CN110499362B

CN110499362B - Joint composition and application thereof

Info

Publication number: CN110499362B
Application number: CN201810473515.1A
Authority: CN
Inventors: 宗亮; 黄斌斌; 陈成; 田志坚; 唐美芳
Original assignee: Wuhan Bgi Medical Laboratory Co ltd
Current assignee: Wuhan Bgi Medical Laboratory Co ltd
Priority date: 2018-05-17
Filing date: 2018-05-17
Publication date: 2022-12-23
Anticipated expiration: 2038-05-17
Also published as: CN110499362A

Abstract

The invention provides a joint composition. The joint composition includes: a first joint; and a second linker, wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first linker and the second linker are self-ligated. The linker composition provided by the embodiment of the invention can be specifically cut and degraded by the restriction enzyme during self-ligation, so that when the linker composition is applied to library construction, a self-ligated linker cannot enter a downstream experiment under the action of the restriction enzyme, and the utilization rate of sequencing data is effectively improved.

Description

Joint composition and application thereof

Technical Field

The invention relates to the field of biotechnology, in particular to a linker composition and application thereof, and more particularly to a linker composition, a method for constructing a sequencing library, a nucleic acid molecule, a sequencing library, a sequencing method and a method for determining RNA sequence information.

Background

Small RNA (Small RNA) is an important functional molecule in organisms, and regulates and controls cell physiological processes such as cell growth and development, stress response, silent transposon and the like through various sequence-specific gene silencing effects.

Small RNA sequencing is high-throughput sequencing of Small RNA of 18-30nt in a specific state of a certain tissue of a certain species by means of a new generation high-throughput sequencing technology. And then, analyzing and identifying the obtained small RNA sequences through database comparison, and classifying millions of small RNA sequences into rRNA, tRNA, snRNA, snorRNA, miRNA and the like.

The existing Small RNA library construction process comprises the following steps: electrophoretically separating total RNA, and recovering 18-30nt components; sequentially connecting a 3 'joint and a 5' joint at two ends of small RNA; and carrying out reverse transcription and PCR amplification on the ligation product to obtain a small RNA library. However, during the linker ligation process in the Small RNA library construction protocol, large amounts of linker self-ligation products (adapter dimers) are produced. The generation of self-ligation of the linker can greatly waste sequencing data, and even possibly bring the bias of amplification efficiency of downstream steps, thereby affecting the accuracy of sequencing and analysis results.

Therefore, how to effectively reduce the generation of the adaptor self-ligation or reduce the adverse effect caused by the adaptor self-ligation is a key problem for improving the accuracy of SmallRNA sequencing and analysis.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art. The invention establishes a method for practically and efficiently reducing self-ligation generation of small RNA library joints. The method specifically degrades the self-ligation product of the linker by only modifying the linker sequence and introducing the restriction endonuclease taking cDNA as a substrate, thereby preventing the self-ligation product of the linker from entering a downstream experiment and ensuring the high utilization rate of sequencing data.

In a first aspect of the invention, a joint composition is provided. According to an embodiment of the invention, the joint composition comprises: a first joint; and a second linker, wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first linker and the second linker are self-ligated. The linker composition provided by the embodiment of the invention can be specifically cut and degraded by restriction endonuclease during self-ligation, so that when the linker composition provided by the embodiment of the invention is applied to library construction, a self-ligated linker cannot enter a downstream experiment under the action of the restriction endonuclease, and compared with the prior art, the utilization rate of sequencing data is remarkably improved.

In a second aspect of the invention, the invention provides a method of constructing a sequencing library. According to an embodiment of the invention, the method comprises: (1) Ligating the RNA sample with the adaptor composition as described above to obtain a ligation product; (2) Carrying out reverse transcription treatment on the ligation product so as to obtain a reverse transcription product; (3) Performing enzyme digestion treatment on the reverse transcription product so as to obtain an enzyme digestion treatment product, wherein the enzyme digestion treatment is performed under the action of a restriction enzyme, and the restriction enzyme specifically recognizes the restriction enzyme recognition site; (4) And carrying out amplification reaction on the enzyme digestion treatment product so as to obtain an amplification product, wherein the amplification product forms the sequencing library. According to the method provided by the embodiment of the invention, the restriction enzyme recognition site taking cDNA as a substrate is introduced into the joint, when the joint self-connection occurs, the restriction enzyme can specifically cut and degrade the joint self-connection product, after the joint self-connection product is cut and degraded, the joint self-connection product cannot enter subsequent PCR amplification due to the lack of complete sites for annealing the 5 'end and the 3' end with the PCR primer, so that the joint self-connection product is effectively prevented from entering a downstream experiment, the obtained RNA sequencing library is used for RNA sequencing and data analysis, the data utilization rate is high, and the accuracy of the analysis result is high.

In a third aspect of the invention, a nucleic acid molecule is presented. According to an embodiment of the invention, the nucleic acid molecule comprises: an RNA fragment; a first linker attached to the 5' end of the RNA fragment; and a second linker attached to the 3' end of the RNA fragment; wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first and second linkers are self-ligated. According to the method for constructing the sequencing library, the RNA sequencing library consisting of the nucleic acid molecules can be obtained, the joint self-connection products are low, the RNA sequencing library is used for RNA sequencing and data analysis, the data utilization rate is high, and the accuracy of the analysis result is high.

In a fourth aspect of the invention, a sequencing library is presented. According to an embodiment of the invention, the sequencing library comprises the nucleic acid molecules described above. The sequencing library is used for sequencing and data analysis, and has high data utilization rate and high accuracy of analysis results.

In a fifth aspect of the invention, the invention features a sequencing library. According to an embodiment of the present invention, the sequencing library is obtained by the method for constructing a sequencing library as described above. The sequencing library has low self-ligation products of the joint, is used for sequencing and data analysis, and has high data utilization rate and high accuracy of an analysis result.

In a sixth aspect of the invention, a sequencing method is provided. According to an embodiment of the invention, the sequencing method comprises: sequencing the sequencing library, wherein the sequencing library is the sequencing library described above. According to the sequencing method provided by the embodiment of the invention, the data utilization rate is high, and the obtained sequencing result has high accuracy.

In a seventh aspect of the invention, the invention features a method of determining RNA sequence information. According to an embodiment of the invention, the method comprises: constructing a sequencing library based on the RNA sample according to the method for constructing a sequencing library described above; sequencing the sequencing library to obtain a sequencing result; determining sequence information of the RNA sample based on the sequencing result. According to the sequence information of the RNA sample, the RNA can be accurately classified to obtain required rRNA, tRNA, snRNA, snorRNA or miRNA and the like; and small (small) RNA in the RNA is an important functional molecule in an organism, so that the obtained small RNA sequence information or classification information lays a good foundation for researching cell states of cells such as growth and development, stress response and the like.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a schematic flow diagram of a method of constructing a small RNA sequencing library according to an embodiment of the present invention;

FIG. 2 is a schematic flow diagram of a prior art method of constructing a small RNA sequencing library according to an embodiment of the present invention; and

FIG. 3 is a diagram showing the results of electrophoretic detection of the library according to the embodiment of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

It should be noted that, if not specifically stated, the term "small (small) RNA" as used herein refers to an RNA molecule having a length within a predetermined length range, which is not particularly limited, and in general, the length range may be such that the RNA molecule can be directly used as an insert for constructing a sequencing library without subjecting the "small (small) RNA" to a cleavage treatment prior to constructing the sequencing library. For example, an RNA of 18-30nt in length, including but not limited to rRNA, tRNA, snRNA, snorRNA, miRNA, etc., it will be understood by those skilled in the art that the "small (small) RNA" may contain non-RNA components, e.g., including deoxynucleotide components. In addition, it will be understood by those skilled in the art that the "small (small) RNA" may be naturally occurring, including, for example, but not limited to rRNA, tRNA, snRNA, snoRNA, and miRNA, and may also be isolated by pretreatment.

As used herein, a "rare restriction enzyme recognition site" refers to a recognition site that has a very low probability of occurrence in a target species, if not specified, e.g., in the human genome, and preferably does not occur more than 5 times, more preferably not more than 4 times, even more preferably not more than 3 times, 2 times or 1 time, and still more preferably not. According to a particular embodiment of the invention, the "rare restriction enzyme recognition site" is not present in any oligonucleotide sequence used in the RNA banking process, nor in any known miRNA sequence.

Joint composition

In a first aspect of the invention, a joint composition is provided. According to an embodiment of the invention, the joint composition comprises: a first joint; and a second linker, wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first linker and the second linker are self-ligated. The linker composition provided by the embodiment of the invention can be specifically cut and degraded by restriction endonuclease during self-ligation, so that when the linker composition provided by the embodiment of the invention is applied to library construction, a self-ligated linker cannot enter a downstream experiment under the action of the restriction endonuclease, and the utilization rate of sequencing data is effectively improved.

According to an embodiment of the invention, the restriction enzyme recognition site is a rare restriction enzyme recognition site. The rare restriction enzyme recognition site according to the embodiment of the invention is not repeated with any oligonucleotide sequence used in the library building process, and is not repeated with a known nucleotide sequence, so that the interference of the restriction enzyme on the library building process, such as PCR amplification, can be effectively avoided, and the degradation of the restriction enzyme on the nucleotide sequence to be detected can also be effectively avoided.

According to an embodiment of the present invention, the restriction enzyme recognition site is not less than 5nt, more preferably not less than 6nt in length. And the probability that the restriction enzyme recognition site does not appear in the target nucleotide sequence is greatly improved.

According to an embodiment of the present invention, the restriction enzyme recognition site is CCTAGG or CCUAGG. The sequence of the recognition site is longer, and is not repeated with any oligonucleotide sequence used in the RNA library building process, and is not repeated with a known miRNA sequence, so that the interference of restriction endonuclease on the library building process, such as PCR amplification, can be effectively avoided, and the degradation of the restriction endonuclease on the RNA to be detected can also be effectively avoided. According to an embodiment of the present invention, the restriction enzyme recognition site is an AvrII recognition site. The AvrII recognition site can be specifically recognized by AvrII restriction endonuclease, avrII can take an RNA-DNA hybrid chain as a substrate, and compared with other enzymes which can take an RNA-DNA hybrid chain as a substrate, avrII can not only cut an RNA chain on the hybrid chain, but also cut a DNA chain on the hybrid chain, and the recognition site has longer sequence and high degradation efficiency on the RNA-DNA hybrid chain. The self-ligation product of the linker composition according to embodiments of the invention is suitable for being subjected to an AvrII restriction enzyme reaction in a reverse transcription step.

Linker compositions according to embodiments of the invention are particularly useful for the construction of RNA libraries.

According to an embodiment of the invention, the 3 'terminal sequence of the first linker is CCT or CCU and the 5' terminal sequence of the second linker is AGG. And then the first linker and the second linker can form a restriction endonuclease recognition site CCTAGG or CCUAGG when self-linking, and then the linker self-linking product can be cut by the AvrII restriction endonuclease.

According to an embodiment of the invention, the 3 'terminal sequence of the first linker is CC and the 5' terminal sequence of the second linker is TAGG or UAGG. And then the first linker and the second linker can form a restriction endonuclease recognition site CCTAGG or CCUAGG when self-linking, and then the linker self-linking product can be cut by the AvrII restriction endonuclease.

According to an embodiment of the invention, the 3 'terminal sequence of the first linker is CCTA or CCUA and the 5' terminal sequence of the second linker is GG. And then the first linker and the second linker can form a restriction endonuclease recognition site CCTAGG or CCUAGG when self-linking, and then the linker self-linking product can be cut by the AvrII restriction endonuclease.

According to an embodiment of the invention, the first linker has the amino acid sequence of SEQ ID NO: 1.

GUUCAGAGUUCUACAGUCCGACGAUCCU(SEQ ID NO:1)。

According to an embodiment of the invention, the second linker has SEQ ID NO: 2.

AGGTGGAATTCTCGGGTGCCAAGG(SEQ ID NO:2)。

The self-ligation product of the linker composition according to the embodiment of the present invention has CCUAGG, the cDNA after reverse transcription has a sequence of CCTAGG, and CCUAGG and CCTAGG can be specifically recognized by AvrII restriction enzyme, so that the self-ligation product of the linker composition according to the embodiment of the present invention is suitable for being subjected to AvrII restriction enzyme reaction in a reverse transcription step, and the self-ligation product of the linker composition according to the embodiment of the present invention is specifically cleaved and degraded after reverse transcription, and cannot enter into downstream experiments, thereby effectively improving the utilization rate of sequencing data.

Method for constructing sequencing library

In a second aspect of the invention, the invention provides a method of constructing a sequencing library. According to an embodiment of the present invention, the method may refer to fig. 1, including: (1) Ligating the RNA sample with the adaptor composition as described above to obtain a ligation product; (2) Carrying out reverse transcription treatment on the ligation product so as to obtain a reverse transcription product; (3) Carrying out enzyme digestion treatment on the reverse transcription product so as to obtain an enzyme digestion treatment product, wherein the enzyme digestion treatment is carried out under the action of a restriction enzyme, and the restriction enzyme specifically recognizes the restriction enzyme recognition site; (4) And carrying out amplification reaction on the enzyme digestion treatment product so as to obtain an amplification product, wherein the amplification product forms the sequencing library. According to the method provided by the embodiment of the invention, the restriction enzyme recognition site taking cDNA as a substrate is introduced into the joint, when the joint self-connection occurs, the restriction enzyme can specifically cut and degrade the joint self-connection product, after the joint self-connection product is cut and degraded, the joint self-connection product cannot enter subsequent PCR amplification due to the lack of complete sites for annealing the 5 'end and the 3' end with the PCR primer, so that the joint self-connection product is effectively prevented from entering a downstream experiment, the obtained RNA sequencing library is used for RNA sequencing and data analysis, the data utilization rate is high, and the accuracy of the analysis result is high.

According to an embodiment of the invention, the RNA sample contains RNA molecules with a length of 18-30 nt. According to a particular embodiment of the invention, said RNA molecules of 18-30nt length are provided in the form of small RNAs. The method for constructing the sequencing library according to the embodiment of the invention is more suitable for constructing 18-30nt RNA molecule (small RNA) libraries.

According to an embodiment of the invention, the amplification reaction is a PCR reaction.

According to an embodiment of the present invention, the restriction enzyme has an RNA-DNA hybrid strand recognition activity. The self-ligated product of the adapter composition is then suitable for being subjected to a restriction enzyme reaction in the reverse transcription step, and the cleaved self-ligated product cannot enter the downstream amplification reaction due to the lack of intact sites for annealing of the PCR primers at the 5 'and 3' ends.

According to an embodiment of the invention, the restriction enzyme is AvrII. As described above, avrII can cleave not only an RNA strand but also a DNA strand on a hybrid strand, and has a long recognition site sequence and a high efficiency of degrading an RNA-DNA hybrid strand, as compared to other enzymes that can cleave an RNA-DNA hybrid strand. Further improving the degradation efficiency of the joint self-connection product.

According to the embodiment of the invention, the enzyme digestion treatment is carried out by using AvrII at 37 ℃ for 30 minutes. And then the adaptor self-ligation product is specifically cut and degraded by AvrII after reverse transcription, and the cutting reaction is carried out for 30 minutes at 37 ℃, so that the highest enzyme activity of AvrII is ensured, the cutting is thorough, and a non-specific product caused by excessive cutting cannot be generated.

According to an embodiment of the invention, the RNA PCR primers utilized in the PCR amplification have the amino acid sequence of SEQ ID NO: 3-4.

AATGATACGGCGACCACCGAGATCTACA(SEQ ID NO：3)。

CGTTCAGAGTTCTACAGTCCGA(SEQ ID NO：4)。

The RNA PCR primer according to the embodiment of the invention can specifically amplify the RNA sequence to be detected, and has high amplification specificity and efficiency.

According to an embodiment of the present invention, the RNA PCR tag primer utilized in the PCR amplification has the sequence of SEQ ID NO: 5-6.

CAAGCAGAAGACGGCATACGAGATCGT(SEQ ID NO：5)。

GATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA(SEQ ID NO：6)。

The RNA PCR label primer can specifically amplify an RNA sequence to be detected, so that an RNA sequencing library for sequencing is obtained.

Sequencing libraries

In a third aspect of the invention, a nucleic acid molecule is provided. According to an embodiment of the invention, the nucleic acid molecule comprises: an RNA fragment; a first linker attached to the 5' end of the RNA fragment; and a second linker attached to the 3' end of the RNA fragment; wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first and second linkers are self-ligated. According to the method for constructing the sequencing library, disclosed by the embodiment of the invention, the RNA sequencing library formed by the nucleic acid molecules can be obtained, the content of the self-ligation product of the joint is low, the RNA sequencing library is used for RNA sequencing and data analysis, the data utilization rate is high, and the accuracy of an analysis result is high.

Wherein the restriction enzyme recognition sites, the characteristics and advantageous effects of the first linker and the second linker are as described in the previous linker composition, and are not described herein again.

In yet another aspect of the invention, the invention features a sequencing library. According to an embodiment of the present invention, the sequencing library is obtained by the method for constructing a sequencing library as described above. The sequencing library is used for RNA sequencing and data analysis, and has high data utilization rate and high accuracy of analysis results.

Sequencing method

In a sixth aspect of the invention, a sequencing method is provided. According to an embodiment of the invention, the sequencing method comprises: sequencing the sequencing library, wherein the sequencing library is the sequencing library described above. According to the sequencing method provided by the embodiment of the invention, the data utilization rate is high, and the obtained sequencing result is high in accuracy.

Method for determining RNA sequence information

In a seventh aspect of the invention, the invention features a method of determining RNA sequence information. According to an embodiment of the invention, the method comprises: constructing a sequencing library based on the RNA sample according to the method for constructing a sequencing library described above; sequencing the sequencing library to obtain a sequencing result; determining sequence information of the RNA sample based on the sequencing result. According to the sequence information of the RNA sample, the RNA can be accurately classified to obtain required rRNA, tRNA, snRNA, snoRNA or miRNA and the like; and small (small) RNA in the RNA is an important functional molecule in an organism, so that the obtained small RNA sequence information or classification information lays a good foundation for researching cell states of cells such as growth and development, stress response and the like.

The scheme of the invention will be explained with reference to the examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples do not specify particular techniques or conditions, and are carried out according to techniques or conditions described in literature in the art (for example, refer to molecular cloning, a laboratory Manual, third edition, scientific Press, compiled by J. SammBruk et al, huang Peitang et al), or according to product instructions. The reagents or apparatus used are not indicated by the manufacturer, but are conventional products available commercially, for example from Illumina.

Examples

The following examples use the human standard RNA sample UHRR (Agilent, lot. # 740000) to construct small RNA libraries.

The experiment is divided into 3 groups:

and (3) performing reverse transcription and subsequent amplification reaction to obtain a final library, wherein the control group (see a method shown in FIG. 2, a target RNA sequence is connected with a 3' joint in a reaction (1), a target RNA sequence is connected with a 5' joint in a reaction (2), and a large amount of joint self-connection products are obtained by connecting the target RNA sequence and an excessive 3' joint in the previous reaction.

ST group (Stop Oligo, an oligonucleotide sequence of stem-loop structure, added to the reaction system after completion of the 3' linker ligation reaction, can specifically anneal and ligate to an excess of 3' linker, preventing ligation with the 5' linker incorporated in the next reaction, thereby preventing the generation of linker self-ligation).

RE group (see FIG. 1 for method, in reaction (1), the modified 3' linker is connected to the target (target) RNA sequence, in reaction (2), the modified 5' linker is connected to the target (target) RNA sequence and the excessive 3' linker in the previous reaction, and a large amount of linker self-ligation products are obtained, in reaction (3), the linker self-ligation products carry restriction endonuclease sites of AvrII through reverse transcription, in reaction (4), the linker ligation products are cut by AvrII, and the fragments of the linker ligation products cannot enter downstream amplification reaction, and finally, a high-purity library is obtained);

each set of experiments was set up in 3 replicates. The experimental procedure was as follows:

1) Small RNA enrichment: taking 1 mu g of total RNA, spotting the total RNA to 15% polyacrylamide denatured gel, cutting the gel, recovering 18-30nt fragments, and dissolving in 5 mu L of nuclease-free water (nuclease-free water);

2) 3' linker attachment: add 1 μ L of 3 'linker (RE group adds modified 3' linker,AGGTGGAATTCTCGGGTGCCAAGG (SEQ ID NO: 2)), mixing, incubating at 70 ℃ for 2 minutes, and then placing on ice; sequentially adding 1ul of a Ligation Buffer (Ligation Buffer) 2 mu L, RNA enzyme Inhibitor (RNase Inhibitor) and 1 mu L of a T4RNA Ligase 2 truncated form (T4 RNA Ligation 2Deletion Mutant) into the mixture, uniformly mixing, and incubating for 1 hour at 28 ℃;

3) Control and RE groups were placed on ice; adding 1 mu L of Stop Oligo into the ST group reaction system, uniformly mixing, and incubating for 15 minutes at 28 ℃;

4) 5' linker connection: sequentially adding 1 μ L of 5 'linker (modified 5' linker is added in RE group, GUUCAGAGUUCUACAGUCCGACGAU)CCU(SEQ ID NO: 1)), 1. Mu.L of 10mM ATP 1. Mu. L, T4RNA ligase, mixing, and incubating at 28 ℃ for 1 hour;

5) RNA reverse transcription: adding 1 mu L of RNA reverse transcription primer into 6 mu L of ligation reaction product, uniformly mixing, incubating for 2 minutes at 70 ℃, and then placing on ice; sequentially adding 2 mu L of 5X First Strand reaction Buffer (First Strand Buffer), 0.5 mu L of 12.5MMdNTP mixture, 1 mu L of 100mM DTT 1 mu L, RNA enzyme inhibitor and 1 mu L of SuperScript II reverse transcriptase (ReverseTranscriptase), mixing uniformly, and incubating for 1 hour at 50 ℃;

6) Control and ST groups were placed on ice; adding 1 mu L of 10X CutSmart Buffer 1 mu L, avrII restriction endonuclease into the RE group, uniformly mixing, incubating at 37 ℃ for 30 minutes, and then placing on ice;

7) Template amplification: adding ultrapure water 8.5 mu L, PCR mixed liquor 25 mu L, RNA PCR primer (shown in SEQ ID NO:3 and 4, AATGATACGGCGACCACCGAGATCTACA (SEQ ID NO: 3), CGTTCAGAGTTCTACAGTCCGA (SEQ ID NO: 4)) 2 mu L, RNA PCR label primer (shown in SEQ ID NO:5 and 6, CAAGCAGAAGACGGCATACGAGATCGT (SEQ ID NO: 5), GATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA (SEQ ID NO: 6)) 2 mu L to the upward reaction system in sequence, mixing uniformly, and entering a PCR reaction program: denaturation at 98 ℃ for 30 seconds, three steps for 11 cycles: denaturation at 98 ℃ for 10 seconds, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 15 seconds, extension at 72 ℃ for 10 minutes, and cooling to 4 ℃;

8) And (3) electrophoresis detection: and (3) taking 20 mu L of PCR product, spotting to 6% polyacrylamide gel, performing electrophoresis at 100V for 40 minutes, and checking a library building result on an ultraviolet imager after EB dyeing. As shown in fig. 3. In fig. 3: lane1, 8 are 20bp DNA ladders, lane2, 3, 4 are control group libraries, lane5, 6, 7 are ST group libraries, and Lane9, 10, 11 are RE group libraries; the white arrows in the figure mark that the band at about 140bp is the target library, and the bands at about 120bp and below are the self-ligation products of the joint; therefore, the situation of self-connection of the connectors of the library in the control group is serious, ST is obviously improved, and almost no self-connection of the connectors occurs in the RE group. Therefore, when equally effective library data are obtained, because the RE group library almost has no joint self-ligation products, when the RE group library is used for subsequent RNA sequencing and data analysis, the data utilization rate is higher, the required original sequencing data are less, and the sequencing cost can be effectively reduced.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Wuhanhua university medical laboratory Co., ltd

<120> linker composition and use thereof

<130> PIDC3181601

<160> 6

<170> PatentIn version 3.3

<210> 1

<211> 28

<212> RNA\DNA

<213> Artificial

<220>

<223> nucleotide sequence of first linker

<400> 1

guucagaguu cuacaguccg acgauccu 28

<210> 2

<211> 24

<212> RNA\DNA

<213> Artificial

<220>

<223> nucleotide sequence of second linker

<400> 2

aggtggaatt ctcgggtgcc aagg 24

<210> 3

<211> 28

<212> DNA

<213> Artificial

<220>

<223> RNA PCR primer used in PCR amplification

<400> 3

aatgatacgg cgaccaccga gatctaca 28

<210> 4

<211> 22

<212> DNA

<213> Artificial

<220>

<223> RNA PCR primer used in PCR amplification

<400> 4

cgttcagagt tctacagtcc ga 22

<210> 5

<211> 27

<212> DNA

<213> Artificial

<220>

<223> RNA PCR tag primer used in PCR amplification

<400> 5

caagcagaag acggcatacg agatcgt 27

<210> 6

<211> 36

<212> DNA

<213> Artificial

<220>

<223> RNA PCR tag primer used in PCR amplification

<400> 6

gatgtgactg gagttccttg gcacccgaga attcca 36

Claims

1. A joint composition, comprising:

a first joint; and

a second linker, wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first linker and the second linker self-ligate.

2. The linker composition of claim 1 wherein the restriction enzyme recognition site is a rare-cutting restriction enzyme recognition site.

3. The linker composition of claim 1 wherein the restriction enzyme recognition site is no less than 5nt in length.

4. The linker composition of claim 1 wherein the restriction enzyme recognition site is not less than 6nt in length.

5. The linker composition of claim 1 wherein the restriction enzyme recognition site is CCTAGG or CCUAGG.

6. The linker composition of claim 1 wherein the restriction enzyme recognition site is an AvrII recognition site.

7. The linker composition of claim 1 wherein the 3 'terminal sequence of the first linker is CCT or CCU and the 5' terminal sequence of the second linker is AGG.

8. The linker composition of claim 1 wherein the 3 'terminal sequence of the first linker is CC and the 5' terminal sequence of the second linker is TAGG or UAGG.

9. The linker composition of claim 1 wherein the 3 'terminal sequence of the first linker is CCTA or CCUA and the 5' terminal sequence of the second linker is GG.

10. The linker composition of claim 1 wherein the first linker has the amino acid sequence of SEQ ID NO: 1.

11. The linker composition of claim 1 wherein the second linker has the amino acid sequence of SEQ ID NO: 2.

12. A method of constructing a sequencing library, comprising:

(1) Connecting an RNA sample with the linker composition as defined in any one of claims 1 to 11 to obtain a connection product;

(2) Subjecting the ligation product to reverse transcription treatment to obtain a reverse transcription product;

(3) Carrying out enzyme digestion treatment on the reverse transcription product so as to obtain an enzyme digestion treatment product, wherein the enzyme digestion treatment is carried out under the action of a restriction enzyme, and the restriction enzyme specifically recognizes the restriction enzyme recognition site;

(4) And carrying out amplification reaction on the enzyme digestion treatment product so as to obtain an amplification product, wherein the amplification product forms the sequencing library.

13. The method of claim 12, wherein the RNA sample comprises RNA molecules 18-30nt in length.

14. The method of claim 13, wherein the RNA molecules of 18-30nt in length are provided in the form of small RNAs.

15. The method of claim 12, wherein the amplification reaction is a PCR reaction.

16. The method according to claim 12, wherein the restriction enzyme has an RNA-DNA hybrid strand recognition activity.

17. The method of claim 16, wherein the restriction enzyme is AvrII.

18. The method according to claim 12, wherein the enzymatic cleavage is carried out using AvrII at 37 ℃ for 30 minutes.

19. The method of claim 15, wherein the RNA PCR primers used in the PCR amplification have the amino acid sequence of SEQ ID NO: 3~4.

20. The method of claim 15, wherein the RNA PCR tag primer used in the PCR amplification has the sequence of SEQ ID NO: 5~6.

21. A nucleic acid molecule, comprising:

an RNA fragment;

a first linker attached to the 5' end of the RNA fragment; and

a second linker attached to the 3' end of the RNA fragment;

wherein the 3 'terminal sequence of the first linker and the 5' terminal sequence of the second linker form a restriction enzyme recognition site when the first and second linkers are self-ligated.

22. The nucleic acid molecule of claim 21, wherein said restriction enzyme recognition site is a rare-cutting restriction enzyme recognition site.

23. The nucleic acid molecule according to claim 21, wherein the restriction enzyme recognition site is not less than 5nt in length.

24. The nucleic acid molecule according to claim 21, wherein the restriction enzyme recognition site is not less than 6nt in length.

25. The nucleic acid molecule of claim 21, wherein the restriction enzyme recognition site is CCTAGG or CCUAGG.

26. The nucleic acid molecule of claim 21, wherein the restriction enzyme recognition site is an AvrII recognition site.

27. The nucleic acid molecule of claim 21, wherein the 3 'terminal sequence of the first linker is CCT or CCU and the 5' terminal sequence of the second linker is AGG.

28. The nucleic acid molecule of claim 21, wherein the 3 'terminal sequence of the first linker is CC and the 5' terminal sequence of the second linker is TAGG or UAGG.

29. The nucleic acid molecule of claim 21, wherein the 3 'terminal sequence of the first linker is CCTA or CCUA and the 5' terminal sequence of the second linker is GG.

30. The nucleic acid molecule of claim 21, wherein said first linker has the sequence of SEQ ID NO: 1.

31. The nucleic acid molecule of claim 21, wherein said second linker has the sequence of SEQ ID NO: 2.

32. A sequencing library comprising the nucleic acid molecule of any one of claims 21 to 31.

33. A sequencing library obtained by the method of any one of claims 12 to 20.

34. A method of sequencing, comprising:

sequencing a sequencing library, wherein the sequencing library is the sequencing library of claim 32 or 33.

35. A method for determining RNA sequence information,

the method according to any one of claims 12 to 20, wherein a sequencing library is constructed based on an RNA sample;

sequencing the sequencing library to obtain a sequencing result;

determining sequence information of the RNA sample based on the sequencing result.