CN112359041B

CN112359041B - Method for improving artemisinin content in sweet wormwood herb by RNA interference

Info

Publication number: CN112359041B
Application number: CN202011245060.1A
Authority: CN
Inventors: 卜其涛; 张磊; 陈万生; 吕宗友
Original assignee: Second Military Medical University SMMU
Current assignee: Second Military Medical University SMMU
Priority date: 2020-11-10
Filing date: 2020-11-10
Publication date: 2022-08-16
Anticipated expiration: 2040-11-10
Also published as: CN112359041A

Abstract

The invention relates to the technical field of biology, in particular to a method for improving the content of artemisinin in sweet wormwood herb by RNA interference, which comprises the following steps: cloning an glandular hair development negative control factor AaMYB2 gene from artemisia apiacea, constructing a plant interference vector pHellsgate-AaMYB2 containing the AaMYB2 gene, transferring the pHellsgate-AaMYB2 into artemisia apiacea through mediating by agrobacterium tumefaciens, regenerating a plant, detecting the integration condition of an exogenous target gene AaMYB2 through PCR (polymerase chain reaction), then determining the glandular hair density and the content of artemisinin in the transgenic artemisia apiacea, and screening to obtain the transgenic artemisia apiacea plant with the increased artemisinin content. The content of artemisinin in the transgenic artemisia apiacea obtained by the method is remarkably improved and reaches 1.8 times of that of a non-transformed control plant at most, and a foundation is laid for large-scale production of artemisinin by utilizing the transgenic artemisia apiacea.

Description

Method for improving artemisinin content in sweet wormwood herb by RNA interference

Technical Field

The invention relates to the technical field of biology, in particular to a method for improving the content of artemisinin in sweet wormwood herb by RNA interference.

Background

Artemisinin (artemisinin) has gained worldwide acceptance as an effective antimalarial drug. Currently, the main source of artemisinin is extraction from aerial parts of the plant Artemisia annua. Artemisia annua L, also known as Artemisia annua, is an annual herbal medicinal plant. The very low content of artemisinin (0.01% -1% of dry weight) in artemisia annua limits the large-scale commercial production of this drug. Although artemisinin can be synthesized artificially, the method has the disadvantages of great difficulty, low yield and high cost, and does not have the feasibility of commercial production.

The production of artemisinin by tissue culture and cell engineering is an attractive method. However, artemisinin is present in callus at less than 0.1% dry weight and in shoots at most 0.16% dry weight, and most studies have not detected artemisinin in roots. Therefore, the feasibility of using tissue culture and cell engineering to produce artemisinin is not high.

The new sweet wormwood variety with stable high yield artemisinin obtained by using genetic engineering technology is a feasible method. At present, a method of over-expressing a key enzyme method, namely, farnesyl diphosphate synthase (FPS), in a sweet wormwood synthetic pathway is mainly adopted, but the research on the competitive branch of the sweet wormwood synthetic pathway through inhibition of the sweet wormwood synthetic pathway has not been reported successfully. Pu Shi et al published a paper entitled "AaMIXTA 1 in Artemisia annua regulates initiation of secretory glandular hairs and wax synthesis in Artemisia annua" and reported that Artemisia annua glandular density was increased 1.5-fold and artemisinin content was also increased nearly 1.5-fold by overexpression of AaMIXTA1 in Artemisia annua (Pu Shi et al, The roles of AaMIXTA1 in regulating The initiation of renal microorganisms and clinical biosyntheses in Artemisia annua.New Phytolist, 2018, 217, 261-. Therefore, the method for regulating and controlling the glandular hair density of the sweet wormwood provides a feasible method for improving the content of the artemisinin in the sweet wormwood.

However, no report has been made on a method for increasing the artemisinin content by interfering AaMYB2 in Artemisia annua with RNA.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a method for improving the content of artemisinin in artemisia apiacea by using RNA interference, so that the method inhibits the expression of negative regulatory factors for artemisia apiacea glandular hair development by using RNA interference, thereby improving the density of the glandular hair in the artemisia apiacea and improving the content of artemisinin. The invention relates to gene cloning, RNA interference vector construction, genetic transformation, molecular detection, glandular hair density measurement, artemisinin extraction and content measurement, establishes a method for improving the content of artemisinin in sweet wormwood, and lays a solid foundation for large-scale production of artemisinin by using transgenic sweet wormwood.

The invention is realized by the following technical scheme: the invention clones part of AaMYB2 gene sequence from Artemisia annua, establishes a plant expression vector for RNA interference by constructing a hairpin structure, transfers AaMYB2hairpin gene into Artemisia annua plants by mediating with agrobacterium tumefaciens, detects the integration and expression conditions of target gene AaMYB2hairpin by PCR and RT-PCR, counts glandular hair density by a fluorescence microscope, determines the artemisinin content in Artemisia annua by a high performance liquid chromatography-evaporative light scattering detector (HPLC-ELSD), and screens to obtain transgenic Artemisia annua plants with increased artemisinin content.

In order to achieve the purpose, the invention provides a method for improving the content of artemisinin in sweet wormwood by RNA interference, which comprises the steps of cloning a fragment of a sweet wormwood glandular hair development negative control gene AaMYB2 from sweet wormwood, constructing a plant expression vector pHellsgate-AaMYB2 containing AaMYB2hairpin, transferring the pHellsgate-AaMYB2 vector into sweet wormwood to obtain a regenerated plant by mediating with agrobacterium tumefaciens, detecting the integration and expression conditions of a target gene AaMYB2 by PCR and qRT-PCR, measuring the content of artemisinin in sweet wormwood by a high performance liquid chromatography and an evaporative light scattering detector, and screening to obtain a transgenic sweet wormwood plant with the increased content of artemisinin.

Further, the method for improving the content of artemisinin in artemisia apiacea by using RNA interference comprises the following steps of:

(a) obtaining a gene fragment containing an AaMYB2 coding sequence by adopting a gene cloning method, wherein the nucleotide sequence of the gene fragment is shown as SEQ ID No.1, an AaMYB2 interference sequence SEQ ID No.2 is selected for constructing an RNA interference vector, and amplification primers of the gene fragment are shown as SEQ ID No.3 and SEQ ID No. 4;

SEQ ID No.3：ATGGACTCGAAGTCAAACAA；

SEQ ID No.4：TCTACCAGGTAGTCTTCCCG。

(b) constructing an AaMYB2 interference sequence SEQ ID No.2 into a hairpin structure, and then operably connecting the hairpin structure with an expression regulation sequence to form a plant expression vector pHellsgate-AaMYB2 containing an AaMYB2hairpin gene;

(c) transforming the plant expression vector pHellsgate-AaMYB2 containing the AaMYB2hairpin gene into agrobacterium tumefaciens to obtain an agrobacterium tumefaciens strain containing the AaMYB2hairpin gene plant expression vector for transforming the sweet wormwood herb;

(d) transforming sweet wormwood by using the constructed agrobacterium tumefaciens strain to obtain a transgenic sweet wormwood plant detected by PCR;

(e) QRT-PCR is used for determining the expression of the AaMYB2 gene in the sweet wormwood;

(f) counting the glandular hair density by using a fluorescence microscope;

(g) and (3) determining the artemisinin content in the obtained transgenic artemisia apiacea plant by using a high performance liquid chromatography and an evaporative light scattering detector to obtain the transgenic artemisia apiacea plant with the increased artemisinin content.

Further, in the step b, the sequences of the primers for amplifying the AaMYB2 interference sequence SEQ ID No.2 are respectively shown as SEQ ID No.5 and SEQ ID No. 4:

SEQ ID No.5：CACCATGGACTCGAAGTCAAACAA；

SEQ ID No.4：TCTACCAGGTAGTCTTCCCG。

further, the step b specifically comprises the following steps:

b1) construction of intermediate vector pENTR-AaMYB2 hairpin: the AaMYB2 gene fragment is amplified by a primer and is connected to pENTR by a GATAWAY entry cloning method to form an intermediate vector PENTR-AaMYB 2;

b2) construction of plant binary expression vector pHellsgate-AaMYB2 hairpin: on the basis of the pENTR-AaMYB2 vector, LR reaction is carried out with a vector pHellsgate12, and the vector is connected to the pHellsgate to form a plant binary expression vector pHellsgate-AaMYB 2.

Further, in the step d, detection primers for synthesizing AaMYB2hairpin are respectively designed, the forward AaMYB fragment (amplification primers SEQ ID No.6 and SEQ ID No.4) and the reverse AaMYB fragment (amplification primers SEQ ID No.7 and SEQ ID No.4) are inserted and amplified, and a positive plant of a target strip observed under ultraviolet rays is the transgenic southernwood detected by PCR.

SEQ ID No.6：GGGATGACGCACAATCC；

SEQ ID No.7：GAGCTACACATGCTCAGG。

Further, in the step e, the method for measuring the expression of the AaMYB2 gene in the artemisia apiacea by QRT-PCR comprises the following steps: designing primers (the nucleotide sequence is shown as SEQ ID No.8-SEQ ID No. 9) of AaMYB2 gene in the synthesized sweet wormwood, carrying out QRT-PCR amplification, and analyzing the relative expression quantity of the gene by using a relative quantitative method.

SEQ ID No.8：GAAGCTATCGAGATACATGGTCCTA；

SEQ ID No.9：GCGAATAATCAAATCCTCCTCTT。

Further, in the step g, the method for determining the content of artemisinin in artemisia apiacea by using a high performance liquid chromatography and an evaporative light scattering detector (HPLC-ELSD) is as follows: a chromatographic column C-18 reverse phase silica gel column, wherein the mobile phase is methanol: water, methanol: the volume ratio of water is 70: 30, the column temperature is 30 ℃, the flow rate is 1.0mL/min, the sample injection amount is 10 mu L, the temperature of a drift tube of the evaporative light scattering detector is 40 ℃, the amplification factor (gain) is 7, and the carrier gas pressure is 5 bar.

The invention has the advantages that:

the invention relates to a method for improving the content of artemisinin in artemisia apiacea by inhibiting the expression of key enzyme of a competitive branch of an artemisinin synthesis way through hairpin RNA mediated RNA interference, which adopts a genetic engineering method to introduce a vector pHellsgate-AaMYB2 into artemisia apiacea plants to obtain transgenic artemisia apiacea plants with significantly improved artemisinin content, wherein the content of artemisinin in the transgenic artemisia apiacea plants can reach 16mg/g DW (namely 1.6 percent of dry weight) to the maximum extent and is 1.8 times of that of non-transformed common artemisia apiacea (9mg/g DW, namely 0.9 percent of dry weight).

Drawings

FIG. 1 MYB-RNAi glandular density variation;

FIG. 2 shows the amount of artemisinin synthesis pathway gene expression;

figure 3 glandular hair density statistics and artemisinin content determination.

Detailed Description

The following examples are provided to illustrate specific embodiments of the present invention.

Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as molecular cloning in Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1: cloning of Artemisia apiacea AaMYB2 gene fragment

1. Extraction of total RNA of sweet wormwood genome

Taking a small amount of young and tender leaves of herba Artemisiae Annuae (of herba Artemisiae Annuae variety with high content of artemisinin produced in Chongqing unitary Yang), quickly freezing with liquid nitrogen, quickly grinding with a mortar, adding into a 1.5mL Eppendorf tube containing 1mL of TRIzol (TRIzol Reagents, GIBCO BRL, USA), fully oscillating, standing at room temperature for 5min, adding 200 μ L of chloroform, strongly oscillating for 15sec, standing at room temperature for 2-3min, and centrifuging at 4 deg.C and 12,000g for 15 min; the supernatant (about 600. mu.L) was taken into a clean 1.5mL Eppendorf tube, added with an equal volume of isopropanol, mixed by inversion, left at room temperature for 10min, and then centrifuged at 12,000g for 10min at 4 ℃; discarding the supernatant, adding 1mL of 75% ethanol for cleaning, oscillating, and centrifuging at 7,500g at 4 ℃ for 5 min; drying at room temperature for 15-20min, and dissolving in appropriate amount (30-50 μ L) of RNAase-free water; the quality of the total RNA is identified by formaldehyde denatured gel electrophoresis, and then the RNA content is determined on a spectrophotometer.

2. Cloning of Artemisia apiacea AaMYB2 gene fragment

The obtained total RNA of the genome of the southernwood is reversely transcribed by a reverse transcriptase XL (AMV) to obtain a first strand cDNA, an upstream primer and a downstream primer (SEQ ID No. 3: ATGGACTCGAAGTCAAACAA; SEQ ID No. 4: TCTACCAGGTAGTCTTCCCG) of an interference sequence (SEQ ID No.2, namely 1bp to 300bp of the SEQ ID No.1) of AaMYB2 are designed and amplified according to a coding sequence (SEQ ID No.1) of the gene of the southernwood AaMYB2, and linker sequences are respectively introduced to the upstream primer and the downstream primer (which can be determined according to an optional vector) so as to construct an expression vector. And (3) taking the first strand cDNA as a template, and carrying out sequencing after PCR amplification. DNA sequencing was performed by Jinzhi technology services, Inc., Suzhou, using a 3730 automated sequencer. The sequencing result shows that the cloned interference sequence (SEQ ID No.2) of the AaMYB2 is consistent with the 1bp to 300bp of the coding sequence (SEQ ID No.1) of the Artemisia apiacea AaMYB2 gene reported in GenBank.

In the embodiment, the interference sequence (SEQ ID No.2) of the artemisia apiacea glandular hair negative control gene AaMYB2 in the artemisia apiacea with a correct sequence is obtained from the artemisia apiacea by adopting a gene cloning method, and a gene fragment is provided for inhibiting the expression of AaMYB2 through RNA interference so as to improve the artemisinin content.

Example 2: construction of plant binary expression vector containing AaMYB2hairpin gene

1. Construction of intermediate vector pENTR-AaMYB 2hairpin

The interfering sequence of AaMYB2 in example 1 (SEQ ID No.2) was amplified by gene primers CACCATGGACTCGAAGTCAAACAA (SEQ ID No.5) and TCTACCAGGTAGTCTTCCCG (SEQ ID No.4) and ligated to pENTR by the approach of GATAWAY's entry clone to form PENTR-AaMYB 2. The specific operation is as follows: the AaMYB2 fragment was amplified using the high fidelity enzyme KOD plus (Nippon, Japan) with primer F1R 1. After 30min of homologous recombination with pENTR vector (commercial vector of Saimeishefei company), the recombinant product is transformed into Escherichia coli DH5 alpha, and monoclonal antibody is selected, and plasmid is extracted for PCR detection, so as to obtain intermediate vector pENTR-AaMYB 2.

2. Construction of plant binary expression vector pHellsgate-AaMYB 2hairpin

On the basis of the pENTR-AaMYB2 vector, LR reaction is carried out with pHellsgate12, and pHellsgate-AaMYB2 is formed by connecting pHellsgate with the LR reaction. The specific operation is as follows: extracting a plasmid of pENTR-AaMYB2, carrying out homologous recombination with a pHellsgate vector (a commercial vector of Saimeishoff company) for 30min, transforming a recombination product into escherichia coli DH5 alpha, carrying out ligation transformation, selecting a single clone, extracting the plasmid, carrying out PCR detection, and obtaining a plant binary expression vector pHellsgate-AaMYB 2.

In the embodiment, an interference sequence (300bp, SEQ ID No.2) of an artemisia apiacea glandular hair development negative control gene AaMYB2 is constructed into a hairpin structure and then is operably connected with an expression control sequence to form a plant expression vector pHellsgate-AaMYB2 containing the AaMYB2hairpin gene, and the expression vector can be used for improving the artemisinin content in the artemisia apiacea through a metabolic engineering strategy.

Example 3: transgenic southernwood plant obtained by genetic transformation of southernwood through agrobacterium tumefaciens mediated AaMYB2hairpin gene

1. Obtaining of double-element plant expression vector pHellsgate-AaMYB2 Agrobacterium tumefaciens engineering bacteria containing AaMYB2hairpin gene

The plant binary expression vector pHellsgate-AaMYB2 containing the AaMYB2hairpin gene in example 2 was transformed into Agrobacterium tumefaciens (e.g., EHA105, a commercially available biomaterial available from Cambian, Australia, with the strain number of Gambar 1) and verified by PCR. The result shows that the plant binary expression vector pHellsgate-AaMYB2 containing the AaMYB2hairpin gene has been successfully constructed into the Agrobacterium tumefaciens strain.

2. Agrobacterium tumefaciens-mediated AaMYB2hairpin gene transformed southernwood

2.1. Pre-culture of explants

Soaking herba Artemisiae Annuae seed in 75% ethanol for 1min, soaking in 20% NaClO for 20min, washing with sterile water for 3-4 times, sucking surface water with sterile absorbent paper, inoculating in hormone-free MS (Murashige and Skoog,1962) solid culture medium, and culturing at 25 deg.C under light/dark for 16h/8h to obtain herba Artemisiae Annuae sterile seedling. After the seedling grows to about 5cm, shearing a sterile seedling leaf explant for transformation.

2.2. Co-culture of Agrobacterium with explants

Transferring the leaf explant into a co-culture medium (1/2MS + AS 100 mu mol/L), dropwise adding 1/2MS suspension of the activated agrobacterium tumefaciens engineering bacteria containing the AaMYB2hairpin gene-containing plant binary expression vector, fully contacting the explant with a bacterial solution, and performing dark culture at 28 ℃ for 3 d. Control was leaf explants dropped on 1/2MS liquid medium suspension of Agrobacterium tumefaciens without the gene of interest.

2.3. Selection of resistant regenerated plants

Transferring the artemisia apiacea explant cultured for 3d in the co-culture mode to a germination screening culture medium (MS +6-BA 0.5mg/L + NAA 0.05mg/L + Kan 50mg/L + Cb 500mg/L), carrying out illumination culture at 25 ℃ for 16h/8h, carrying out subculture once every two weeks, and obtaining Kan resistant cluster buds after 2-3 subcultures. Shearing off the well-grown resistant cluster buds, transferring the cluster buds to a rooting culture medium (1/2MS + Cb 125mg/L) for culturing until the cluster buds grow to root, thereby obtaining a Kan resistant regeneration sweet wormwood plant.

3. PCR detection of transgenic sweet wormwood plant

Primers (SEQ ID No.6 and SEQ ID No.7) are respectively designed according to a sequence AaMYB2hairpin of a vector where a target gene is located to detect the target gene in a transgenic southernwood plant. The result shows that the designed PCR specific primer can be used for amplifying a specific DNA fragment of about 900 bp. And DNA extracted from the non-transformed southernwood genome is used as a negative template of PCR, and any fragment is not amplified, so that the RNAi vector is successfully transformed into the southernwood.

In the embodiment, the plant expression vector is transformed into agrobacterium tumefaciens to obtain an agrobacterium tumefaciens strain containing an AaMYB2hairpin gene plant expression vector for transforming the artemisia apiacea, and the constructed agrobacterium tumefaciens strain is used for transforming the artemisia apiacea to obtain a transgenic artemisia apiacea plant detected by PCR.

Example 4: QRT-PCR detection of AaMYB2 gene expression in transgenic southernwood plant

1. Design and Synthesis of primers

Primers are designed according to the complete sequences of the southernwood AaMYB2 gene and housekeeping gene actin. The lengths of the primer amplified gene segments are 162bp and 300bp respectively. The primers used were synthesized by Suzhou Jinweizhi. The primer sequences are as follows:

SEQ ID No.8：GAAGCTATCGAGATACATGGTCCTA；

SEQ ID No.9：GCGAATAATCAAATCCTCCTCTT；

SEQ ID No.10：CCAGGCTGTTCAGTCTCTGTAT；

SEQ ID No.11：CGCTCGGTAAGGATCTTCATCA。

extraction and reverse transcription of RNA

Referring to the method described in example 1, RNA was extracted from Artemisia annua plants, genomic DNA was removed from the RNA using DNaseI, and first strand cDNA was synthesized using reverse transcriptase XL (AMV).

RT-PCR detection of AaMYB2 gene and housekeeping gene actin expression in transgenic southernwood

In order to adjust the difference of reaction efficiency in the processes of RNA extraction and reverse transcription among samples, the expression of the housekeeping gene actin needs to be detected while the expression of the target gene AaMYB2 is detected. The reaction system of PCR for detecting actin and target gene is as follows:

and (3) PCR reaction conditions: hot start and denaturation at 94 ℃ for 5min for 1 cycle; 30s at 94 ℃, 30s at 54 ℃, 10s at 72 ℃ and 35 cycles; 8min at 72 ℃ for 1 cycle; storing at 4 ℃. And (5) electrophoresis detection results.

In the embodiment, the qRT-PCR technology is adopted to determine the expression level of the glandular hair development negative regulatory factor AaMYB2 gene in the transgenic artemisia apiacea, and the possible artemisia apiacea plant with high artemisinin yield can be preliminarily screened by detecting the expression level of the artemisinin synthesis pathway gene.

As shown in FIG. 2, the increase of the expression levels of the glandular trichome development negative regulatory gene AaMYB2, the artemisinin synthesis pathway gene ADS, the CYP71AV1, the DBR2 and the ALDH1 is interfered, so that the metabolic flow flows to the artemisinin synthesis pathway and the content of artemisinin is increased.

Example 5: method for measuring density of artemisia apiacea glandular hairs by using fluorescence microscope

Because the artemisia apiacea glandular hairs can perform autofluorescence, fluorescence is observed under the condition that the wavelength of excitation light is 430nm through an Olympus fluorescence microscope BX43 system, and the density of the glandular hairs is calculated and counted in area.

As a result, as shown in FIG. 1, the expression level of AaMYB2 gene was interfered, and the density of leaf glandular hairs of the interfered plant was increased relative to the control experiment group, thereby causing the increase of artemisinin synthesis.

Example 6: determination of artemisinin content in transgenic southernwood by HPLC-ELSD

HPLC-ELSD conditions and System applicability and preparation of Standard solutions

HPLC: a water alliance 2695 system was used, the column was a C-18 reverse phase silica gel column (SymmetryShieldTM C18, 5 μm, 250X 4.6mm, Waters) and the mobile phase was methanol: water, methanol: the volume ratio of water is 70: 30, column temperature of 30 ℃, flow rate of 1.0mL/min, sample injection amount of 10 mu L, sensitivity (AUFS is 1.0), and theoretical plate number calculated according to artemisinin peak is not less than 2000.

ELSD: adopting a water alliance 2420 system, wherein the temperature of a drift tube of the evaporative light scattering detector is 40 ℃, the amplification factor (gain) is 7, and the carrier gas pressure is 5 bar;

accurately weighing 2.0mg of artemisinin standard (Sigma company), dissolving completely with 1mL of methanol to obtain 2mg/mL of artemisinin standard solution, and storing at-20 deg.C for use.

The mobile phase in the invention is methanol (methanol): water, the proportion is 70%: at 30%, the retention time of artemisinin was 5.1min, and the peak pattern was good. The theoretical plate number is not less than 2000 calculated by artemisinin.

2. Preparation of Standard Curve

And respectively injecting 2 mu l, 4 mu l, 6 mu l, 8 mu l and 10 mu l of the reference substance solution under corresponding chromatographic conditions to record a spectrum and chromatographic parameters, and respectively performing regression analysis on the content (X, mu g) of the standard substance by using a peak area (Y). Through research, the artemisinin in the invention presents a good log-log linear relation in the range of 4-20 mug. The log-log linear regression equation for the artemisinin control was:

Y＝1.28e+000X+4.71e+000，R＝0.979546

3. preparation of sample and determination of artemisinin content

The extraction process of artemisinin is based on the method reported in Van Nieuwerburgh et al (2006): a small amount of fresh folium Artemisiae Annuae (1-2g fresh weight) is immersed in 10ml chloroform in a 50ml test tube and shaken for 1min, the leachate is poured into a new test tube to volatilize chloroform completely, and 3ml absolute ethyl alcohol is used to dissolve the extract sufficiently for HPLC detection. Meanwhile, collecting the leaves after chloroform extraction, putting the leaves into a 60-degree oven for drying, and weighing (calculating the dry weight of the sweet wormwood leaves);

and (3) measuring the content of artemisinin by adopting HPLC-ELSD, wherein the sample injection volume is 20ul, substituting the peak area into a linear regression equation to calculate the content (mg) of artemisinin in the sample, and dividing by the dry weight (g) of the artemisia apiacea leaves of the sample so as to calculate the content of artemisinin in the artemisia apiacea plants.

As shown in FIG. 3, the glandular hair density of RNAi plants is increased by 1.7 times compared with CK, and the corresponding artemisinin content is also increased by 1.8 times.

The AaMYB2hairpin transgenic gene in the invention can obviously improve the artemisinin content in the sweet wormwood herb. The highest content of artemisinin in the artemisia apiacea with the AaMYB2hairpin gene can reach 16mg/g DW (namely 1.6 percent of dry weight), and is 1.8 times of that of non-transformed common artemisia apiacea (0.9mg/g DW, namely 0.9 percent of dry weight).

In this example, the content of artemisinin in transgenic Artemisia annua was determined by HPLC-ELSD method. The Artemisia apiacea plant with high artemisinin yield is obtained by adopting an RNA interference strategy, and an ideal method is provided for large-scale production of artemisinin.

While the preferred embodiments of the present invention have been described in detail, it will be understood by those skilled in the art that the invention is not limited thereto, and that various changes and modifications may be made without departing from the spirit of the invention, and the scope of the appended claims is to be accorded the full range of equivalents.

Sequence listing

<110> China people liberation army navy military medical university

<120> a method for improving the content of artemisinin in sweet wormwood herb by RNA interference

<130> /

<160> 11

<170> SIPOSequenceListing 1.0

<210> 1

<211> 546

<212> DNA

<213> Artemisia annua (Artemisia annua)

<400> 1

atggactcga agtcaaacaa atccaagaat aaagaaatta atagaggagc atggacagca 60

gaagaagatg aaaagctagc agaagctatc gagatacatg gtcctaaaaa atggacagtc 120

attgcaacaa aagcaggttt gcaaaggtgt ggaaagagtt gtaggttaag atggttaaat 180

tatttgagac caaacatcaa acgaggaaat atatcagatc aagaggagga tttgattatt 240

cgccttcata aacttttagg aaacaggtgg tcactgatag cgggaagact acctggtaga 300

acggataatg agatcaagaa ctattggaat tcccatttga gcaaaaagaa ggaaacaatg 360

gaaaaacaaa cggatcataa aaagaagatg aaagaagagg atgtcaccga tagaaacaaa 420

cttggagttg aatcttcaaa gttcagtttc aacgttgatg agttttttga tttttcgaat 480

gaggatccct cgaccttgga ttgggttaac aggtaccttg cgggtacaag tgatgcattt 540

ctgtag 546

<210> 2

<211> 300

<212> DNA

<213> Artemisia annua (Artemisia annua)

<400> 2

atggactcga agtcaaacaa atccaagaat aaagaaatta atagaggagc atggacagca 60

gaagaagatg aaaagctagc agaagctatc gagatacatg gtcctaaaaa atggacagtc 120

attgcaacaa aagcaggttt gcaaaggtgt ggaaagagtt gtaggttaag atggttaaat 180

tatttgagac caaacatcaa acgaggaaat atatcagatc aagaggagga tttgattatt 240

cgccttcata aacttttagg aaacaggtgg tcactgatag cgggaagact acctggtaga 300

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 3

atggactcga agtcaaacaa 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

tctaccaggt agtcttcccg 20

<210> 5

<211> 24

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

caccatggac tcgaagtcaa acaa 24

<210> 6

<211> 17

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

gggatgacgc acaatcc 17

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

gagctacaca tgctcagg 18

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

gaagctatcg agatacatgg tccta 25

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

gcgaataatc aaatcctcct ctt 23

<210> 10

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

ccaggctgtt cagtctctgt at 22

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence (Artificial)

<400> 11

cgctcggtaa ggatcttcat ca 22

Claims

1. A method for improving the content of artemisinin in sweet wormwood by RNA interference is characterized in that a sweet wormwood glandular hair development negative control gene AaMYB2 is cloned from sweet wormwood, a plant expression vector pHellsgate-AaMYB2 containing AaMYB2hairpin is constructed, the pHellsgate-AaMYB2 vector is transferred into sweet wormwood to obtain a regenerated plant through mediation of agrobacterium tumefaciens, integration and expression conditions of a target gene AaMYB2 are detected through PCR and qRT-PCR, the content of artemisinin in sweet wormwood is measured through high performance liquid chromatography and an evaporative light scattering detector, and a transgenic sweet wormwood plant with the increased content of artemisinin is obtained through screening.

2. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 1, comprising the following steps:

(f) counting the glandular hair density by using a fluorescence microscope;

3. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 2, wherein in the step b, the primer sequences for amplifying the AaMYB2 interference sequence SEQ ID No.2 are shown as SEQ ID No.5 and SEQ ID No.4 respectively.

4. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 2, wherein the step b specifically comprises the following steps:

b1) construction of intermediate vector pENTR-AaMYB2 hairpin: the AaMYB2 gene fragment is amplified through a primer and is connected to pENTR through a GATAWAY in-door cloning method to form an intermediate vector PENTR-AaMYB 2;

5. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 2, wherein in the step d, detection primers for synthesizing AaMYB2hairpin are respectively designed, the AaMYB fragment inserted in the forward direction and the AaMYB fragment inserted in the reverse direction are amplified, and a positive plant of a target band observed under ultraviolet light is the transgenic artemisia apiacea detected by PCR.

6. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 2, wherein in the step e, the method for determining the expression of AaMYB2 gene in artemisia apiacea by QRT-PCR comprises the following steps: designing primers for synthesizing the AaMYB2 gene in the southernwood, carrying out QRT-PCR amplification, and analyzing the relative expression quantity of the gene by using a relative quantification method.

7. The method for increasing the content of artemisinin in artemisia apiacea by using RNA interference as claimed in claim 2, wherein the method for determining the content of artemisinin in artemisia apiacea in the step g by using high performance liquid chromatography and an evaporative light scattering detector is as follows: a chromatographic column C-18 reverse phase silica gel column, wherein the mobile phase is methanol: water, methanol: the volume ratio of water is 70: 30, the column temperature is 30 ℃, the flow rate is 1.0mL/min, the sample injection amount is 10 mu L, the temperature of a drift tube of the evaporative light scattering detector is 40 ℃, the amplification factor is 7, and the carrier gas pressure is 5 bar.