CN112342290B - Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis - Google Patents
Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis Download PDFInfo
- Publication number
- CN112342290B CN112342290B CN202011226557.9A CN202011226557A CN112342290B CN 112342290 B CN112342290 B CN 112342290B CN 202011226557 A CN202011226557 A CN 202011226557A CN 112342290 B CN112342290 B CN 112342290B
- Authority
- CN
- China
- Prior art keywords
- mir
- apoptosis
- protein
- hcy
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a screening method of non-coding small molecular RNA related to liver injury hepatocyte apoptosis and application thereof, and cbs is used +/‑ The gene knockout mouse and the liver cell are taken as research objects, RNA and protein of tissues or cells are extracted, genes related to HHcy induced liver injury are screened out, expression changes of miR-212-5p, apoptosis related protein and unfolded protein are verified at the cell level, and the Hcy induced liver injury specific disease combined diagnosis method consisting of three gene networks of miR-212-5p, apoptosis related gene and unfolded protein is established. The method is simple and reliable, has convenient material acquisition, has high sensitivity and specificity which are highly consistent with the results of biochemical diagnosis, and has great application value in the early diagnosis and prognosis evaluation of HHcy-induced liver injury diseases.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and relates to a screening method of non-coding small molecular RNA related to liver injury hepatocyte apoptosis and application thereof.
Background
Homocysteine (Hcy) is a thiol-containing non-protein amino acid produced during the methylation and demethylation of methionine nucleic acids, and plasma Hcy concentrations in excess of 15. Mu. Mol/l plasma are defined as hyperhomocysteinemia (HHcy). Are involved in the pathogenesis of a variety of diseases, including atherosclerosis, hypertension, and coronary artery disease.
Glutathione (GSH) is a main oxidation-reduction buffer solution in cells in livers, is important for discharging foreign matters in liver cells and expelling other environmental toxins, is produced in a large amount in the process of converting Hcy into cysteine, mainly relates to the activities of cystathionine beta-synthase (CBS) and cystathionine g-lyase (CGL), and can cause the severe increase of Hcy level when the activity of CBS is inhibited, so that the Hcy level in blood plasma is increased, and simultaneously, the GSH is reduced, so that the discharge of foreign matters and toxins by the livers is blocked, and the liver is damaged.
The endoplasmic reticulum stress unfolded protein reaction is one of important ways of apoptosis, participates in regulation and control of a plurality of diseases, plays a key role in the steady state of protein, and under the condition that various external stimuli exist continuously, the requirement for protein folding is increased, the original normal folding process is damaged, the misfolded protein is accumulated in the ER to expand the ER, so that the ER stress and the Unfolded Protein Response (UPR) are activated, cells are apoptotic, and the damage of organs is caused.
miRNA is non-coding endogenous RNA (length is 22-25 nucleotides), can regulate and control gene expression by combining with a complementary sequence in 3' UTR of target mRNA, and is involved in various biological regulation and control processes such as apoptosis, inflammation, proliferation, differentiation, aging and the like. Research shows that miR-212 has a tumor promotion effect in NSCLC and a proliferation inhibition effect in gastric cancer. miR-212-5p inhibits expression of BRCA1 through binding with a target of BRCA1, so that apoptosis induced by radiation is mediated, and the experimental study finds that miR-212-5p is down-regulated in liver injury caused by HHcy, and hepatic cell injury is remarkably reduced after miR-212-5p is over-expressed, which indicates that miR-212-5p plays an important role in liver injury caused by HHcy and can be used as a therapeutic target of liver injury caused by HHcy.
Disclosure of Invention
The invention aims to provide a screening method and application of non-coding small molecular RNA related to liver injury hepatocyte apoptosis, the method develops a molecular miR-212-5p for inhibiting liver excessive injury aiming at a treatment target for early prevention and treatment of liver injury, and a tissue specimen in the invention is from male cbs +/- A knockout mouse of gene, the cell is the hepatocyte of human origin, the main detection index is the expression of miR-212-5p, miR-212-5p over-expresses or interferes with the post-flow cytometry to detect the apoptosis of the hepatocyte, and western blot detects the detection of endoplasmic reticulum stress unfolded protein response related protein GRP78, PERK, p-PERK, eIF2a, p-eIF2a and CHOP, apoptosis related protein clear caspase-3, clear caspase-12, bax and Bcl-2.
The technical scheme is as follows:
a screening method of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis comprises the following steps:
(1) Construction of cbs +/- Knocking out a mouse hyperhomocysteinemia model by genes, and simulating hyperhomocysteinemia by using Hcy intervention hepatic cells in vitro;
(2) Detecting the expression of miR-212-5p in the liver and after the intervention of Hcy on the liver cells by real-time fluorescent quantitative PCR;
(3) Detecting the transfection efficiency of the constructed miR-212-5p micic and inhibitor by real-time fluorescent quantitative PCR;
(4) After the hepatic cells are transfected with miR-212-5p mimic and inhibitor, and Hcy intervenes the hepatic cells for 48 hours, western blot detects stress unfolded protein molecules and apoptosis related molecules of the endoplasmic reticulum of the hepatic cells;
(5) After the hepatic cells are transfected with miR-212-5p mimic and inhibitor, and the Hcy intervenes the hepatic cells for 48 hours, detecting the hepatic cell apoptosis by flow cytometry;
(6) The detection sensitivity of the non-coding micromolecule RNAmiR-212-5p in liver injury is analyzed and compared with that of a conventional liver injury detection method, and meanwhile, artificial recovery and supplement of miR-212-5p can be used as an important target point for liver injury treatment.
Further, in cbs +/- In the gene knockout mice, compared with the normal group, the expression of miR-212-5p in the liver tissue of HHcy is obviously reduced, and the same trend is obtained in the liver cells intervened by Hcy in vitro. After miR-212-5p mimic and inhibitor are constructed and transfected to hepatocytes respectively, the miR-212-5p mimic can remarkably reduce the stress unfolded protein reaction of endoplasmic reticulum induced by Hcy, so that the apoptosis of the hepatocytes is relieved, and the miR-212-5p inhibitor remarkably promotes the endoplasmic reticulumThe net stress unfolded protein response further exacerbates hepatocyte apoptosis. The detection of the expression down-regulation of miR-212-5p as an important diagnosis target of liver injury and the existing liver function injury index combined diagnosis can further improve the detection rate of liver injury, discover diseases in time and treat diseases at early stage.
The application of the non-coding small-molecule RNA miR-212-5p obtained by the screening method in the preparation process of the reagent for diagnosing liver injury caused by HHcy.
The invention has the beneficial effects that:
(1) The invention finds out that the non-coding small molecular RNA miR-212-5p is used as an early diagnosis target of liver injury caused by HHcy.
(2) The invention discovers that the expression of the supplementary miR-212-5p in vivo can relieve the liver injury induced by HHcy, and can be used as a therapeutic target of the liver injury.
(3) The invention has the advantages that the diagnosis formed by the combination of miR-212-5p, unfolded protein and apoptosis-related protein is highly consistent with the existing diagnosis result and is sensitive.
(4) The method of the invention takes the liver cells from the cbs gene knockout mouse HHcy and the human source, and the method is simple, reliable and easy to popularize.
Drawings
FIG. 1A miR-212-5p expression alteration in hepatocytes, cbs +/+ 、cbs +/- The expression level of miR-212-5p in the liver of the mouse is changed;
FIG. 1B expression of miR-212-5p in hepatocytes is changed, and after Hcy intervenes in hepatocytes, expression of miR-212-5p is changed. ** P＜0.01vs cbs +/+ or control；
FIG. 2 shows the transfection efficiency verification of miR-212-5p mimics and inhibitor, wherein A is the expression change of miR-212-5p detected by qRT-PCR after miR-212-5p mimics are transfected by hepatocytes; b, after the cell is transfected with miR-212-5p inhibitor, qRT-PCR is used for detecting the expression change of the miR-212-5 p. ** P＜0.01vs mic-NC or inh-NC；
FIG. 3 shows that miR-212-5p regulates and controls the expression change of stress unfolded protein of endoplasmic reticulum of hepatocytes, wherein A is Hcy intervention hepatocyte 48h after miR-212-5p mimics are transfected by hepatocytes, and western blot detection is performed on the Hcy intervention hepatocyte 48hProtein expression levels of unfolded proteins marker GRP78, PERK, p-PERK, IRE1a, p-IRE1a, eIF2a, p-eIF2a, ATF6, and CHOP. * P＜0.05， ** P＜0.01vs mic-NC， # P＜0.05， ## P is less than 0.01vs Hcy + mic-NC; b is Hcy intervened in the hepatocytes 48h after the hepatocytes are transfected with miR-212-5p inhibitor, and western blot detects the protein expression levels of unfolded proteins marker GRP78, PERK, p-PERK, IRE1a, p-IRE1a, eIF2a, p-eIF2a, ATF6 and CHOP. * P＜0.05， ** P＜0.01vs inh-NC； # P＜0.05， ## P＜0.01vs Hcy+inh-NC；
FIG. 4 shows that miR-212-5p regulates the expression change of the hepatocyte apoptosis-related protein, wherein after A is the overexpression of miR-212-5p, the expression change of apoptosis-related proteins clearcaspase-3, clearcaspase-12, bcl-2 and Bax is detected by using western blot. * P＜0.05， ** P＜0.01vs mic-NC， # P＜0.05， ## P is less than 0.01vs Hcy + mic-NC; and B, after miR-212-5p expression is interfered, using western blot to detect expression changes of apoptosis-related proteins clear caspase-3, clear caspase-12, bcl-2 and Bax. * P＜0.05， ** P＜0.01vs inh-NC， # P＜0.05， ## P＜0.01vs Hcy+inh-NC；
FIG. 5 shows that miR-212-5p regulates the expression change of hepatocyte apoptosis, wherein A is miR-212-5p mimics transfected into hepatocytes, hcy intervenes in the hepatocytes 48h, and annexin V-FITC-PI flow cytometry detects hepatocyte apoptosis. * P＜0.05， ** P is less than 0.01vs mic-NC, # P＜0.05， ## p < 0.01vs Hcy + mic-NC group; b is miR-212-5p inhibitor transfected into the hepatocyte, hcy intervenes the hepatocyte 48h, annexin V-FITC-PI flow cytometry detects hepatocyte apoptosis. * P＜0.05， ** P is less than 0.01vs inh-NC, # P＜0.05， ## P＜0.01vs Hcy+inh-NC。
Detailed Description
The technical solution of the present invention will be described in further detail with reference to specific embodiments.
1 Material
1.1 Primary reagents
A fluorescent quantitative kit of America Fermentas company, namely a Ruibo miR-212-5p kit; a bebo cell apoptosis detection kit; clear caspase-3, caspase-12, bax, bcl-2, GRP78, PERK, p-PERK, eIF2a, p-eIF2a, IRE1a, p-IRE1a, and CHOP antibodies.
1.2 Main Instrument
A clean bench, a Berle rotary film instrument, a Berle electric rotary instrument, a nucleic acid analyzer, a gel imaging system, a low-temperature refrigerator, a mini centrifuge, a high-speed low-temperature centrifuge, a freezing microtome, a fluorescent quantitative PCR and a common PCR.
2 method
2.1 selection of subjects
cbs +/- Mice were purchased from Jackson laboratories, USA, and were housed in the Ningxia university of medicine laboratory animal under SPF-level environment and randomly assigned to cbs as a control group +/+ And experimental group cbs +/- Two groups of mice were fed a 2% methionine diet for 12 weeks, respectively.
2.2 HL7702 normal hepatocytes: cell conservation is in Ningxia vessel injury and repair research focus laboratories.
2.3 expression assay of miR-212-5p in mouse liver and hepatocytes
Total RNA extraction
Sample processing
(1) Mouse liver tissue: mouse liver tissue 80mg was weighed in a clean bench, 1ml of RZ lysate was added, and vortexed in a vortexer to ensure sufficient lysis.
(2) Normal liver cells: the remaining liquid was aspirated off and 1ml of RZ lysate was added, and the flask was shaken to bring the lysate into full contact with the cells.
(3) Transferring the lysate obtained in the above step to a 1.5ml RNase-free centrifuge tube, and standing at room temperature for 5min to completely separate nucleic acid from protein.
(4) The tissue lysate was centrifuged at 12,000rpm at 4 ℃ for 5min using a centrifuge, and the supernatant was transferred to a new 1.5ml RNase centrifuge tube for subsequent processing.
(5) The supernatant was added to 200. Mu.l of chloroform, sufficiently shaken for 15 seconds, and left at room temperature for 3min.
(6) Centrifuging at 4 deg.C and 12,000rpm for 10min, and collecting the upper layer of colorless liquid. Transfer to a new 1.5ml RNase-free centrifuge tube.
(7) Adding 250 μ l of anhydrous ethanol solution, transferring to CR3 adsorption column, and centrifuging at 4 deg.C 12,000rpm 30s
(8) Adding 500 μ l protein solution RD into CR3 adsorption column, centrifuging at 12,000rpm for 30s at 4 deg.C,
(9) Adding 500 μ l of rinsing solution RW (anhydrous ethanol should be added according to the instruction before adding) into CR3 adsorption column, standing at room temperature for 2min, centrifuging at 4 deg.C for 12,000rpm 30s, and discarding the waste liquid in collection tube.
(10) The above-mentioned operation steps of the rinsing liquid PW are repeated.
(11) The collecting tube and the CR3 adsorption column are assembled, centrifuged at 12,000rpm at 4 ℃ for 2min, the liquid adsorbed in the adsorption column CR3 is removed, and the air is dried for 5min.
(12) The adsorption column CR3 was assembled with a new 1.5ml centrifuge tube, 80. Mu.l RNase-Free dd H2O was added, the mixture was left at room temperature for 3min, and centrifuged at 12,000rpm4 ℃ for 2min.
MiRNA cDNA Synthesis
The miR-212-5p primer is designed by Shazhou Ruibo company, experiments are carried out by using Bulge lopTM miRNA qRT-PCR primer sets, and the kit contains a specific reverse transcription reagent of miR-212-5p and a PCR primer for miR-212-5p fluorescence quantification. U6 is used as an internal reference, primers are designed by Ruibo, guangzhou, and Bulge loptm miRNA qRT-PCR rimers ets are used, a kit contains a reverse transcription reagent specific to U6, and U6 fluorescent quantitative PCR primers.
(1) The miRNA reverse transcription reaction firstly dilutes Bulge-LoopTM miRNA RT Primer in the kit. Bulge-LoopTM miRNA RT Primer (20. Mu.M) was diluted 1: 4 and prepared in 20. Mu.l (5. Mu.M) of Bulge-LoopTM miRNA RT Primer, and 15. Mu.l RNase-free H2O was added to 5. Mu.l (20. Mu.M) of Bulge-LoopTM miRNA RT Primer using a pipette. The reverse transcription experiment was carried out using a 10. Mu.l reaction system or a 20. Mu.l system as shown in Table 1.
TABLE 1 miR-212-5p and U6 reverse transcription systems
Shaking and instantaneous centrifuging. Avoiding the generation of bubbles and then carrying out reverse transcription.
(2) The reaction procedure for reverse transcription of mirnas is shown in table 2,
TABLE 2 miR-212-5p and U6 reverse transcription reaction procedures
The product obtained from the reaction was quickly stored at-80 ℃.
(3) Quantitative fluorescence detection of miRNA was performed using a 20. Mu.l qPT-PCR reaction system as recommended by the reagent instructions and is shown in Table 3.
TABLE 3 detection System for miR-212-5p and U6 qRT-PCR reactions
The sample was placed in a fluorescent quantitative PCR apparatus for detection, and the procedure was as shown in Table 14 below.
TABLE 4 fluorescent quantitation procedure for miR-212-5p and U6
(4) Calculation of results
2.4 Western Blot procedure
2.4.1 Total protein extraction:
(1) Scraping the intervened hepatic cells by using cells, then placing the scraped hepatic cells in a centrifuge for centrifugation, centrifuging the scraped hepatic cells at 3000rpm at 4 ℃ for 5min, and discarding waste liquid.
(2) Cells were washed 3 times with pre-chilled PBS and centrifuged to remove waste.
(3) The whole protein lysate was prepared at low temperature, 1. Mu.l protease inhibitor, 10. Mu.l phosphatase inhibitor and 5. Mu.l 100mM PMSF were added to 1ml lysis buffer, mixed and placed on ice.
(4) Every 25cm 2 Adding 500 μ l of prepared lysate into cells obtained from cell culture flask, shaking repeatedly and vigorously, operating at low temperature, centrifuging at 4 deg.C and 12,000rpm for 10min, and packaging supernatant at-80 deg.C.
2.4.2 BCA method for measuring cell holoprotein
(1) According to the specification, the corresponding reagents were added as per table 5:
TABLE 5 BCA protein quantitation Standard Curve
(2) Preparing a BCA working solution at low temperature: the quantity is determined according to the number of the standard substance and the sample to be detected, the reagent A and the reagent B are configured in a volume ratio of 50: 1 and are placed in the constant temperature module after being frozen.
(3) Samples were added to corresponding wells mixed with 1. Mu.l whole protein plus 19. Mu.l deionized water, followed by addition of 200. Mu.l BCA working solution to each well.
(4) And (3) gently shaking the 96-well plate, incubating at 37 ℃ in a dark place, reacting in a thermostat for 30min, and detecting and reading the absorbance value in each well according to a preset program (562 nm wavelength).
(5) The protein concentration in each sample was normalized to 3. Mu.g/. Mu.l.
2.4.3 protein denaturation
Mu.l of protein lysate was added to 40. Mu.l of loading Buffer, mixed and deformed by heating in a metal bath at 99.5 ℃ for 10min.
2.4.4 Western Blot Experimental procedure
(1) Cleaning the glass plate, firstly using tap water to remove surface stains on the glass plate, then using distilled water to clean the glass plate again, then placing the glass plate in an oven at 60 ℃ to be baked, completely assembling a baked glass plate glue making frame, paying attention to sealing, and preparing the required SDS-PAGE glue according to the experimental amount.
(2) Mu.l of a pre-stained protein marker was added to the prepared gel, followed by 30. Mu.l of protein sample per well.
(3) Electrophoresis: the power is switched on, the voltage is initially 80V until the gel runs out for about 15min, then the voltage is increased to 120V for about 50min till the bottom of the gel, and then the power is switched off.
(4) Electric conversion: cutting a PVDF film according to the number of loaded lanes, then putting the PVDF film into absolute ethyl alcohol for activation for 5min, then putting filter paper into prepared electrotransfer liquid, cutting gel after electrophoresis, cutting off concentrated gel, reserving all separation gel below the concentrated gel, manufacturing a sandwich structure of filter paper → PVDF film → gel → filter paper, paying attention to remove bubbles in the manufacturing process, cleaning the bottom of a cover of a semi-dry transfer instrument, which is in contact with the filter film, covering the cover, and switching on a power supply, wherein the membrane transfer condition of the whole gel is 15V 75min.
(5) And (3) sealing: and (3) soaking the PVDF membrane after the membrane conversion in prepared skim milk, placing the PVDF membrane on a horizontal shaker, sealing at 80rpm for 2h, and then cleaning the PVDF membrane with PBST for three times at 100rpm for 10min.
(6) Primary antibody incubation: the above washed PVDF membrane was tailored to the molecular weight of the gene of interest, followed by incubation of the corresponding primary antibody at 4 ℃ overnight.
(7) And (3) secondary antibody incubation: primary antibody recovery was followed by washing with PBST, 100rpm for 10min three times, and secondary antibody was incubated according to primary antibody source, at room temperature for 2h.
(8) Exposure: after discarding the secondary antibody, PBST was used for washing three times at 100rpm 10min to prepare luminescent solutions A: B = 1: 1, and 3ml of each of the two solutions was added and mixed. And (6) exposing.
(10) And (4) counting results: selecting a picture with good quality in an exposure picture, adopting software image J to analyze the strip gray, calculating an optical density value, and comparing the optical density value with an internal reference beta-actin so as to calculate the relative expression quantity.
2.5 miR-212-5p mimic and inhibitor transfected hepatocyte
(1) Cell plating, passage of hepatocytes into 6-well plates, and transfection until the next day, cell growth reached 30-50%.
(2) Transfection, 250. Mu.l of 1640 pure medium (without serum, without antibiotics) was added to a 1.5ml ER tube, followed by addition of 0.5OD 6.25. Mu.l of miR-212-5p mimic or inhibitor (sequence shown in Table 15) thereto, followed by mixing. To another 1.5ml ER tube was added 250. Mu.l of 1640 pure medium, to which was added 5. Mu.l of Lipofectamine TM 2000, mixing and standing for 5min. Then, the two tubes of liquid are mixed evenly and kept stand for 20min. The original culture medium in the six-well plate was discarded, 1.5ml of pure culture medium was added, and after 20min, 500. Mu.l of the mixed liquid was added to the six-well plate. After 6 hours, the culture medium is changed to a normal culture medium, hcy medicine is added for intervention, and other subsequent experiments are carried out after 48 hours.
TABLE 6 miR-212-5p micic and inhibitor sequences (from Shanghai Ji code)
miR-212-5p mimics sense(5’-3’)ACCUUGGCUCUAGACUGCUUACU
antisense(5’-3’)UAAGCAGUCUAGAGCCAAGGUUU
miR-212-5p inhibitor sense(5’-3’)AGUAAGCAGUCUAGAGCCAAGGU
2.6 flow cytometry detection of apoptosis of hepatocytes
(1) Digesting hepatic cells with trypsin containing no phenol red and no EDTA, adding pancreatin, and placing in an incubator at 37 deg.C for 2min; the pancreatin was then aspirated off using a bus pipette and blown in with PBS. The operation was repeated by centrifuging the mixture at 1000rpm for 5min in a centrifuge.
(2) Adding 500 mul Binding buffer to blow and suspend the cells;
(3) Adding 5 μ l Annexin V-FITC, mixing, adding 5 μ l Propidium Iodid, mixing, and reacting at room temperature in dark place for 15min;
(4) And (5) finishing the on-machine detection within 1h, and filtering before the detection.
2.7 statistical treatment
Data were statistically processed using Prism 6.0 software. The data are all measured data and are expressed by means of mean +/-standard deviation, student's t test is adopted for mean comparison between two samples, one-way ANOVA test is adopted for mean comparison between multiple samples, student-Newman-Keuls test is adopted for pairwise comparison between each group of results, and P is less than 0.05, so that the statistical significance is achieved.
3 results
3.1 Expression change of miR-212-5p in liver cells
To clarify that miR-212-5p is involved in the regulation of hepatocyte apoptosis by HHcy, qRT-PCR is used for detecting the expression of miR-212-5p in mouse liver, and the expression is compared with that of control group mice (cbs) +/+ High methionine diet mice) HHcy mice (cbs) +/- High methionine diet mouse) expression of miR-212-5P in the liver was significantly decreased (P < 0.01) (fig. 1A). To further verify that HHcy caused decreased miR-212-5P expression, hepatocytes were intervened with 100 μmol/l Hcy for 48h, in vitro to mimic HHcy, and miR-212-5P expression in hepatocytes was detected using qRT-PCR, consistent with animal level results, with significantly decreased miR-212-5P expression (P < 0.01) following Hcy intervention in hepatocytes compared to control group (fig. 1B).
3.2 miR-212-5p mimics and inhibitor transfection efficiency verification
In order to verify the biological function of miR-212-5P, constructed miR-212-5P mimics (miR-212-5P mimics) and inhibitor (miR-212-5P inhibitor) are respectively transfected into hepatocytes, and qRT-PCR verifies the transfection efficiency, compared with a mic-NC (mimic normal control) group, the expression of miR-212-5P is remarkably increased (P is less than 0.01) after miR-212-5P mimics are transfected (FIG. 2A); compared with an inh-NC (inhibitor normal control) group, the expression of miR-212-5P is remarkably reduced (P is less than 0.01) after miR-212-5P is transfected (FIG. 2B).
3.3 miR-212-5p regulates expression change of endoplasmic reticulum stress unfolded protein of liver cells
Early-stage experiment results show that Hcy can induce the hepatic cell to undergo apoptosis through an endoplasmic reticulum stress pathway, in order to determine whether miR-212-5p participates in the regulation and control of the process, the hepatic cell is transfected with miR-212-5p mimics or miR-212-5p inhibitor respectively, the Hcy interferes with the hepatic cell 48h, and western blot detects the endoplasmic reticulum stress state of the hepatic cell. The results show that when miR-212-5P is over-expressed in the liver cells, western blot detects endoplasmic reticulum stress unfolded proteins marker GRP78, PERK, P-PERK, IRE1a, P-IRE1a, eIF2a, P-eIF2a, ATF6 and CHOP, and compared with the Hcy + mic-NC group, the protein expression levels of the GRP78, PERK, P-PERK, IRE1a, P-IRELA, eIF2a, P-eIF2a, ATF6 and CHOP in the Hcy + miR-212-5P mimics group are obviously reduced (P < 0.05) (FIG. 3A). The result shows that the Hcy-induced endoplasmic reticulum stress of the liver cells can be remarkably relieved by over-expressing miR-212-5 p. In order to further verify the regulation and control of miR-212-5p on endoplasmic reticulum stress, western blot detects the change of protein expression of endoplasmic reticulum stress unfolded proteins marker GRP78, PERK, p-PERK, IRE1a, p-IRE1a, eIF2a, p-eIF2a, ATF6 and CHOP after the hepatocyte is transfected with miR-212-5p inhibitor. The results showed that compared with the Hcy + inh-NC group, the Hcy + miR-212-5P inhibitor group had significantly increased unfolded protein response, and the protein expression of GRP78, PERK, P-PERK, IRE1a, P-IRE1a, eIF2a, P-eIF2a, ATF6 and CHOP were significantly increased (P < 0.05) (FIG. 3B). This result indicates that the decreased expression of miR-212-5p induces the reaction of endoplasmic reticulum stress unfolded protein.
3.4 Expression change of protein related to liver cell apoptosis regulated by miR-212-5p
In order to further prove that miR-212-5P regulates Hcy-induced hepatocyte apoptosis, miR-212-5P mimics transfect hepatocytes, hcy intervenes in the hepatocytes for 48h, and western blot is used for detecting protein expression of apoptosis-related proteins including clear caspase-3, clear caspase-12, bcl-2 and Bax, compared with the Hcy + mic-NC group, the expression of apoptosis-related proteins including clear caspase-3, clear caspase-12 and Bax in the Hcy + miR-212-5P mimic group is remarkably reduced (P < 0.05), the expression change of apoptosis-related protein Bcl-2 is remarkably increased (P < 0.05) (FIG. 4A), and the result shows that miR-212-5P is over-expressed to remarkably inhibit Hcy-induced hepatocyte apoptosis. In order to further verify that miR-212-5P regulates the apoptosis of the hepatocyte, miR-212-5P inhibitor is used for transfecting the hepatocyte, hcy intervenes the hepatocyte for 48h, the expression of miR-212-5P in the hepatocyte is knocked down, western blot is used for detecting the protein expression of apoptosis-related proteins clearase-3, clearase-12, bcl-2 and Bax, and the detection results show that compared with inh-NC, the expression of miR-212-5P inhibitor group apoptosis-related proteins clearase 3, clearase caspase12 and Bax is increased (P < 0.05), the expression of apoptosis-related protein Bcl2 is reduced (P < 0.05), hcy + miR-212-5pinhibitor and the Hcy + inh group are compared, the expression of apoptosis-related proteins clearase 3, clearase caspase12 and Bax is further increased (P < 0.05), and the expression of the miR-related proteins B-212P is further reduced (B < 0.05), and the expression of apoptosis-related proteins B-212P is further reduced (B < 0.05), and the expression of the hepatocyte induces the hepatocyte expression of the protein B-212-5P is obviously reduced (B-5P < 0.05).
3.5 Expression change of miR-212-5p for regulating hepatocyte apoptosis
The method comprises the steps of carrying out Annexin V-PI double staining, distinguishing different apoptosis stages by utilizing flow cytometry, transfecting miR-212-5p mimics into hepatocytes for further detecting Hcy by regulating the apoptosis of the hepatocytes through down-regulating miR-212-5p, and detecting the apoptosis of the hepatocytes by utilizing Annexin V-FITC-PI double staining flow cytometry for 48h through the Hcy intervention. The detection result shows that when miR-212-5P is over-expressed, hcy-induced hepatocyte apoptosis can be remarkably inhibited, and hepatocyte apoptosis is remarkably reduced (P is less than 0.05) (figure 5A). miR-212-5p inhibitor is used for transfecting the hepatocyte, the expression of miR-212-5p in the hepatocyte is knocked down, and Annexin V-FITC-PI double staining flow cytometry is used for detecting the hepatocyte apoptosis. The detection result shows that the apoptosis rate of the liver cells is remarkably increased (P is less than 0.05) in the miR-212-5P inhibitor group compared with the inh-NC group, and the apoptosis rate of the liver cells is further increased (P is less than 0.05) after miR-212-5P is knocked down in the Hcy + miR-212-5P inhibitor group compared with the Hcy + inh-NC group (FIG. 5B). The results show that Hcy regulates and controls hepatocyte apoptosis by down-regulating miR-212-5 p.
As a result, the
(1) The qRT-PCR detection result shows that miR-212-5p is in cbs +/- The expression content in mouse liver tissue is obviously lower than that of cbs +/+ The expression content and difference of mouse liver tissues have significance (P is less than 0.01), and the result shows that the expression of miR-212-5P is reduced by HHcy induction.
(2) The qRT-PCR detection result shows that the expression of miR-212-5P in an intervention group is obviously lower than that in a normal control group, the difference is significant (P is less than 0.01), and the result shows that the expression of miR-212-5P is reduced by Hcy induction.
(3) Transfecting a liver cell with miR-212-5P mimics (miR-212-5P mimics) or miR-212-5P inhibitor (miR-212-5P inhibitor), carrying out Hcy intervention on the liver cell 48h, carrying out western blot detection on UPR-related proteins GRP78, PERK, P-PERK, eIF2 alpha, P-eIF2 alpha, IRE1a, P-IRE1a, ATF6 and CHOP, and remarkably reducing the expression of the UPR-related proteins after miR-212-5P is over-expressed (P is less than 0.05); UPR related protein expression is obviously increased after miR-212-5P interferes (P is less than 0.05). The result shows that miR-212-5p participates in UPR regulation and control induced by Hcy.
(4) The HL7702 cells are transfected with miR-212-5P mimics (miR-212-5P mimics) or miR-212-5P inhibitor (miR-212-5P inhibitor), hcy intervenes in the hepatocytes 48h, western blot and flow cytometry detect apoptosis, and Hcy-induced hepatocyte apoptosis is remarkably reduced after miR-212-5P is over-expressed (P is less than 0.05). After miR-212-5P interference, hepatocyte apoptosis is remarkably increased (P is less than 0.05). The result shows that miR-212-5p participates in regulation and control of Hcy induced hepatocyte apoptosis.
4. Conclusion
The research proves that homocysteine can cause damage to the liver, and the research shows that miR-212-5p can significantly reduce the expression in the HHcy group, the liver cell can significantly reduce the liver injury induced by Hcy by over-expressing miR-212-5p after being transfected with miR-212-5p mimics or miR-212-5p inhibitor, and the liver injury is further aggravated after the miR-212-5p is inhibited. The reduction of miR-212-5p, the increase of the reaction of unfolded protein and the expression of apoptosis-related protein, the diagnosis specificity and sensitivity of the specific target molecule for HHcy induced liver injury formed by the protein on the liver injury are higher, and the evaluation and diagnosis of the HHcy induced liver injury by the specific target protein in liver tissues are reliable.
The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.
Sequence listing
<110> Ningxia medical university
<120> screening method of non-coding small molecular RNA related to liver injury hepatocyte apoptosis and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
accuuggcuc uagacugcuu acu 23
<210> 2
<211> 23
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
uaagcagucu agagccaagg uuu 23
<210> 3
<211> 23
<212> DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
aguaagcagu cuagagccaa ggu 23
Claims (1)
1. The application of the reagent for detecting the expression of the non-coding small-molecule RNA miR-212-5p in the preparation of the reagent for diagnosing liver injury caused by hyperhomocysteinemia.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011226557.9A CN112342290B (en) | 2020-11-05 | 2020-11-05 | Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011226557.9A CN112342290B (en) | 2020-11-05 | 2020-11-05 | Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112342290A CN112342290A (en) | 2021-02-09 |
| CN112342290B true CN112342290B (en) | 2022-12-13 |
Family
ID=74430144
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011226557.9A Active CN112342290B (en) | 2020-11-05 | 2020-11-05 | Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112342290B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113913508B (en) * | 2021-11-05 | 2023-03-28 | 宁夏医科大学 | Application of miR-195-3p detection reagent in preparation of product for diagnosing oxidative stress injury of liver |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109394779A (en) * | 2018-10-17 | 2019-03-01 | 河南师范大学 | A kind of miR-183 instrumentality of liver cell and its application adjusted in liver cell drug is treated in preparation |
| CN111189808A (en) * | 2019-12-25 | 2020-05-22 | 宁夏医科大学总医院 | Screening method of specific protein molecular marker related to liver injury and hepatocyte apoptosis |
-
2020
- 2020-11-05 CN CN202011226557.9A patent/CN112342290B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109394779A (en) * | 2018-10-17 | 2019-03-01 | 河南师范大学 | A kind of miR-183 instrumentality of liver cell and its application adjusted in liver cell drug is treated in preparation |
| CN111189808A (en) * | 2019-12-25 | 2020-05-22 | 宁夏医科大学总医院 | Screening method of specific protein molecular marker related to liver injury and hepatocyte apoptosis |
Non-Patent Citations (2)
| Title |
|---|
| miR-148a-5p参与了高蛋氨酸饮食诱导ApoE~(-/-) 小鼠的肝细胞凋亡;马芳等;《中国组织工程研究》;20200620(第35期);摘要、1材料与方法、2结果 * |
| miR-30a-5p启动子区DNA甲基化在同型半胱氨酸致肝损伤中的作用;孙磊等;《中国病理生理杂志》;20200119(第01期);摘要、结果部分 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112342290A (en) | 2021-02-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| He et al. | Salivary exosomal miR-24-3p serves as a potential detective biomarker for oral squamous cell carcinoma screening | |
| Xue et al. | Development and validation of serum exosomal microRNAs as diagnostic and prognostic biomarkers for hepatocellular carcinoma | |
| Vaira et al. | microRNA profiles in coeliac patients distinguish different clinical phenotypes and are modulated by gliadin peptides in primary duodenal fibroblasts | |
| Liu et al. | Identification of serum microRNAs as diagnostic and prognostic biomarkers for acute pancreatitis | |
| Xu et al. | MicroRNA-10a,-210, and-563 as circulating biomarkers for ossification of the posterior longitudinal ligament | |
| EP2734636A2 (en) | Micro-rna biomarkers for identifying risk of and/or for diagnosing lung tumour and pharmaceutical compositions thereof. | |
| Divoux et al. | MicroRNA‐196 regulates HOX gene expression in human gluteal adipose tissue | |
| CN112342290B (en) | Screening method and application of non-coding small-molecule RNA related to liver injury hepatocyte apoptosis | |
| Jian et al. | MiR-337-3p confers protective effect on facet joint osteoarthritis by targeting SKP2 to inhibit DUSP1 ubiquitination and inactivate MAPK pathway | |
| CN112359118B (en) | Application of long-chain non-coding RNA AC073352.1 as breast cancer diagnosis marker and treatment target | |
| Jia et al. | Effect of lncRNA XLOC_005950 knockout by CRISPR/Cas9 gene editing on energy metabolism and proliferation in osteosarcoma MG63 cells mediated by hsa‑miR‑542‑3p | |
| CN110699454A (en) | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample | |
| Li et al. | Circ_0114581 promotes osteogenic differentiation of BMSCs via the MiR-155-5p/HNRNPA3 axis | |
| Huang et al. | Metabolites of intestinal microflora upregulate miR-192-5p to suppress proliferation of colon cancer cells via RhoA-ROCK-LIMK2 pathway. | |
| Liu et al. | miR-1293 suppresses tumor malignancy by targeting hydrocyanic oxidase 2: therapeutic potential of a miR-1293/hydrocyanic oxidase 2 axis in renal cell carcinoma | |
| CN116334223B (en) | Application of detection reagent of alternative splicing functional site rs61746794 in preparation of colorectal cancer auxiliary diagnosis kit | |
| Jodati et al. | Different expression of Micro RNA-126, 133a and 145 in aorta and saphenous vein samples of patients undergoing coronary artery bypass graft surgery | |
| Zeinelabdeen et al. | MIAT LncRNA: A multifunctional key player in non-oncological pathological conditions | |
| CN109402253B (en) | Use of ALDH18A1 in the treatment and diagnosis of colorectal cancer | |
| Cabiati et al. | Transcriptional level evaluation of osteopontin/miRNA-181a axis in hepatocellular carcinoma cell line-secreted extracellular vesicles | |
| Dara et al. | Expression of miR-let7b and miR-19b in progressive familial intrahepatic cholestasis (PFIC) children | |
| Yu et al. | Expression of B cell-specific moloney murine leukemia virus integration site 1 (BMI-1) and WW domain-containing oxidoreductase (WWOX) in liver cancer tissue and normal liver tissue | |
| CN114672558B (en) | Research method of drug resistance mechanism of liver cancer drug lenvatinib | |
| CN111304325B (en) | Oral cancer marker STOML1 gene expression and application thereof | |
| CN117106912B (en) | Enhancer RNA functional site related to colorectal cancer high-risk group identification and early screening and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |