then the elution buffer was added for elution;

e. Second luciferase ligation: the antibody-S-S-biotin reaction solution was added and incubated at 35°C for 30 minutes, so that the antibody-s-s-biotin was ligated with digoxin-labeled dCTP and dTTP derivatives, the reaction solution was removed, the elution buffer was added and carefully pipetted several times, the elution solution was removed, 100 μl of the SA-Gluc binding reaction solution was added and incubated at 35°C for 30 minutes, then the reaction solution was removed, the elution buffer was added, after completion of the elution, the elution buffer was removed;

f. Second signal detection: the microplate reader was set to the appropriate parameters, the substrate reaction solution was added, the signal was detected, and the highest signal value was recorded;

g. Cutting: Substrate 2 reaction solution was removed, 200 µl of elution buffer was added and carefully pipetted several times, elution buffer was removed, 100 µl of cutting reaction solution was added, the reaction was carried out at 55°C for 3 minutes, the cutting reaction solution was removed; 200 μl of elution buffer was added for washing, washing was repeated three times;

h. Steps a-g were repeated for the next sequencing run; and sequencing of only 10 bp was performed.

(5) Sequencing results

a. The results of signal detection 10 p. were as follows:

First detection (W) Second detection (W) cycle 1 0.6 223 cycle 2 312 0.7 cycle 3 278 327 cycle 4 254 0.3 cycle 5 239 0.4 cycle 6 243 275 cycle 7 0.27 228 cycle 8 267 0.5 cycle 9 263 279 cycle 10 0.7 0.6

b. Analysis of sequencing results:

For cycle 1 and cycle 7, signal values were obtained only at the second detection, so it could be concluded that biotin-dTTP was polymerized in these two cycles, and thus the first and seventh bases of the library to be tested were T;

For cycle 2, cycle 4, cycle 5, and cycle 8, signals were observed only at the first detection, so it could be concluded that digoxin-dATP had undergone polymerization in these four cycles, and thus the second, fourth, fifth, and eighth bases of the library to be tested were base A;

For cycle 3, cycle 6, and cycle 9, signals were obtained at both the first detection and the second detection, so that it could be concluded that biotin-digoxin-dCTP had undergone polymerization in these two cycles, and thus the third, sixth, and the ninth base of the library to be tested was base C;

For run 10, no light was emitted in two signal detections, so it could be concluded that cold G had undergone polymerization in this run, and thus the tenth base of this library was the G base.

In general, the first 10 bases of the sequence to be tested were: TACAACTACG (SEQ ID NO: 7), which was 100% identical to the TACAACTACG (SEQ ID NO: 7) base sequence of the first 10 bp. library to be tested.

--->

SEQUENCE LIST

<110> EGI TECH (SHEN ZHEN) CO., LIMITED

<120> Single-channel sequencing method based on self-luminescence

<130> PCT/CN2019/086974

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 233

<212> DNA

<213> Artificial sequence

<220>

<223> Constructed DNA sequence

<400> 1

gatatctgca ggcatagaat gaatattatt gaatcaataa ttaaagtcgg aggccaagcg 60

gtcttaggaa gacaacaact ccttggctca cagaacgaca tggctacgat ccgactttac 120

aactacgata atgggctgga tacatggaat gattatagat atattaagga ataatgttaa 180

ttaatgccta aattaattaa tctaaggggg ttaatacttc agcctgtgat atc 233

<210> 2

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 2

gatatctgca ggcat 15

<210> 3

<211> 15

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 3

gatatcacag gctga 15

<210> 4

<211> 30

<212> DNA

<213> Artificial sequence

<220>

<223> composite oligonucleotide

<400> 4

atgcctgcag atatcgatat cacaggctga 30

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 5

gccatgtcgt tctgtgagcc aagg 24

<210> 6

<211> 32

<212> DNA

<213> Artificial sequence

<220>

<223> primer

<400> 6

gctcacagaa cgacatggct acgatccgac tt 32

<210> 7

<211> 10

<212> DNA

<213> Artificial sequence

<220>

<223> base sequence of the first 10 b.p.

<400> 7

tacaactacg 10

<---

Claims (102)

1. A method for sequencing a nucleic acid molecule, comprising the following steps: (1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support; (2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And the first compound is bound to the first molecular label, the second compound is linked to the second molecular label, the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label, the fourth compound is not associated with any molecular label; (3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) allowing the duplex from the previous step to be contacted with two different luciferases and performing a ligation reaction where the two luciferases can be specifically ligated to a first molecular label and a second molecular label, respectively; then allowing the luciferase to undergo a fluorescent reaction in the presence of a substrate, and detecting the emitted fluorescence signal; (6) removing the molecular label of each nucleotide; (7) optionally, repeating steps (3)-(6) or (3)-(5) one or more times to obtain information about the sequence of the nucleic acid molecule. 2. The method according to p. 1, where in stage (5), the duplex is brought into contact with two different luciferases in a one-step reaction and subjected to a ligation reaction; or in step (5), the duplex is sequentially contacted with two luciferases and subjected to a ligation reaction. 3. The method according to p. 1 or 2, including the following stages: (1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support; (2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And the first compound is bound to the first molecular label, the second compound is linked to the second molecular label, the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label, the fourth compound is not associated with any molecular label; (3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding two different luciferases to carry out a ligation reaction, where the two luciferases can be specifically ligated to the first molecular label and the second molecular label, respectively; (6) removing unbound luciferase by using an elution buffer; (7) adding a first luciferase substrate and detecting a fluorescent signal at the same time; (8) removing the solution from the reaction of the previous stage; (9) adding a second luciferase substrate and detecting a fluorescent signal at the same time; (10) removing the solution from the reaction of the previous stage; (11) removal of the molecular label and 3'-protective group of each nucleotide; (12) optionally, removing the solution from the reaction of the previous step; (13) optionally, repeating steps (3) - (12) or (3) - (9) one or more times to obtain sequence information of the nucleic acid molecule. 4. The method according to p. 1 or 2, including the following stages: (1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support; (2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And the first compound is bound to the first molecular label, the second compound is linked to the second molecular label, the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label, the fourth compound is not associated with any molecular label; (3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding the first luciferase to carry out a ligation reaction, where the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a first luciferase substrate and detecting a fluorescent signal at the same time; (8) removing the solution from the reaction of the previous stage; (9) adding a second luciferase to carry out a ligation reaction, where the second luciferase can specifically bind to the second molecular label; (10) removing unbound second luciferase by using an elution buffer; (11) adding a second luciferase substrate and detecting a fluorescent signal at the same time; (12) removing the solution from the reaction of the previous stage; (13) optionally, removing the molecular label of each nucleotide; (14) optionally, repeating steps (3) - (13) or (3) - (11) one or more times to obtain information about the sequence of the nucleic acid molecule. 5. The method according to claim 3 or 4, wherein the first luciferase and the second luciferase contain different luciferases. 6. The method according to p. 1 or 2, including the following stages: (1) providing a nucleic acid molecule to be sequenced that is associated with a support, or linking the nucleic acid molecule to be sequenced to a support; (2) adding a primer to initiate the nucleotide polymerization reaction, a polymerase to carry out the nucleotide polymerization reaction, and four compounds to form a reaction system containing a solution phase and a solid phase; where the four compounds are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And the first compound is bound to the first molecular label, the second compound is linked to the second molecular label, the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label, the fourth compound is not associated with any molecular label; (3) hybridizing the primer to the nucleic acid molecule to be sequenced and forming a support-bound duplex by using the primer as the initial growing nucleic acid strand together with the nucleic acid molecule to be sequenced; (4) using the polymerase to carry out the nucleotide polymerization reaction under conditions allowing the polymerase to carry out the nucleotide polymerization reaction, thus incorporating one of the four compounds at the 3' end of the growing nucleic acid strand; (5) removing the solution phase from the reaction system in the previous step, keeping the duplex bound to the support, and adding the first luciferase to carry out a ligation reaction, where the first luciferase can specifically bind to the first molecular label; (6) removing unbound first luciferase by using an elution buffer; (7) adding a luciferase substrate and detecting a fluorescent signal at the same time; (8) removing the solution from the reaction of the previous stage; (9) adding a luciferase denaturant reagent; (10) removing the solution from the reaction of the previous stage; (11) adding a second luciferase to carry out a ligation reaction, where the second luciferase can specifically bind to the second molecular label; (12) removing unbound second luciferase by using an elution buffer; (13) adding a luciferase substrate and detecting a fluorescent signal at the same time; (14) optionally, removing the solution from the reaction of the previous step; (15) optionally, removing the molecular label and the 3' protecting group of each nucleotide; (16) optionally, repeating steps (3) - (15) or (3) - (13) one or more times to obtain information about the sequence of the nucleic acid molecule. 7. The method of claim 6 wherein the first luciferase and the second luciferase may contain the same luciferase. 8. The method according to any one of paragraphs. 1-7, wherein the first molecular tag and the second molecular tag are selected from the group consisting of biotin, digoxin, N3G, or FITC, and the first luciferase and the second luciferase are, respectively, labeled with streptavidin, anti-digoxin, anti-N3G, or anti-FITC . 9. The method according to any one of paragraphs. 1-8, where these four compounds are shown in formula I, formula II, formula III or formula IV:

Formula I

Formula II

Formula III

Formula IV 10. Polynucleotide sequencing kit, comprising: (a) four compounds that are, respectively, derivatives of the nucleotides A, (T/U), C and G, and have the ability to complementary base pairing; and the hydroxyl (-OH) at the 3' position of the ribose or deoxyribose of the four compounds is protected by a protecting group; And the first compound is bound to the first molecular label, the second compound is linked to the second molecular label, the third compound is associated with the first molecular label and with the second molecular label, or part of the third compound is associated with the first molecular label, and the other part of the third compound is associated with the second molecular label, the fourth compound is not associated with any molecular label; And (b) two different luciferases that can specifically bind to the first molecular tag and the second molecular tag, respectively. 11. The kit of claim 10 wherein the two different luciferases may contain the same luciferase or different luciferases. 12. The kit according to claim 10 or 11, wherein the first molecular label and the second molecular label are selected from the group consisting of biotin, digoxin, N3G, or FITC, and the first luciferase and the second luciferase are, respectively, labeled with streptavidin, an anti-digoxin antibody, an antibody against N3G or an antibody against FITC. 13. Set according to any one of paragraphs. 10-12, further comprising: a reagent and/or a device for isolating a nucleic acid molecule from a sample; a reagent for pre-treatment of the nucleic acid molecule; a support for binding the nucleic acid molecule to be sequenced; a reagent for binding (eg, covalently or non-covalently binding) the nucleic acid molecule to be sequenced to the support; a primer for initiating a nucleotide polymerization reaction; a polymerase for conducting a nucleotide polymerization reaction; one or more buffer solutions; one or more wash solutions; or any combination of them. 14. Set according to any one of paragraphs. 10-13, where these four compounds are shown in formula I, formula II, formula III or formula IV:

Formula I

Formula II

Formula III

Formula IV

Images