CN112353811A - Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis - Google Patents
Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis Download PDFInfo
- Publication number
- CN112353811A CN112353811A CN202011305955.XA CN202011305955A CN112353811A CN 112353811 A CN112353811 A CN 112353811A CN 202011305955 A CN202011305955 A CN 202011305955A CN 112353811 A CN112353811 A CN 112353811A
- Authority
- CN
- China
- Prior art keywords
- periodontitis
- medicament
- dna
- treating
- medicine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/711—Natural deoxyribonucleic acids, i.e. containing only 2'-deoxyriboses attached to adenine, guanine, cytosine or thymine and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/02—Stomatological preparations, e.g. drugs for caries, aphtae, periodontitis
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Molecular Biology (AREA)
- Epidemiology (AREA)
- Biochemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Organic Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of a DNA tetrahedron in preparing a medicament for treating and preventing periodontitis, belonging to the field of nucleic acid medicaments. The invention has good effect when being used for treating periodontitis and has better curative effect than common antibiotics for treating periodontitis. The invention provides a real therapeutic drug for clinical treatment of periodontitis, provides a brand new direction for periodontitis treatment, and has good application prospect.
Description
Technical Field
The invention belongs to the field of nucleic acid medicines.
Background
Periodontitis is a common inflammatory, destructive disease caused by plaque. If the treatment is not intervened, risks of gingival bleeding, alveolar bone absorption, tooth loosening and falling and the like can occur, so that the life quality of people is greatly influenced. Besides, it can also induce or aggravate various systemic chronic inflammatory diseases, such as diabetes, cardiovascular diseases, chronic kidney diseases, cerebral apoplexy, etc. by locally releasing a large amount of inflammatory factors into blood circulation or causing odontogenic bacteremia. Related studies report that treatment to control periodontal inflammation can greatly reduce the risk of loose and loose teeth and effectively improve the therapeutic effect and prognosis of the above-mentioned systemic diseases. Therefore, the prevention and treatment of periodontitis has great application value.
Currently, the most effective way to treat periodontitis is basic treatment, i.e., removal of plaque after basic treatment by scaling, curettage, etc., and treatment with antibiotics such as amoxicillin, clindamycin, doxycycline, metronidazole, spiramycin, minocycline, etc., for acute inflammation. For more serious conditions, under the condition that basic treatment cannot be effectively used, the operation treatment can be performed through flap operation, bone grafting and other operations.
However, the basic treatment and the surgical treatment are only performed by dentists, but many people do not have the condition for dentists to cure periodontitis. The medicine is a treatment mode which is convenient for patients to take, does not need doctors, but related reports of medicines for radically treating periodontitis are not available at present. At present, the existing drugs for periodontitis only contain antibiotics, but the antibiotics can only relieve acute inflammation, cannot protect alveolar bones and periodontal tissues and cannot radically cure periodontitis.
It would be of great positive interest if a medicament could be provided to treat periodontitis without the need for basic treatment or surgery.
DNA Tetrahedrons (TDNs), also called tetrahedral framework nucleic acids (tFNAs), are tetrahedral nucleic acid structures formed by complementary base pairing of single DNA strands (usually 4 pieces), which are more stable in vivo structure than DNA double strand structures, and are commonly used as carriers of certain nucleic acid drugs and constituent members of molecular detection probes. At present, no report of DNA tetrahedron for treating periodontitis is found.
Disclosure of Invention
The invention aims to solve the problems that: provides the application of the DNA tetrahedron in the preparation of the medicine for treating periodontitis.
The technical scheme of the invention is as follows:
use of a DNA tetrahedron for the preparation of a medicament for the treatment and prophylaxis of periodontitis.
The medicine for treating and preventing periodontitis described in the application can be used for treating or preventing periodontitis independently.
Further, the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNA with a sequence shown as SEQ ID NO. 1-4.
Furthermore, the DNA tetrahedron is prepared by the four DNA single strands through denaturation at 95 ℃ for 10min and retention at 4 ℃ for more than 20 min.
Further, the medicament is a medicament for protecting periodontal tissue and/or alveolar bone.
Further, the medicament is an injection preparation.
A medicine for treating and preventing periodontitis is prepared by taking DNA tetrahedron as an active ingredient and adding pharmaceutically acceptable auxiliary ingredients.
Further, the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNA with a sequence shown as SEQ ID NO. 1-4.
Furthermore, the DNA tetrahedron is prepared by the four DNA single strands through denaturation at 95 ℃ for 10min and retention at 4 ℃ for more than 20 min.
Further, the medicament is a medicament for protecting periodontal tissue and/or alveolar bone.
Further, the medicament is an injection preparation.
Has the advantages that:
the DNA tetrahedron can be used independently to effectively inhibit the damage of periodontal tissues, has obvious protection effect on alveolar bones, and can also relieve inflammatory reaction and treat periodontitis. Therefore, the DNA tetrahedron can be used as a medicament for treating and preventing periodontitis, overcomes the problem that the periodontitis cannot be radically treated by adopting the medicament in the prior art, and provides a new choice for treating the periodontitis.
Obviously, many modifications, substitutions, and variations are possible in light of the above teachings of the invention, without departing from the basic technical spirit of the invention, as defined by the following claims.
The present invention will be described in further detail with reference to the following examples. This should not be understood as limiting the scope of the above-described subject matter of the present invention to the following examples. All the technologies realized based on the above contents of the present invention belong to the scope of the present invention.
Drawings
Fig. 1. And synthesizing and characterizing tFNAs. (a) One shows the structural diagram of the composition of tFNAs. (b) Transmission electron microscopy images show the morphology and average size of tnfas. The scale bar is 50 nm. (c) The results of 8% acrylamide gel electrophoresis showed the successful preparation of tFNAs. (d) Capillary electrophoresis results indicate successful preparation of tFNAs. (e) Particle size distribution of tFNAs and Zeta potential test. (f) Immunofluorescence staining cells were observed for uptake of cy5 tfnas. (nucleus: blue, cytoskeleton: green, cy 5: red). The scale bar is 25 μm.
Fig. 2. tFNAs significantly reduce the inflammatory response of periodontitis. (a) Schematic diagram of rat periodontitis experiment. (b) H & E stained images at 5-fold and 20-fold magnification. The yellow arrows show inflammatory cells. (c) Immunohistochemistry results for IL-1. beta. at 5-fold and 20-fold magnification. IL-1 is shown by the red arrow. (d) Immunohistochemical images of IL-6 at 5-fold and 20-fold magnification. Interleukin-6 is shown by the red arrow. (e) Statistical analysis of the expression of IL-1. beta. and IL-6 in periodontal tissues. P <0.01, P <0.001, compared to the blank group. # # P <0.001 compared to control. & P <0.5 compared to tFNAs (250nM) group. Root/mesial root is the distal root. MR/DR ═ mesial root/distal root; AB ═ alveolar ridge.
Fig. 3. tFNAs can remarkably inhibit the destruction of periodontitis to periodontal tissues. (a) Schematic diagram of rat periodontitis experiment. (b) Masson stained images at 5 and 20 magnifications. (c) H & E stained images at 5-fold and 20-fold magnification. The area enclosed by the solid yellow line is cementum, and the aera enclosed by the dashed yellow line is cementum absorbed by inflammation. (d) 5-fold and 20-fold magnification of TRAP staining photographs. Red arrows indicate osteoclasts. MR/DR ═ mesial root/distal root; AB ═ alveolar ridge; d ═ dentin; c ═ cementum; PDL is periodontal ligament.
Fig. 4. tFNAs has obvious protective effect on alveolar bone. (a) Schematic diagram of rat periodontitis experiment. (b) And (4) carrying out micro CT three-dimensional reconstruction on the left maxillary alveolar bone. The red portion shows the root is exposed. (c) Statistical analysis of proximal, middle and distal alveolar bone resorption of the second molar (n-5). P <0.5, P <0.01, P <0.001 compared to the blank group. # compared to control, P <0.5, P <0.01, P < 0.001. & P <0.5 compared to tFNAs (250nM) group. (d) Statistical analysis of results of microscopic CT of BV/TV, tb.n, BV/TV, mycobacterium tuberculosis, and tb.th (n-5). P <0.5, P <0.01 compared to the blank group. # compared to control, P <0.5, P <0.01, P < 0.001. And & compared to the tFNAs (250nM) group, P < 0.5. The area marked with yellow lines is the area of interest.
Detailed Description
Example 1 Synthesis and characterization of DNA tetrahedra
1. Synthesis method
Four single-stranded DNAs (ssDNA) S1, S2, S3, S4 were dissolved in TM Buffer (10mM Tris-HCl,50mM MgCl)2pH 8.0) to make the final concentration of four single-stranded DNAs 1000nM, mixing them uniformly, heating to 95 ℃ quickly and keeping for 10 minutes, then cooling to 4 ℃ quickly and keeping for more than 20 minutes, and then self-assembling to obtain DNA tetrahedron, the principle of which is shown in fig. 1 a.
The four single-stranded sequences (5 '→ 3') are as follows:
S1：
ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA(SEQ ID NO.1)
S2：
ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG(SEQ ID NO.2)
S3：
ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC(SEQ ID NO.3)
S4：
ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG(SEQ ID NO.4)
2. identification
Transmission electron microscopy (fig. 1b) shows the formation of a granular structure that is approximately triangular; the result of PAGE gel (FIG. 1c) and capillary electrophoresis (FIG. 1d) shows that the tetrahedral DNA band is clear, the size is about 180bp, and is larger than the single-stranded DNA composing it; the particle size distribution and Zeta potential test of tFNAs show that the particle size distribution is uniform and is 20.99 +/-5.92 nm, and the Zeta potential is-6.79 +/-3.64 mV (figure 1 e); cy 5-labeled tFNA treated cells were taken up by the cells and emitted red fluorescence (FIG. 1 f). The foregoing results indicate that DNA tetrahedra are successfully synthesized.
The invention will be further illustrated in the form of experimental examples in which the tFNAs used were prepared by the method of example 1.
Experimental example 1 therapeutic Effect of DNA tetrahedron on periodontitis
1. Method of producing a composite material
A periodontitis animal model was established by winding SD male rats 8-10 weeks old with 3-0 silk thread around maxillary second molar for 3 weeks.
After the day of modeling, the experimental group injected 20 μ l of DNA tetrahedron at the mucous membrane of the palatal second molars and palatal second molars of rats at concentrations of 250nM and 500nM, and the control group injected an equivalent amount of physiological saline. Both groups were injected once daily, the corresponding rats were sacrificed 21 days after drug injection, and maxilla tissue samples were collected for detection:
(1) fixing the sampled maxillary bone tissue, and then carrying out micro-CT (micro-CT) scanning to analyze the alveolar bone absorption change condition.
(2) And (3) fixing, dehydrating, embedding and slicing the sampled maxilla tissues, and performing H & E staining, TRAP staining and immunohistochemical staining of IL-6 and IL-1 beta protein respectively.
The blank group was not treated with thread binding and injection.
2. Results
2.1 inflammatory reaction
The detection scheme is shown in fig. 2 a.
As can be seen from the H & E staining results, the inflammatory cells in the experimental group were significantly reduced compared to the control group, even to a level similar to that of the blank group (fig. 2 b). The expression levels of interleukin 1(IL-1) and interleukin 6(IL-6) in the experimental group are significantly lower than those in the control group, and even lower than those in the blank group (FIG. 2c, d, e).
The results indicate that tFNAs can significantly reduce the inflammatory response of periodontitis.
2.2 periodontal tissue Observation
A schematic view of the periodontal tissue is shown in FIG. 3 a.
As seen from Masson staining, the density of periodontal collagen fibers was decreased (lighter blue) in the control group, whereas the density of collagen fibers was higher in the experimental group than in the control group and was concentration-dependent (fig. 3 b). The H & E staining results showed cementum resorption in the control group, while no significant bone resorption in the experimental group (fig. 3 c). TRAP staining showed the number of osteoclasts, with the control group having a greater number of osteoclasts and the experimental group having a significantly smaller number of osteoclasts (fig. 3 d).
This result indicates that tFNAs can protect periodontal tissues from inflammatory destruction.
2.3 micro-CT detection of alveolar bone
A schematic diagram of micro-CT detection of alveolar bone is shown in FIG. 4 a.
According to the micro-CT three-dimensional reconstruction image, the alveolar bone of the control group has more small holes, the bone absorption is serious, and the tooth root exposure condition is very obvious; whereas the alveolar bone was not significantly absorbed and was intact in the experimental group, the tooth root exposure of the group injected with tFNAs 500nM was comparable to that of the blank group (FIG. 4 b). The statistical analysis of the alveolar bone resorption in the mesial, middle and distal molar teeth of the second molars showed that the alveolar bone resorption degree in the experimental group was significantly lower than that in the control group (fig. 4 c).
As can be seen from the bone-related analysis, BV/TV (relative bone volume or bone volume fraction) was significantly improved in the experimental group compared to the control group, with the tFNAs 500nM group even better than the blank group; the Tb.Sp (trabecular bone resolution, mean width of medullary cavity between the trabeculae of the phalanges, which is equivalent to the porosity of the porous material) of the experimental group is reduced relative to the control group and is even lower than that of the blank group; tb.th (trabecular bone thickness, equivalent to the pore wall thickness of the porous material) was increased in the experimental group relative to the control group; the difference in tb.n (trabecular number) was small for each group, but the experimental group was still slightly higher than the control group (fig. 4 d).
The results show that tFNAs can obviously inhibit bone resorption caused by periodontitis and improve bone mass.
In conclusion, tFNAs has the effects of relieving inflammation, protecting periodontal tissues and improving alveolar bone mass, can overcome the defect that antibiotic medicines can only resist inflammation but can not radically cure periodontitis, and has good application value.
SEQUENCE LISTING
<110> Sichuan university
Application of <120> DNA tetrahedron in preparation of medicine for treating and preventing periodontitis
<130> GYKH1118-2020P0111850CC
<160> 4
<170> PatentIn version 3.5
<210> 1
<211> 63
<212> DNA
<213> Artificial sequence
<400> 1
atttatcacc cgccatagta gacgtatcac caggcagttg agacgaacat tcctaagtct 60
gaa 63
<210> 2
<211> 63
<212> DNA
<213> Artificial sequence
<400> 2
acatgcgagg gtccaatacc gacgattaca gcttgctaca cgattcagac ttaggaatgt 60
tcg 63
<210> 3
<211> 63
<212> DNA
<213> Artificial sequence
<400> 3
actactatgg cgggtgataa aacgtgtagc aagctgtaat cgacgggaag agcatgccca 60
tcc 63
<210> 4
<211> 63
<212> DNA
<213> Artificial sequence
<400> 4
acggtattgg accctcgcat gactcaactg cctggtgata cgaggatggg catgctcttc 60
ccg 63
Claims (10)
- Use of a DNA tetrahedron for the preparation of a medicament for the treatment and prophylaxis of periodontitis.
- 2. Use according to claim 1, characterized in that: the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNA with a sequence shown as SEQ ID No. 1-4.
- 3. Use according to claim 2, characterized in that: the DNA tetrahedron is prepared by the denaturation of the four DNA single strands at 95 ℃ for 10min and the retention at 4 ℃ for more than 20 min.
- 4. Use according to any one of claims 1 to 3, wherein: the medicament is a medicament for protecting periodontal tissue and/or alveolar bone.
- 5. Use according to claim 1, characterized in that: the medicine is an injection preparation.
- 6. A medicament for treating and preventing periodontitis, which is characterized in that: the medicine is prepared by taking DNA tetrahedron as an active ingredient and adding pharmaceutically acceptable auxiliary ingredients.
- 7. The medicament of claim 6, wherein: the DNA tetrahedron is prepared by base complementary pairing of single-stranded DNA with a sequence shown as SEQ ID No. 1-4.
- 8. The medicament of claim 7, wherein: the DNA tetrahedron is prepared by the denaturation of the four DNA single strands at 95 ℃ for 10min and the retention at 4 ℃ for more than 20 min.
- 9. The medicament according to any one of claims 6 to 8, wherein: the medicament is a medicament for protecting periodontal tissue and/or alveolar bone.
- 10. The medicament of claim 6, wherein: the medicine is an injection preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011305955.XA CN112353811A (en) | 2020-11-19 | 2020-11-19 | Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011305955.XA CN112353811A (en) | 2020-11-19 | 2020-11-19 | Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112353811A true CN112353811A (en) | 2021-02-12 |
Family
ID=74533516
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011305955.XA Pending CN112353811A (en) | 2020-11-19 | 2020-11-19 | Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112353811A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115192725A (en) * | 2021-04-12 | 2022-10-18 | 四川大学 | Medicine for treating cerebral hemorrhage |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111467364A (en) * | 2020-05-11 | 2020-07-31 | 四川大学 | Medicine for preventing drug-induced osteonecrosis of jaw |
-
2020
- 2020-11-19 CN CN202011305955.XA patent/CN112353811A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111467364A (en) * | 2020-05-11 | 2020-07-31 | 四川大学 | Medicine for preventing drug-induced osteonecrosis of jaw |
Non-Patent Citations (3)
| Title |
|---|
| MI ZHOU等: "Effect of tetrahedral DNA nanostructures on proliferation and osteogenic differentiation of human periodontal ligament stem cells", 《CELL PROLIFERATION》 * |
| YI LIU等: "Periodontal Ligament Stem Cell-Mediated Treatment for Periodontitis in Miniature Swine", 《STEM CELLS》 * |
| 樊明文: "《中华医学百科全书 2 临床医学 口腔医学》", 30 November 2018 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115192725A (en) * | 2021-04-12 | 2022-10-18 | 四川大学 | Medicine for treating cerebral hemorrhage |
| CN115192725B (en) * | 2021-04-12 | 2023-05-23 | 四川大学 | Medicine for treating cerebral hemorrhage |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Holland et al. | Reaction of dogs' teeth to root canal filling with mineral trioxide aggregate or a glass ionomer sealer | |
| Palma et al. | Histologic evaluation of regenerative endodontic procedures with the use of chitosan scaffolds in immature dog teeth with apical periodontitis | |
| Ricucci et al. | Recurrent apical periodontitis and late endodontic treatment failure related to coronal leakage: a case report | |
| Hosoya et al. | A review of the literature on the efficacy of mineral trioxide aggregate in conservative dentistry | |
| JP5970046B2 (en) | Granulation tissue forming agent containing genetically modified gelatin | |
| Yildirim et al. | Histologic study of furcation perforations treated with MTA or Super EBA in dogs' teeth | |
| Wikesjö et al. | Periodontal repair in dogs: Effect of rhBMP‐2 concentration on regeneration of alveolar bone and periodontal attachment | |
| Becerra et al. | Histologic study of a human immature permanent premolar with chronic apical abscess after revascularization/revitalization | |
| Wang et al. | Histologic characterization of regenerated tissues in canal space after the revitalization/revascularization procedure of immature dog teeth with apical periodontitis | |
| Holland et al. | Reaction of the lateral periodontium of dogs’ teeth to contaminated and noncontaminated perforations filled with mineral trioxide aggregate | |
| Wikesjö et al. | Periodontal repair in dogs: rhBMP‐2 significantly enhances bone formation under provisions for guided tissue regeneration | |
| Holiel et al. | Histological evaluation of the regenerative potential of a novel treated dentin matrix hydrogel in direct pulp capping | |
| Al-Hezaimi et al. | Histomorphometric and micro–computed tomography analysis of pulpal response to three different pulp capping materials | |
| Bottino et al. | A novel patient‐specific three‐dimensional drug delivery construct for regenerative endodontics | |
| Seltzer et al. | Epithelial proliferation in periapical lesions | |
| Londero et al. | Histologic analysis of the influence of a gelatin-based scaffold in the repair of immature dog teeth subjected to regenerative endodontic treatment | |
| Åstrand et al. | Changes in the alveolar process after extractions in the white rat a histologic and fluorescence microscopic study | |
| Walsh et al. | Histology of NeoMTA Plus and Quick-Set2 in contact with pulp and periradicular tissues in a canine model | |
| JPS62228029A (en) | Drug composition and manufacture | |
| Shaw et al. | Electrosurgical pulpotomy—A 6-month study in primates | |
| DE69610826T2 (en) | DENTINE'S MORPHOGEN-REGENERATED REGENERATION | |
| CN112353811A (en) | Application of DNA tetrahedron in preparation of medicine for treating and preventing periodontitis | |
| Yang et al. | Effects of platelet-rich plasma on tooth replantation in dogs: a histologic and histomorphometric analysis | |
| Barbosa et al. | Human pulp pesponse to Portland cement and MTA | |
| JP5384120B2 (en) | Therapeutic agent for periodontal diseases and alveolar bone defects caused by surgery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |