CN112322700A

CN112322700A - Construction method, kit and application of short RNA fragment library

Info

Publication number: CN112322700A
Application number: CN201910716816.7A
Authority: CN
Inventors: 宗亮; 陈翠; 徐怀前; 田志坚
Original assignee: Wuhan Bgi Medical Laboratory Co ltd
Current assignee: Wuhan Bgi Medical Laboratory Co ltd
Priority date: 2019-08-05
Filing date: 2019-08-05
Publication date: 2021-02-05
Anticipated expiration: 2039-08-05
Also published as: CN112322700B

Abstract

The invention relates to the field of gene sequencing, in particular to a construction method, a kit and application of a short RNA fragment library. The construction method comprises the steps of carrying out pre-phosphorylation and dephosphorylation treatment on a short RNA fragment sample to modify a 3 '-end phosphate group into a hydroxyl group and modify a 5' -end hydroxyl group into a phosphate group in the short RNA fragment to obtain a first product; then connecting the 3' joint to obtain a first connection product; then, dephosphorizing to obtain a second product of which the 5' end is a phosphate group; connecting the 5' joint to obtain a second connection product; then reverse transcription is carried out, and the short RNA fragment library is obtained through amplification. The kit comprises T4polynucleotide kinase and RNA 5' pyrophosphate hydrolase. The kit comprises T4polynucleotide kinase and RNA 5' pyrophosphate hydrolase. The construction method and the kit can obtain the nucleic acid information of various short RNA fragments and are applied to the field of life science.

Description

Construction method, kit and application of short RNA fragment library

Technical Field

The invention relates to the field of gene sequencing, in particular to a construction method, a kit and application of a short RNA fragment library.

Background

Extracellular RNA (Extracellar RNA or ExRNAs) has extremely high research value in the field of life science, and is a research hotspot when applied to the field of liquid biopsy and the like. It is known that the exRNAs include degraded fragments containing a variety of short RNA fragments, such as miRNA, siRNA, snoRNA, etc., and more include a large amount of long RNA (such as mRNA, long non-coding RNA, etc.). The fragments may perform important functions outside cells, but at present, the library-establishing sequencing process of short RNA fragments (small RNA) can only research miRNA components in the short RNA fragments, and other nucleic acid sequences cannot be obtained.

Thus, the library-building sequencing process for the short RNA fragment library needs to be further improved to try to detect other short RNA fragment components.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. Therefore, the invention aims to provide a construction method and a kit of a short RNA fragment library.

The inventor of the invention finds out in the research process that:

as shown in FIG. 1, the current flow of Small RNA library construction is generally as follows: 1) electrophoretically separating total RNA, and recovering 18-30nt components; 2) sequentially connecting a 3 'joint and a 5' joint at two ends of small RNA; 3) and carrying out reverse transcription and PCR amplification on the obtained ligation product to obtain a small RNA library. However, in the process of using enzyme to connect the 3 'linker and the 5' linker at the two ends of the small RNA in the step 2), only the RNA sequence with the 5 'end as the phosphate group and the 3' end as the hydroxyl end can be used as the reaction substrate, and when the RNA end is the 5 'triphosphate group (5' triphosphate group), the 5 'hydroxyl group or the 3' phosphate group, the connection efficiency of the two enzymes is extremely low.

However, extracellular RNA includes degraded fragments containing a variety of short RNA fragments, such as miRNA, siRNA, snorNA, etc., and more including large amounts of long RNA (such as mRNA, long non-coding RNA, etc.). Wherein, miRNA is cut and processed by Dicer enzyme in the maturation process, and the mature miRNA has the structural characteristics of 5 'phosphate group and 3' hydroxyl group. The siRNA is processed by RdRP enzyme in the maturation process, and the structure of the mature siRNA is characterized by 5 'triphosphate group and 3' hydroxyl group. The degradation fragment of long RNA is cut by RNase A, and has the structural characteristics of 5 'hydroxyl and 3' phosphate. According to the existing Small RNA library construction method, except miRNA, other short RNA fragments can not be detected. However, studies have shown that siRNA plays an important role in organ development, while long RNA degradation fragments play a role in cell-cell transmission of genetic information or specific RNA binding proteins. Both short RNA fragments have extremely high research value, but the existing Small RNA library building method cannot be developed.

The inventor finds out in the research process that: t4Polynucleotide Kinase (T4Polynucleotide Kinase, abbreviated as T4PNK) has both 5 'phosphorylase activity and 3' phosphatase activity, and is commonly used in gene cloning experiments. The reaction substrate is mostly double-stranded DNA. It can be applied to modify the degradation fragment of long RNA to change the 3 'phosphate group of 5' hydroxyl group of the degradation fragment of long RNA into 3 'hydroxyl group of 5' phosphate group. RNA 5'Pyrophosphohydrolase (RNA 5' Pyrophosphohydrolase, abbreviated as RpHH) has Pyrophosphohydrolase activity, can hydrolyze 5 'triphosphate of long RNA to remove pyrophosphate to obtain 5' phosphate, and is commonly used for mRNA decapping reaction and transcription initiation site study. Therefore, it can also be applied to modify siRNA to change the 5 'triphosphate group of SiRNA to a 5' phosphate group. At the same time, the decapping activity of the RppH can help capture the 5' degradation fragment of mRNA. The short RNA fragment samples are processed by the enzymes, so that the processed short RNA fragment samples can be subjected to library construction and sequencing by using a conventional Small RNA molecule library construction method, and the information of the short RNA fragments can be obtained and used for scientific research or clinical analysis and the like. Of course, if other nucleases can also perform the above function, for example, the RNA molecule can be converted from the 3' end to the 3' hydroxyl group, thereby being suitable for connection to the 3' linker; alternatively, the RNA molecule can be converted to have only one phosphate group at the 5 'end, thereby being suitable for ligation to a 5' linker, and the same principle as that of the present invention can be applied to the present invention. Such nucleases are also included within the scope of the present invention.

Specifically, the invention provides the following technical scheme:

according to a first aspect of the present invention, a method for constructing a short RNA fragment library comprises: carrying out pre-phosphorylation and dephosphorylation treatment on a short RNA fragment sample to modify a 3 '-end phosphate group into a hydroxyl group and modify a 5' -end hydroxyl group into a phosphate group in the short RNA fragment so as to obtain a first product; first ligating said first product to a 3 'linker to obtain a 3' linker ligated first ligation product; dephosphorylating the first connection product connected with the 3 'joint so as to obtain a second product of which the 5' end is phosphate; second ligating said second product, 5 'terminated with a phosphate group, to a 5' linker to obtain a second ligated product having a5 'linker and a 3' linker ligated thereto; and carrying out reverse transcription on the second ligation products connected with the 5 'linker and the 3' linker, and amplifying to obtain the short RNA fragment library.

The short RNA fragment sample is subjected to pre-phosphorylation and dephosphorylation treatment, so that the 3 'end phosphate group of a long fragment degradation fragment in the short RNA fragment sample is modified into 3' hydroxyl, and the 5 'end hydroxyl group is modified into 5' phosphate group, so that the modified short RNA fragment is suitable for connecting a 3 'joint and a 5' joint; the first ligation product with the 3' linker ligated thereto is then dephosphorylated, so that phosphate groups at the 5' end in some short RNA fragments are modified to one phosphate group for ligation with the 5' linker, resulting in a second ligation product with the 5' linker and the 3' linker ligated thereto. Amplification by reverse transcription of the second ligation product enables a library of short RNA fragments to be obtained. The obtained short RNA fragment library contains a plurality of short RNA fragments such as long fragment degradation fragments, miRNA, siRNA and the like, the information of the short RNA fragments can be obtained through sequencing, the molecules play an important function in the field of life science, and the information can be applied to scientific research or clinical treatment and research.

According to an embodiment of the present invention, the method for constructing the short RNA fragment library described above may further include the following technical features:

in some embodiments of the invention, the sample of short RNA fragments and T4polynucleotide kinase are subjected to a first mixed incubation for the pre-phosphorylation and dephosphorylation treatments. The short RNA fragment sample is processed by utilizing T4polynucleotide kinase, so that the degradation fragment of the long RNA, namely the degradation fragment of which the 5 'end is hydroxyl and the 3' end is phosphate group, is modified, the 5 'end is modified into phosphate group, and the 3' end is modified into hydroxyl, thereby facilitating the connection of a 3 'joint and a 5' joint in the subsequent library construction process. Moreover, the T4polynucleotide kinase has little influence on the processing of the short RNA fragment sample, on other fragments in the short RNA fragment sample, such as miRNA, siRNA and the like, and does not influence the construction of a subsequent library of the short fragments.

In some embodiments of the invention, the first ligation product to which the 3 'linker is ligated and RNA 5' pyrophosphate hydrolase are subjected to a second mixed incubation to perform the dephosphorylation treatment.

In some embodiments of the invention, the temperature of the first mixed incubation and the second mixed incubation is 35 to 38 degrees celsius and the incubation time is 25 to 35 minutes. Therefore, the pre-phosphorylation and dephosphorylation treatments can be quickly realized through the first mixed incubation, and the dephosphorylation treatment can be quickly realized through the second mixed incubation without influencing other RNAs in the short RNA segment, such as miRNA.

In some embodiments of the invention, after performing the first mixed incubation and the second mixed incubation, further comprising: and respectively incubating the incubation products at 60-70 ℃ for 5-10 minutes to inactivate the enzyme.

In some embodiments of the invention, the sample of short RNA fragments comprises: miRNA, siRNA and long RNA degradation fragments.

In some embodiments of the invention, the sample of short RNA fragments is 18-50nt in length.

According to a second aspect of the invention, there is provided the use of T4polynucleotide kinase and/or RNA 5' pyrophosphate hydrolase in the field of short RNA fragment library sequencing.

According to a third aspect of the present invention, the present invention provides a kit for short RNA fragment library construction, comprising: t4polynucleotide kinase and RNA 5' pyrophosphate hydrolase.

In some embodiments of the invention, the kit described above further comprises at least one of: t4 RNA ligase, 5 'linker, 3' linker, RNase inhibitor, T4 RNA ligase 2, truncated, ligation buffer.

Drawings

FIG. 1 is a flow chart of a conventional small RNA library preparation provided according to an embodiment of the present invention.

FIG. 2 is a flow chart of the preparation of small RNA libraries using the invention provided according to an embodiment of the invention.

Fig. 3 is a graph showing the results of data analysis of the experimental group and the control group provided according to the embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings, wherein like or similar reference numerals refer to the same or similar elements or elements having the same or similar function throughout. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

The invention establishes a practical and high-efficiency short RNA fragment library building method. By introducing two nucleases, namely T4polynucleotide kinase (T4PNK) and RNA 5' pyrophosphorohydrolase (RpHs) and giving optimal reaction conditions and experimental procedures, the degradation fragments of siRNA and long RNA (such as mRNA, long non-coding RNA and the like) in a sample except miRNA can be simultaneously and intensively studied. Of course, the present invention is not limited to T4PNK and RppH nucleases, and other enzymes capable of performing the same functions as these two enzymes are also included in the scope of the present invention. For example, in dephosphorylation treatment of the 3' -terminus, Alkaline Phosphatase, Alkaline Phosphotase, Calf Internal (CIP); RNA5 'Polyphosphatase may also be used when the 5' end of the RNA fragment is pre-phosphorylated. However, the adoption of T4PNK can realize pre-phosphorylation and dephosphorylation treatment at the same time, can realize modification at both ends at the same time by the simplest process, and does not need to introduce CIP treatment. Importantly, treatment with T4PNK did not affect other fragments in the short RNA fragments, and thus did not affect the construction of subsequent libraries of these other fragments.

Similarly, the dephosphorylation treatment can be performed by using Tobacco Acid Pyrophosphatase (TAP), but the TAP has high use cost and takes a long time to react, for example, the treatment needs to be performed for 1-2 hours at 37 ℃. The short RNA fragments are dephosphorylated by adopting RpHs, so that the short RNA fragments with phosphate groups at the 5' ends can be simply and quickly obtained, and the cost is low. At the same time, RpHs show superior decapping (decapping) activity than TAP, and can help capture the 5' degradation fragment of mRNA while reacting at this step. Importantly, the dephosphorylation treatment is carried out without affecting other short RNA fragments, and therefore, the library construction and sequencing of the other short RNA fragments are not affected.

Whether the pre-phosphorylation and dephosphorylation treatment is carried out by using an enzyme or the dephosphorylation treatment is carried out by using an enzyme, the selection of the enzyme which effectively exerts the similar functions to the above-mentioned enzymes is important for the construction and sequencing of the short RNA fragment library, and can directly influence the library construction and detection of each target fragment in the short RNA fragment. Taking RNA 5' polyphosphatase as an example, the RNA can also convert 5' triphosphorylated RNA into 5' monophosphorylated RNA, but the enzyme is ATP dependent, and the enzyme activity is obviously reduced under the condition that ATP and phosphate exist at the same time. ATP is an essential component for the 5' linker ligation step, and phosphate is a common buffering environment for each enzymatic reaction. Therefore, if RNA 5' polyphosphatase is used for dephosphorylation in the experimental process, the change of the subsequent ligation reaction efficiency is triggered and proved to have an influence on the detection efficiency of other fragments. Therefore, in at least some preferred embodiments, the method for constructing the short RNA fragment library, which utilizes T4polynucleotide kinase to perform phosphorylation and dephosphorylation on the short RNA fragment sample, can modify the phosphate group at the 3 'end of the short RNA fragment into a hydroxyl group and modify the hydroxyl group at the 5' end into a phosphate group, and importantly, does not affect other short RNA fragments; the dephosphorylation treatment is carried out by using RNA5 'pyrophosphoric acid hydrolase, so that the 5' end of the short RNA fragment can be changed into a phosphate group, other short RNA fragments cannot be influenced, and the detection efficiency of the target short RNA fragment cannot be influenced.

In at least some embodiments of the present invention, there is provided a method of constructing a library of short RNA fragments, comprising: incubating a short RNA fragment sample with T4polynucleotide kinase, and carrying out pre-phosphorylation and dephosphorylation treatment to modify a 3 '-terminal phosphate group into a hydroxyl group and modify a 5' -terminal hydroxyl group into a phosphate group in the short RNA fragment to obtain a first product; first ligating said first product to a 3 'linker to obtain a 3' linker ligated first ligation product; incubating the first ligation product connected with the 3' linker with RNA 5' pyrophosphohydrolase, and carrying out dephosphorylation treatment to obtain a second product of which the 5' end is phosphate; second ligating said second product, 5 'terminated with a phosphate group, to a 5' linker to obtain a second ligated product having a5 'linker and a 3' linker ligated thereto; and carrying out reverse transcription on the second ligation products connected with the 5 'linker and the 3' linker, and amplifying to obtain the short RNA fragment library.

Herein, short RNA fragments mean short RNA fragments of any length, including, for example, miRNA, siRNA, snoRNA, etc., and may also include degraded fragments of a large number of long RNAs (e.g., mRNA, long non-coding RNA, etc.). In at least some embodiments, these short RNA fragments can be 18-50nt in length.

The "pre-phosphorylation and dephosphorylation treatment" herein refers to a modification that the 5 'hydroxyl group in the short RNA fragment is pre-phosphorylated to be modified to be a 5' phosphate group, and the 3 'phosphate group in the short RNA fragment is dephosphorylated to be a 3' hydroxyl group. The "dephosphorylation treatment" herein is different from the "dephosphorylation treatment" in that the dephosphorylation treatment refers to a treatment of removing excess phosphate at the 5' end, for example, a treatment of converting the triphosphate at the 5' end into a phosphate at the 5' end, i.e., a monophosphate.

In addition, when a5 'terminal phosphate group or a 3' terminal phosphate group is expressed herein, only one phosphate group is referred to according to the general explanation of those skilled in the art, unless otherwise specified.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1

A small RNA library was constructed using the human standard RNA sample UHRR (Agilent, Lot. # 740000). Experiment was divided into 2 groups: experimental group (using the method for constructing the short RNA fragment library provided by the invention, as shown in figure 2) and control group (conventional method for constructing the short RNA fragment library); each set was set to 3 replicates respectively.

Wherein, FIG. 1 is a flow chart of the preparation of a conventional small RNA library. Namely, in the process of constructing a Small RNA library, a 3 'joint is connected to the 3' end of the short RNA fragment in the control group; then connecting a5 'joint to the 5' end of the short RNA segment; in the reaction, the ligase can only use the RNA sequence of 5 'phosphate group and 3' hydroxyl terminal as a reaction substrate, so that the miRNA component in the sample can only be captured, and the capture efficiency of other short RNA fragments is very low; finally, the final library is obtained through reverse transcription and subsequent amplification reaction.

FIG. 2 is a flow chart of the preparation of small RNA library provided by the invention. In the process of constructing a Small RNA library, short RNA fragments are treated by T4PNK in advance and then connected with a 3' joint, and after the treatment of T4PNK, long RNA degradation products of 5' hydroxyl and 3' phosphate are modified into 5' phosphate and 3' hydroxyl, so that the long RNA degradation products can participate in connection reaction; then, connecting the obtained connecting product with a 5' joint after the treatment of RpHs, and modifying 5' triphosphate siRNA and the like into 5' phosphate siRNA after the treatment of the RpHs so as to participate in a connecting reaction; finally, a final library is obtained by reverse transcription and subsequent amplification reactions, and all RNA components are converted into a library which can be sequenced.

The specific experimental process is as follows, wherein when the same treatment steps are carried out on the experimental group and the control group, the experimental group or the control group is not specified to be explained, and when the treatment steps are different, the following steps are specified:

(1) small RNA enrichment: taking 1 mu g of total RNA, spotting the total RNA to 15% concentration polyacrylamide denatured gel, cutting the gel to recover 18-50nt of fragments, and dissolving in 5 mu l of nucleic-free water.

Wherein 18-30nt is the length range of miRNA and siRNA, and the length range of the degradation segment of the long RNA is selected to be about 25-50nt in order to ensure the correctness of the comparison between the degradation segment of the long RNA and the reference sequence.

(2) Wherein the control group was placed on ice without further treatment;

the experimental group was added with 1. mu. l T4polynucleotide kinase (from NEB, cat # M0201S, 10000units/ml), mixed well and incubated at 37 ℃ for 30 minutes; after the phosphorylation, the cells were inactivated by incubation at 65 ℃ for 20 minutes;

(3) 3' linker attachment: adding 1. mu.l of 3' adapter (the sequence of the adapter is shown in SEQ ID NO:1, purchased from Illumina, TruSeq Small RNA Library Preparation Kits, cat # RS-200-0012), mixing, incubating at 70 ℃ for 2 minutes, and placing on ice; adding 2. mu.l of Ligation Buffer, 1. mu.l of RNase Inhibitor (Ligation Buffer and RNase Inhibitor are purchased from Illumina, TruSeq Small RNA Ligation prediction Kits, Cat # RS-200-0012), T4 RNA Ligase 2, and truncated 1. mu.l (purchased from NEB, Cat # M0242S, Cat # 200,000units/ml) in sequence, mixing, and incubating at 28 ℃ for 1 hour;

3'Adapter (3' linker) TGGAATTCTCGGGTGCCAAGG (SEQ ID NO: 1).

(4) Wherein the control group was placed on ice without further treatment;

the experimental group was added with 1. mu.l of RNA 5' Pyrophosphohydrosole (purchased from NEB under the accession No. M0356S, 5000units/ml), mixed well and incubated at 37 ℃ for 30 minutes; after uncapping reaction, the reaction was inactivated by incubation at 65 ℃ for 5 minutes.

(5) Mu.l of Stop Oligo (purchased from Illumina, TruSeq Small RNA Library Preparation Kits, cat # RS-200-0012) was added to the reaction system, mixed well and incubated at 28 ℃ for 15 minutes to prevent self-ligation of the adaptor.

(6) 5' linker connection: adding 1. mu.l of 5' adapter (shown as SEQ ID NO:2), 1. mu.l of 10mM ATP and 1. mu.l of T4 RNA Ligase (both purchased from Illumina, TruSeq Small RNA Library Preparation kit, cat # RS-200-0012) to the reaction system in the last step in sequence, mixing uniformly, and incubating for 1 hour at 28 ℃;

wherein the 5'Adapter (5' linker) is GUUCAGAGUUCUACAGUCCGACGAUC (SEQ ID NO:2)

(7) RNA reverse transcription: taking 6ul of the ligation reaction product, adding 1ul of RNA RT Primer, mixing uniformly, incubating for 2 minutes at 70 ℃, and then placing on ice; sequentially adding 2 mul of 5 XFirst Strand Buffer, 0.5 mul of 12.5mM dNTP mix, 1 mul of 100mM DTT, 1 mul of RNase Inhibitor and 1 mul of SuperScript II Reverse Transcriptase, uniformly mixing, and incubating for 1 hour at 50 ℃; except for SuperScript II Reverse Transcriptase, which was purchased from Invitrogen, cat # 18064014, 200U/. mu.l, other reagents were purchased from Illumina, TruSeq Small RNA Library Preparation Kits, cat # RS-200-0012.

Wherein the RNA RT Primer used is derived from TruSeq Small RNA Library Preparation Kits, cat # RS-200-0012, the sequence of which is shown in SEQ ID NO: 3:

GCCTTGGCACCCGAGAATTCCA(SEQ ID NO:3)。

(8) template amplification: to the reaction system in the previous step, sequentially adding 8.5. mu.l of Ultra Pure Water, 25. mu.l of PCR Mix (purchased from Illumina, TruSeq Small RNA Library Preparation Kits, cat # RS-200-0012), 2. mu.l of RNA PCR Primer (shown in SEQ ID NO: 4) and 2. mu.l of RNA PCR Index Primer (shown in SEQ ID NO: 5), mixing and entering a PCR reaction program:

denaturation at 98 ℃ for 30 seconds, three steps for 11 cycles: denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 30 seconds, elongation at 72 ℃ for 15 seconds, elongation at 72 ℃ for 10 minutes, and cooling to 4 ℃.

Wherein, the RNA PCR Primer is as follows:

AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA(SEQ ID NO:4)

RNA PCR Index Primer is:

CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQ ID NO:5)

(9) and (3) machine sequencing: taking the PCR product, spotting to 6% concentration polyacrylamide gel, cutting the gel and recovering 140-and 200-bp fragments. And sequenced using Illumina NextSeq 500 SE 75.

(10) And (3) data analysis:

firstly, the sequencing data is filtered to remove tags meeting the following conditions:

1) removing tag with lower sequencing quality;

2) removing tag polluted by 5' joint;

3) removing tags without 3' linker sequences;

4) removing tag without insert;

5) removing tags smaller than 18 nt;

6) removing tag larger than 50 nt;

and then comparing the filtered data with a reference database:

1) comparing tags with the length of 18-29nt to a data set containing miRBase, Rfam, siRNA, piRNA and snorRNA;

2) tag with the length of 30-50nt is aligned to a data set containing RefSeq and NONCODE;

the results of the alignment are collated as shown in Table 1 below and FIG. 3.

Table 1 data comparison results

In Table 1 and FIG. 3, ribosomal RNA gene refers to ribosomal RNA, which is generally highly conserved in sequence and of little research value; IncRNA fragments refer to long non-coding RNA; small nucleolar RNA refers to Small nuclear RNA, and the sequence is usually highly conserved and has little research value.

As can be seen from the results shown in table 1, in the control group, the measured data are almost entirely derived from miRNA (around 76%); in the experimental data, a large number of components (mRNA fragment 9.4%, IncRNA fragment 17%, siRNA 8.8%) were included in addition to miRNA (about 24%). The method provided by the invention can reduce the relative abundance of miRNA, is used for detecting more components such as mRNA, IncRNA and siRNA, and has important value for developing the research of the downstream biological significance.

Comparative example 1

Comparative example 1 provides a method for preparing a small RNA library, which is different from the experimental group of example 1 in that in the process of preparing the small library, the enriched small RNA is firstly incubated with T4polynucleotide kinase and RNA 5' pyrophosphohydrolase simultaneously, the incubated product is then connected with a 3' joint and a 5' joint in sequence, and the subsequent steps of RNA reverse transcription, template amplification, on-machine sequencing and the like are carried out.

The experimental result shows that: in the sequencing data, the proportion of tags of the siRNA was not significantly increased, that is, the proportion of siRNA in the measured data was not significantly increased compared to the control group in example 1. Without being limited by theory, one of the reasons is: when the reaction substrate sequence is short, the work efficiency of RpHs can be reduced, so in the library construction process, the enriched small RNA is incubated with T4polynucleotide kinase and the RpHs at the same time, and then the 3' joint and the 5' joint are connected in sequence, at the moment, the action substrate of the RpHs is not connected with the 3' joint, the sequence is short, the enzyme action efficiency is low, and the detection efficiency of target short RNA fragments is influenced. Therefore, the ligation reaction of the 3' linker should be performed first (for example, the sequence length can be increased by 21nt at this time), and then the dephosphorylation treatment is performed using the RpHs, which helps to improve the working efficiency of the RpHs.

Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless specifically limited otherwise.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Wuhanhua university medical laboratory Co., Ltd

Construction method, kit and application of <120> short RNA fragment library

<130> PIDC3193180

<160> 5

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> 3' linker

<400> 1

tggaattctc gggtgccaag g 21

<210> 2

<211> 26

<212> RNA

<213> Artificial Sequence

<220>

<223> 5' linker

<400> 2

guucagaguu cuacaguccg acgauc 26

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<220>

<223> RNA reverse transcription primer

<400> 3

gccttggcac ccgagaattc ca 22

<210> 4

<211> 50

<212> DNA

<213> Artificial Sequence

<220>

<223> RNA PCR Primer

<400> 4

aatgatacgg cgaccaccga gatctacacg ttcagagttc tacagtccga 50

<210> 5

<211> 63

<212> DNA

<213> Artificial Sequence

<220>

<223> RNA PCR Index Primer

<400> 5

caagcagaag acggcatacg agatcgtgat gtgactggag ttccttggca cccgagaatt 60

cca 63

Claims

1. A method for constructing a short RNA fragment library, comprising:

carrying out pre-phosphorylation and dephosphorylation treatment on a short RNA fragment sample to modify a 3 '-end phosphate group into a hydroxyl group and modify a 5' -end hydroxyl group into a phosphate group in the short RNA fragment so as to obtain a first product;

first ligating said first product to a 3 'linker to obtain a 3' linker ligated first ligation product;

dephosphorylating the first connection product connected with the 3 'joint so as to obtain a second product of which the 5' end is phosphate;

second ligating said second product, 5 'terminated with a phosphate group, to a 5' linker to obtain a second ligated product having a5 'linker and a 3' linker ligated thereto;

and carrying out reverse transcription on the second ligation products connected with the 5 'linker and the 3' linker, and amplifying to obtain the short RNA fragment library.

2. The method of claim 1, wherein the sample of short RNA fragments is incubated with T4polynucleotide kinase in a first mixture for the pre-phosphorylation and dephosphorylation treatments.

3. The method of claim 1, wherein the dephosphorylation treatment is performed by performing a second mixed incubation of the 3 '-adaptor-ligated first ligation product and RNA 5' pyrophosphate hydrolase.

4. The construction method according to claim 2 or 3, wherein the temperature of the first mixed incubation and the second mixed incubation is 35-38 ℃ and the incubation time is 25-35 minutes.

5. The method of construction according to claim 2 or 3, further comprising, after performing the first mixed incubation and the second mixed incubation: and respectively incubating the incubation products at 60-70 ℃ for 5-10 minutes to inactivate the enzyme.

6. The method for constructing a short RNA fragment of claim 1, wherein the sample of short RNA fragments comprises: miRNA, siRNA and long RNA degradation fragments.

7. The method for constructing a recombinant vector according to claim 1, wherein the sample of short RNA fragments has a length of 18 to 50 nt.

Use of T4polynucleotide kinase and/or RNA 5' pyrophosphate hydrolase in the field of short RNA fragment library sequencing.

9. A kit for constructing a short RNA fragment library, which is characterized by comprising:

t4polynucleotide kinase and RNA 5' pyrophosphate hydrolase.

10. The kit of claim 9, further comprising at least one of:

t4 RNA ligase (Takara Shuzo),

the 5' of the joint is connected with the joint,

the 3' -end of the main chain is connected,

an RNase inhibitor which is capable of inhibiting the activity of RNase,

t4 RNA ligase 2, truncated,

and (4) connecting a buffer solution.