CN112322766B - Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology - Google Patents
Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology Download PDFInfo
- Publication number
- CN112322766B CN112322766B CN202011142832.9A CN202011142832A CN112322766B CN 112322766 B CN112322766 B CN 112322766B CN 202011142832 A CN202011142832 A CN 202011142832A CN 112322766 B CN112322766 B CN 112322766B
- Authority
- CN
- China
- Prior art keywords
- pseudo
- dna
- powder
- ginseng powder
- panax
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for quantitatively detecting pseudo-ginseng powder components by utilizing a micro-drop digital PCR technology, and a primer and probe combination designed by using a pseudo-ginseng single-copy nuclear gene diacylglycerol kinase (DGK 1) in the method. The method finally constructs the linear relation between the quality of the pseudo-ginseng powder and the copy number of the nuclear gene by establishing the linear relation between the quality of the pseudo-ginseng powder and the DNA concentration and between the DNA concentration and the copy number of the gene, thereby calculating the content of the pseudo-ginseng powder. By using the microdroplet digital PCR method, the specific, rapid and accurate quantitative detection of the pseudo-ginseng powder can be realized, and the technical support is provided for maintaining the benefits of consumers and supervising the pseudo-ginseng powder market.
Description
Technical Field
The invention relates to the technical field of food detection, in particular to a method for quantitatively detecting pseudo-ginseng powder by utilizing a micro-drop digital PCR (polymerase chain reaction) technology, which comprises the steps of combining a primer and a probe designed by taking a single-copy nuclear gene diacylglycerol kinase 1 gene (DGK 1) as a target sequence, establishing the relation between the quality of the pseudo-ginseng powder and the DNA concentration and the gene copy number, and establishing the relation between the quality of the pseudo-ginseng powder and the nuclear gene copy number by taking the DNA concentration as an intermediate quantity so as to determine the content of the pseudo-ginseng powder.
Background
Notoginseng [ radix ], [ sic ]Panax notoginseng（Burk.）F. H. Chen]Is a rare Chinese medicinal material, and is listed as a raw material for health-care food. The notoginseng contains effective components of notoginsenoside, flavonoid glycoside, amino acid and volatile oil, and has the effects of enriching blood, stopping bleeding, reducing blood fat, improving cardiac muscle function and the like. With the intensive research on pseudo-ginseng in recent years, pseudo-ginseng related health-care food is also providedThe method shows diversification, high quality and high value, and the market demand is increased year by year. However, the panax notoginseng has high requirements on the ecological environment, the production area is difficult to expand and transfer, and meanwhile, continuous cropping obstacles exist in the growth of panax notoginseng, so that the yield of panax notoginseng is limited, and the price is high. Driven by economic benefits, pseudo-ginseng in the market is mixed to make the problem of counterfeiting more frequently, and normal market order is influenced.
Pseudo-ginseng powder is one of main products of pseudo-ginseng, and the problem that common edible powder with lower price, such as rice powder, potato powder, soybean powder and the like, is doped into the pseudo-ginseng powder exists in the market. The pseudo-ginseng powder without the original morphological characteristics brings great convenience to doping and adulteration. At present, the traditional microscopic character identification and physical and chemical analysis methods are mainly adopted for identifying adulteration of pseudo-ginseng powder, and the methods have the limitations that the operation is relatively complex, the detection result is influenced by the growth environment, the harvesting time and the storage condition of pseudo-ginseng, the accurate quantification cannot be realized, and the like. The method for seeking accurate qualitative and quantitative method of the pseudo-ginseng powder is the key to solve the problem of adulteration of the pseudo-ginseng powder and can promote the benign development of the pseudo-ginseng health-care food industry chain.
The droplet-type digital PCR is a nucleic acid quantification technique rapidly developed in recent years, and generates tens of thousands or millions of droplets from a reaction system containing nucleic acid molecules based on the water-in-oil principle, thereby theoretically amplifying single molecules. The micro-drop digital PCR can eliminate the influence of exogenous DNA background on the detection of target genes, and can realize the accurate detection of low-abundance genome samples. The micro-drop digital PCR technology has strong absolute quantitative capability, can obtain the copy number of a target gene without depending on a standard product and a standard curve, and has high sensitivity, stability and repeatability. The problem of specific, rapid and accurate quantitative detection of the pseudo-ginseng powder needs to be solved urgently, and at present, no relevant research report about quantitative detection of the pseudo-ginseng powder by using a micro-drop digital PCR is found.
Disclosure of Invention
The invention aims to provide a quantitative detection method for pseudo-ginseng powder. Aiming at the above purpose, the invention provides the following technical scheme:
the inventor of the invention bases on the single copy nuclear gene DGK of panax notoginseng1 designing oligonucleotide primer and probe combination capable of identifying pseudo-ginseng source components specifically, and amplifying a section of pseudo-ginseng specific gene fragment of 96 bp from sample DNA efficiently and specifically. The primer comprises an upstream primer and a downstream primer, wherein the upstream primer is Panax notoginseng-F: AGACCTATCATGATGATTACTCTTCC, the downstream primer isPanax notoginseng-R: GAATAGGAGTATGGAAACAGGTAAGAC, respectively; the probe isPanax notoginseng-P: TACCAATCCCAGCGTA, the 5 'end of the probe is connected with a fluorescence reporter group FAM, and the 3' end is connected with a fluorescence quencher group MGB.
According to another embodiment of the invention, the invention provides a method for quantitatively detecting the pseudo-ginseng powder based on micro-drop digital PCR, which establishes the relationship between the quality of the pseudo-ginseng powder and the DNA concentration, and the relationship between the DNA concentration and the gene copy number, constructs the relationship between the gene copy number and the quality of the pseudo-ginseng powder by taking the DNA concentration as an intermediate quantity, and further determines the content of the pseudo-ginseng powder. Comprises using a specific primer and probe combination aiming at the pseudo-ginseng source components.
Further, the detection method comprises the following steps:
(1) pulverizing whole main root of Notoginseng radix, and sieving to obtain Notoginseng radix powder sample;
(2) extracting genome DNA in a pseudo-ginseng powder sample, determining the concentration of the DNA, and establishing a linear relation between the quality of the pseudo-ginseng powder and the concentration of the DNA;
(3) carrying out gradient dilution on the extracted panax notoginseng powder DNA, detecting the nuclear gene copy number of the DNA with different concentrations through micro-drop digital PCR, and establishing a linear relation between the DNA concentration and the target gene copy number;
(4) constructing a linear regression equation of the quality of the pseudo-ginseng powder and the copy number of the nuclear gene by taking the DNA concentration as an intermediate quantity according to the linear relation established in the steps (2) and (3);
Further, in the step (3), the total volume of the droplet-type digital PCR reaction system is 20 μ L, including: 10 μ L of 2 XDdPCR Supermix for probe (No dUTP) (Bio-Rad, USA), primersPanax notoginseng-F andPanax notoginseng1.8 muL, 0.5 muL probes for each-RPanax notoginseng-P: TACCAATCCCAGCGTA, template DNA 1 μ L, addddH2And O is complemented to 20 mu L.
Further, in the step (3), the amplification reaction conditions of the droplet digital PCR are as follows: pre-denaturation at 95 ℃ for 10 min; denaturation at 94 deg.C for 30 s, annealing at 56-60 deg.C for 1 min, and circulating for 40 times; heat-inactivating at 98 deg.C for 10 min, and cooling to 4 deg.C; the temperature rising and falling speed is 2 ℃/s.
Further, the primerPanax notoginseng-F andPanax notoginseng-R has a final concentration of 900 nmol/L, said probePanax notoginseng-P: TACCAATCCCAGCGTA was found to have a final concentration of 250 nmol/L.
The invention has the following beneficial effects:
the invention establishes a method for accurately and quantitatively detecting the pseudo-ginseng powder based on a micro-drop digital PCR technology by searching the relationship between the quality of the pseudo-ginseng powder and the copy number of a gene. The method comprises a pseudo-ginseng source component specific primer and a fluorescent probe combination which are designed based on a single-copy nuclear gene DGK 1. The method can realize accurate quantification of the pseudo-ginseng powder without depending on a standard substance, and has strong specificity, rapidness, accuracy and important practical significance.
Drawings
Fig. 1 is a diagram of the results of verifying the specificity of pseudo-ginseng-derived primers and probes based on the micro-droplet digital PCR technique in the embodiment of the present invention, wherein 1, pseudo-ginseng 2, ginseng 3, american ginseng 4, panax japonicus 5, panax notoginseng screensaver 6, panax notoginseng 7, panax notoginseng 8, panax ginseng 9, rice flour 10, potato flour 11, soybean flour 12, blank control;
FIG. 2 is a linear relationship between the mass of Panax notoginseng powder and the DNA concentration in the example of the present invention;
FIG. 3 is a linear relationship between the DNA concentration and the nuclear gene copy number in examples of the present invention.
Detailed Description
The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.
Example 1:
the specificity of the designed combination of primers and probes for Panax notoginseng was verified by the following test.
(1) Main instrument and reagent
The instrument comprises the following steps: tissue grinder (TissueLyzer II, Qiagen, Germany), nucleic acid protein analyzer (DU 640, Beckman, Germany), PCR instrument, QX200 droplet generator, reader (Bio-Rad, USA).
Reagent: 2 XDddPCR Supermix for probe (No dUTP), microdroplet oil (Bio-Rad, USA), and Biomiga (Biomiga, USA) plant genome extraction kit.
The primer and the probe are prepared by Shanghai biological engineering technical service company, and have the following sequences:
the upstream primer isPanax notoginseng-F: AGACCTATCATGATGATTACTCTTCC, the downstream primer isPanax notoginseng-R: GAATAGGAGTATGGAAACAGGTAAGAC, respectively; the probe isPanax notoginseng-P: TACCAATCCCAGCGTA, the 5 'end of the probe is connected with a fluorescence reporter group FAM, and the 3' end is connected with a fluorescence quencher group MGB.
(2) DNA extraction
The DNA of 30 mg of pseudo-ginseng, American ginseng, panax japonicus, panax stipuleanatus, panax notoginseng, potato powder and soybean powder is respectively extracted by using a Biomiga plant genome extraction kit as a template and is used for micro-drop digital PCR detection.
(3) Reaction system
The total volume of the PCR reaction system is 20 muL, and comprises the following steps: primer with concentration of 10 [ mu ] L of 2 XddPCR Supermix for probe (No dUTP) and concentration of 10 [ mu ] mol/LPanax notoginseng-F andPanax notoginseng1.8 muL, 0.5 muL (10 mumol/L) probes for each RPanax notoginseng-P, template DNA 1 muL, Add ddH2And O is complemented to 20 mu L. The final concentration of the primers was 900 nmol/L and the final concentration of the probes was 250 nmol/L.
(4) Droplet generation
Transferring the reaction system into a droplet generation card, adding 70 muL of droplet generation oil into each oil hole, covering a rubber pad, and putting into a droplet generation instrument. The reaction droplets were transferred to a 96-well plate and sealed with aluminum film.
(5) Reaction procedure
Pre-denaturation at 95 ℃ for 10 min; denaturation at 94 deg.C for 30 s, annealing at 56 deg.C for 1 min, and circulating for 40 times; heat-inactivating at 98 deg.C for 10 min, and cooling to 4 deg.C; the temperature rising and falling speed is 2 ℃/s.
(6) Reading and result analysis
After the reaction was completed, the 96-well plate was placed in a Bio-Rad QX200 droplet reader for detection. The result is shown in fig. 1, the designed primer probe has good specificity, can amplify the panax notoginseng DNA sample, and has no obvious amplification for other kindred species, easily adulterated products and blank control reaction systems.
Example 2:
in this embodiment, a linear relationship between the quality of the notoginseng powder and the DNA concentration, and a linear relationship between the DNA concentration and the gene copy number are established through the following tests, and then the linear relationship between the quality of the notoginseng powder and the DNA copy number is established, so as to finally realize the determination of the quality of the notoginseng powder, which includes the following steps:
(1) genomic DNA of pseudo-ginseng powder with different mass gradients is extracted by using a Biomiga kit, and each mass gradient is repeated for three times. The DNA concentration was determined using a nucleic acid protein analyzer. The mass M (mg) of the notoginseng powder is taken as the abscissa and the DNA concentration is Y1 And (ng/muL) is a vertical coordinate, and a standard curve is established to obtain the linear relation between the quality of the pseudo-ginseng powder and the DNA concentration. Wherein, the whole main root of the pseudo-ginseng is pulverized and sieved by a 200-mesh sieve to prepare a pseudo-ginseng powder sample. Weighing 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg and 50 mg of pseudo-ginseng powder to extract DNA. The results are shown in FIG. 2, and the linear regression equation of the quality of Notoginseng radix powder and DNA concentration is 
，R2The value was 0.996.
(2) And carrying out micro-drop digital PCR detection on the DNA of the panax notoginseng powder with gradient concentration. The DNA gradient concentration is 45 ng/muL, 40 ng/muL, 35 ng/muL, 30 ng/muL, 25 ng/muL, 20 ng/muL, 15 ng/muL, 10 ng/muL and 5 ng/muL.
The instrument comprises: tissue grinder (tissue lyzer II, Qiagen, Germany), nucleic acid protein analyzer (DU 640, Beckman, Germany), PCR instrument, QX200 droplet generator, reader (Bio-Rad, USA).
Reagent: 2 XDddPCR Supermix for probe (No dUTP), microdroplet oil (Bio-Rad, USA), and Biomiga (Biomiga, USA) plant genome extraction kit.
The primer and the probe are prepared by Shanghai biological engineering technical service company, and have the following sequences:
the upstream primer isPanax notoginseng-F: AGACCTATCATGATGATTACTCTTCC, the downstream primer isPanax notoginseng-R: GAATAGGAGTATGGAAACAGGTAAGAC, respectively; the probe isPanax notoginseng-P: TACCAATCCCAGCGTA, the 5 'end of the probe is connected with a fluorescence reporter group FAM, and the 3' end is connected with a fluorescence quencher group MGB.
The total volume of the PCR reaction system is 20 muL, and comprises the following steps: primer with concentration of 10 [ mu ] L of 2 XddPCR Supermix for probe (No dUTP) and concentration of 10 [ mu ] mol/LPanax notoginseng-F andPanax notoginseng1.8 muL, 0.5 muL (10 mumol/L) probes for each R Panax notoginseng-P, template DNA 1. mu.L, Add ddH2And O is complemented to 20 mu L. The final concentration of the primer was 900 nmol/L and the final concentration of the probe was 250 nmol/L.
Transferring the reaction system into a droplet generation card, adding 70 muL of droplet generation oil into each oil hole, covering a rubber pad, and putting into a droplet generation instrument. The reaction droplets were transferred to a 96-well plate and sealed with aluminum film.
Pre-denaturation at 95 ℃ for 10 min; denaturation at 94 deg.C for 30 s, annealing at 56 deg.C for 1 min, and circulating for 40 times; heat-inactivating at 98 deg.C for 10 min, and cooling to 4 deg.C; the temperature rising and falling speed is 2 ℃/s.
After the reaction was completed, the 96-well plate was placed in a Bio-Rad QX200 droplet reader for detection. The results are shown in FIG. 3, wherein the DNA concentration of Panax notoginseng powder is Y1 (ng/muL) is linearly related to the DNA copy number (C)
，R2The value was 0.9985.
According to the established quality of the notoginseng powder, the DNA concentration and the DNA copy numberThe linear relation between the mass (M) of the pseudo-ginseng powder and the DNA copy number (C) obtained by the regression equation is as follows:
。
(3) verification test of method accuracy
Mixing rice flour, potato flour, soybean flour and pseudo-ginseng powder with known contents, extracting DNA of 30 mg of the mixed sample, carrying out micro-drop digital PCR detection according to the step (2), and calculating the content of the pseudo-ginseng powder in the mixed sample according to a linear equation of the mass of the pseudo-ginseng powder obtained in the step (2) and the copy number of the DNA. The results are shown in Table 1, the measured value of the pseudo-ginseng powder is similar to the actual value, the deviation is-10.4-11.65%, and the RSD value is less than 25%. In conclusion, the quantitative detection method for the pseudo-ginseng powder based on the digital PCR technology has good accuracy and can be better applied to actual detection.
The above description is only a preferred embodiment of the present invention, but the scope of the present invention is not limited thereto, and any modifications, equivalents, or improvements, which can be easily conceived by those skilled in the art within the technical scope of the present invention, are included in the scope of the present invention.
TABLE 1 quality test of Notoginseng radix powder in known mixed components
Sequence listing
<110> scientific research institute of Chinese inspection and quarantine
<120> accurate quantitative method of pseudo-ginseng powder based on micro-drop digital PCR technology
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 26
<212> DNA
<213> Panax notoginseng (Panax notogeng)
<400> 1
agacctatca tgatgattac tcttcc 26
<210> 2
<211> 27
<212> DNA
<213> Panax notoginseng (Panax notogeng)
<400> 2
gaataggagt atggaaacag gtaagac 27
<210> 3
<211> 16
<212> DNA
<213> Panax notoginseng (Panax notogeng)
<400> 3
taccaatccc agcgta 16
Claims (3)
1. A method for accurately quantifying panax notoginseng powder based on a micro-drop digital PCR technology is characterized in that a primer and probe composition designed by a panax notoginseng single-copy nuclear gene is used for establishing the relationship between the mass of the panax notoginseng powder and the DNA concentration and the relationship between the DNA concentration and the gene copy number, the relationship between the gene copy number and the panax notoginseng powder mass is established by taking the DNA concentration as an intermediate quantity, and then the content of the panax notoginseng powder is determined; the single-copy nuclear gene is diacylglycerol kinase 1 gene (DGK 1), and primers and probes are designed as follows: wherein the upstream primer is Panax notogeng-F: AGACCTATCATGATGATTACTCTTCC, respectively; the downstream primer is Panax notogeng-R: GAATAGGAGTATGGAAACAGGTAAGAC, respectively; the probe is Panax notogeng-P: TACCAATCCCAGCGTA, wherein the 5 'end of the probe is connected with a fluorescence reporter group FAM and the 3' end is connected with a fluorescence quencher group MGB.
2. A method for accurately quantifying panax notoginseng powder according to claim 1, comprising the steps of:
(1) pulverizing Notoginseng radix, and sieving to obtain Notoginseng radix powder; extracting genome DNA of the pseudo-ginseng powder with different gradient masses, determining the DNA concentration, and establishing a linear relation between the pseudo-ginseng powder mass and the DNA concentration;
(2) adding the primer and probe composition in claim 1 into a reaction system of panax notoginseng powder DNA with different gradient concentrations to perform micro-drop digital PCR detection, and establishing a linear relation between the DNA concentration and the DNA copy number;
(3) and (3) establishing a linear relation between the quality of the pseudo-ginseng powder and the copy number of the DNA by taking the concentration of the DNA as an intermediate quantity according to the linear relation established in the step (1) and the step (2).
3. A method for accurately quantifying Panax notoginseng powder as claimed in claim 2, wherein the annealing temperature in step (2) is 56-60 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011142832.9A CN112322766B (en) | 2020-10-23 | 2020-10-23 | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011142832.9A CN112322766B (en) | 2020-10-23 | 2020-10-23 | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112322766A CN112322766A (en) | 2021-02-05 |
| CN112322766B true CN112322766B (en) | 2022-05-24 |
Family
ID=74310620
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011142832.9A Active CN112322766B (en) | 2020-10-23 | 2020-10-23 | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112322766B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112725512A (en) * | 2021-02-22 | 2021-04-30 | 拱北海关技术中心 | Micro-drop digital PCR (polymerase chain reaction) primer, probe, kit and method for quantitatively detecting ginseng |
| CN113278685B (en) * | 2021-05-10 | 2022-10-14 | 南方医科大学 | Molecular identification method for storage life of pericarpium citri reticulatae |
| CN114182002A (en) * | 2021-11-22 | 2022-03-15 | 中国医学科学院药用植物研究所 | Method for detecting pseudo-ginseng in Chinese patent medicine and application |
| CN116287424B (en) * | 2023-05-24 | 2023-08-18 | 云南珩柯生物科技有限公司 | Primer, probe and detection method for detecting rhizoma zingiberis pseudo-ginseng |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680098A (en) * | 2019-03-07 | 2019-04-26 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet digital pcr quantitative detection potato ingredient |
| CN109929946A (en) * | 2019-03-07 | 2019-06-25 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet type digital pcr quantitative detection cassava ingredient |
| CN110004243A (en) * | 2019-03-07 | 2019-07-12 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet digital pcr quantitative detection sweet potato ingredient |
-
2020
- 2020-10-23 CN CN202011142832.9A patent/CN112322766B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109680098A (en) * | 2019-03-07 | 2019-04-26 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet digital pcr quantitative detection potato ingredient |
| CN109929946A (en) * | 2019-03-07 | 2019-06-25 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet type digital pcr quantitative detection cassava ingredient |
| CN110004243A (en) * | 2019-03-07 | 2019-07-12 | 广东出入境检验检疫局检验检疫技术中心 | A kind of kit and its application based on droplet digital pcr quantitative detection sweet potato ingredient |
Non-Patent Citations (2)
| Title |
|---|
| Panax notoginseng isolate Z14P241-1 diacylglycerol kinase 1 gene, partial cds；GenBank: KT593558.1;Genbank;《NCBI》;20160112;全文 * |
| The impacts of polyploidy, geographic and ecological isolations on the diversification of Panax (Araliaceae);Feng-Xue Shi,et al;《BMC Plant Biol》;20151221;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112322766A (en) | 2021-02-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112322766B (en) | Accurate pseudo-ginseng powder quantitative method based on micro-drop digital PCR technology | |
| WO2016015686A1 (en) | Method for quantitatively measuring short rna using amplified dna fragment length polymorphism | |
| CN104651488B (en) | Detect the Amplification thing and quick detection kit of chromosome aneuploid numerical abnormality | |
| CN108728554B (en) | Method for rapidly identifying mutton content by using fluorescence test strip | |
| CN107058498B (en) | Triple real-time fluorescence PCR method for detecting bovine, ovine and porcine derived components | |
| CN113718063A (en) | Multi-chip digital PCR primer, kit and detection method for simultaneously detecting ASFV, PCV2 and PRV viruses | |
| CN112813195A (en) | Novel quantitative detection kit for coronavirus nucleic acid based on micro-droplet digital analysis | |
| CN106555000A (en) | A kind of method of plant derived component in plant identification protein beverage | |
| Temisak et al. | Accurate determination of meat mass fractions using DNA measurements for quantifying meat adulteration by digital PCR | |
| CN112852988A (en) | Microdroplet digital PCR detection method for simultaneously detecting penicillium and fusarium | |
| CN112725514A (en) | Micro-drop digital PCR (polymerase chain reaction) primer, probe, kit and method for quantitatively detecting cordyceps sinensis | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| CN117431330A (en) | Primer probe set for detecting neisseria yellowish and kit and application thereof | |
| Shanmughanandhan et al. | Quantification of Actaea racemosa L.(black cohosh) from some of its potential adulterants using qPCR and dPCR methods | |
| He et al. | An effective droplet digital PCR method for identifying and quantifying meat adulteration in raw and processed food of beef (Bos taurus) and lamb (Ovis aries) | |
| CN112592965B (en) | E.coli host DNA residue detection kit adopting TaqMan probe method | |
| CN112592972B (en) | Early screening method and kit for diffuse toxic goiter susceptibility genes | |
| Lanubile et al. | DNA-based techniques to check quality and authenticity of food, feed and medicinal products of plant origin: A review | |
| CN112795678B (en) | Fungus microdroplet digital PCR (polymerase chain reaction) detection method for simultaneously detecting aflatoxin and ochratoxin | |
| CN112725513A (en) | Micro-drop digital PCR (polymerase chain reaction) primer, probe, kit and method for quantitatively detecting saffron | |
| CN110004243B (en) | Kit for quantitatively detecting sweet potato components based on microdroplet digital PCR and application thereof | |
| CN107881244B (en) | Probe primer for fluorescence quantitative PCR detection for authenticity identification of bezoar and detection method and application | |
| CN107881243B (en) | Fluorescent quantitative PCR detection method for authenticity identification of bezoar and application thereof | |
| CN111575403A (en) | High-throughput digital PCR kit for detecting RNA virus nucleic acid and detection method | |
| Lu et al. | Validation of a targeted PCR method for raw and processed botanical material identification: an example using Matricaria chamomilla (Chamomile) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |