CN112322647A - Method for gene insertion of Escherichia coli K4 based on CRISPR technology - Google Patents

Method for gene insertion of Escherichia coli K4 based on CRISPR technology Download PDF

Info

Publication number
CN112322647A
CN112322647A CN202011384236.1A CN202011384236A CN112322647A CN 112322647 A CN112322647 A CN 112322647A CN 202011384236 A CN202011384236 A CN 202011384236A CN 112322647 A CN112322647 A CN 112322647A
Authority
CN
China
Prior art keywords
escherichia coli
ptarget
gene
target gene
plasmid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202011384236.1A
Other languages
Chinese (zh)
Inventor
尹鸿萍
朱岩
王莹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
China Pharmaceutical University
Original Assignee
China Pharmaceutical University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by China Pharmaceutical University filed Critical China Pharmaceutical University
Priority to CN202011384236.1A priority Critical patent/CN112322647A/en
Publication of CN112322647A publication Critical patent/CN112322647A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses a method for carrying out gene insertion on Escherichia coli K4 based on a CRISPR technology. The invention relates to the field of biotechnology gene editing, in particular to a method for targeting exogenous genes to chromosomes in escherichia coli based on a CRISPR/Cas9 system. The method comprises the following steps: the target gene is inserted into the LacZ gene of the Escherichia coli K4 by using the introduced lambda Red homologous recombination system and the CRISPR system. The invention establishes an efficient and simple target gene positioning and inserting method for combining the traditional gene editing technology of escherichia coli with a CRISPR system. Compared with the existing Escherichia coli K4 gene editing method, the method provided by the invention can realize efficient and accurate target gene insertion work in Escherichia coli. The gene insertion method in bacteria provided by the invention is simple, convenient and quick to operate, has low experimental cost, and is particularly suitable for high-throughput gene editing work.

Description

Method for gene insertion of Escherichia coli K4 based on CRISPR technology
Technical Field
The invention relates to the field of biotechnology gene knockout, in particular to a method for targeting exogenous genes to chromosomes in escherichia coli based on a CRISPR/Cas9 system.
Background
The capsular polysaccharide structure of Escherichia coli K4(ATCC23502) is chondroitin sulfate analogue fructosyl chondroitin, and the improvement of the yield of the fructosyl chondroitin is a hot research problem all the time. Currently, there are two methods for transforming target genes on chromosome level for Escherichia coli K4: firstly, homologous recombination is carried out on the DNA mediated by recombinant protein coded by a RecA homologous recombination system of the recombinant protein; and secondly, improving the homologous recombination efficiency by introducing exogenous recombinase lambda-Red or RecET. Both of the above two types of genes are the target genes edited by double exchange of DNA molecules. The traditional escherichia coli K4 homologous recombination technologies usually need exogenous auxiliary plasmids and screening marker genes, and perform experimental operations such as knockout and insertion on target genes, but when point mutation and other more precise operations are performed on the target genes, the recombination technologies have the defects of low recombination efficiency, complex flow and the like, and the large-scale application still faces huge challenges.
A base editor modified by a CRISPR/Cas system is a method which is widely applied to point mutation of nucleic acid bases at present, and is used as a novel gene editing tool, and the problems of high off-target rate, limited editing window and the like still exist in the technology.
Disclosure of Invention
The invention aims to provide a method for quickly and efficiently realizing targeted insertion of a K4 target gene of escherichia coli by combining the traditional gene editing technology of the escherichia coli with the CRISPR/Cas9 technology.
In a first aspect, the invention claims a method for site-directed insertion of a target gene in the genome of E.coli K4.
The method for performing site-specific insertion on the target gene in the genome of Escherichia coli K4, which is claimed by the invention, can comprise the following steps:
(1) transferring the plasmid pCas9 into Escherichia coli K4 to obtain Escherichia coli K4 pCas 9;
(2) designing 1 pair of reverse complementary primers according to a target gene lacZ, wherein one of the primers contains 20 nucleotide sequences of the target gene, taking a pTarget-F plasmid as a template, carrying out PCR amplification, transforming Escherichia coli DH5 alpha competent cells after the obtained PCR product is subjected to Dpn I digestion, phosphorylation and T4DNA ligase connection, selecting a positive transformant, sending to sequencing verification, and extracting the pTarget-F plasmid containing 20 nucleotide sequences of the target gene;
(3) using Escherichia coli BL21(DE3) genome as template, designing primers P3 and P4 according to T7RNAP nucleotide sequence, and PCR amplifying DNA fragment of T7 RNAP;
P3：TGTAAACGGGGATACTGACGAGATCCCGGACACCATCGAA
P4：CGCTACGGCCTGTATGTGGTATCCGGAGTCGTATTGATTTGGCGT
(4) taking a genome of Escherichia coli K4 as a template, designing primers according to upstream and downstream nucleotide sequences of a target gene site to be inserted, and carrying out PCR amplification on DNA fragments of the T7RNAP gene to be inserted and upstream and downstream homologous DNA sequences of the target gene; constructing a Donor DNA fragment carrying upstream and downstream homologous sequences of a T7RNAP gene and a lacZ gene;
(5) and (3) transferring the helper plasmid pTarget-F obtained in the step (2) and the DNA fragment obtained in the step (3) into escherichia coli K4 pCas9 competent cells by an electric shock transformation method to obtain recombinant escherichia coli with inserted genes.
Further, the mass ratio of the helper plasmid pTarget-F and the DONOR DNA fragment in the step (5) is preferably 1: 4;
further, the step (5) is transferred into a method comprising the following steps: mixing the helper plasmids pTarget-F and DONOR DNA fragments with competent cells of Escherichia coli K4 pCas9, gently flicking and uniformly mixing, adding into a precooled electric shock cup, wiping off condensed water outside the electric shock cup, and placing into a cup groove of an electric converter (Bio-Rad), wherein the conversion conditions are as follows: rapidly adding a liquid culture medium after electric shock, standing and culturing at 30 ℃ for 2h for resuscitation, centrifuging for 3min, discarding redundant supernatant, resuspending the thallus, and coating the thallus on an LB double-resistant solid culture medium to obtain genetically recombinant Escherichia coli K4;
further, the PCR amplification conditions in the step (2) are as follows: PrimeSTAR Max Premix 25. mu.L, 1.5. mu.L primer pTargetF-lacZF, 1.5. mu.L primer pTargetF-lacZR, template 1. mu.L, dd H2O is complemented to 50 mu L; the reaction procedure is as follows: 10s at 98 ℃, 5s at 55 ℃ and 15s at 72 ℃ for 30 cycles; storing at 16 ℃.
Further, the condition of DpnI in step (2) is: incubating at 37 ℃ for 5min, inactivating at 70 ℃ for 15min, and directly recovering DNA in the enzyme digestion reaction solution by using a DNA product purification kit for purification and recovery.
Further, the phosphorylation conditions in step (2) are as follows: ligation Buffer 5. mu. L, T4PNK 1uL, ddH2O42. mu.L, incubated at 37 ℃ for 30-40min, and inactivated at 65 ℃ for 20 min.
Further, the PCR conditions in step (3) are as follows: PrimeSTAR Max Premix 25. mu.L, 1.5. mu.L primer P3, 1.5. mu.L primer P4, template 1. mu.L, dd H2O is complemented to 50 mu L; the reaction procedure is as follows: 10s at 98 ℃, 5s at 55 ℃ and 3min at 72 ℃ for 30 cycles; storing at 16 ℃.
Further, the PCR conditions in step (4) are as follows: PrimeSTAR Max Premix 25. mu.L, 1.5. mu.L primer P1, 1.5. mu.L primer P2 or 1.5. mu.L primer P5, 1.5. mu.L primer P6, template 1. mu.L, dd H2O is complemented to 50 mu L; the reaction procedure is as follows: 30 cycles of 98 ℃ for 10s, 55 ℃ for 5s and 72 ℃ for 10 s; storing at 16 ℃.
The LB agar culture medium of the invention comprises the following final concentration components: 10g/L of peptone, 5g/L, NaCl 10g/L of yeast extract, 15g/L of agar powder and deionized water as a solvent, and the pH value is natural.
Drawings
FIG. 1 is a map of the plasmid vector pTargetF-lacZ of example 1.
FIG. 2 is a gel electrophoresis of the PCR amplified plasmid pTarget-F of example 1, M being DL2000Marker, lanes 1-6 representing parallel 6 identical PCR products of plasmid pTarget-F.
FIG. 3 is a gel electrophoresis image of DNA fragments obtained by PCR amplification of homology arms 1, T7RNAP and homology arm 2 in example 1, M is 15kb Ladder Marker, lanes 1-2 represent homology arm 1, lanes 3-4 represent PCR products of the T7RNAP gene, and lanes 5-6 represent homology arm 2.
FIG. 4 is a gel electrophoresis of the DNA fragment fusion PCR products of homology arm 1, T7RNAP and homology arm 2 of example 1, M being 15kb Ladder Marker, lanes 1-4 representing parallel 4 identical fusion PCR products.
FIG. 5 is a gel electrophoresis image of colony PCR verification of the E.coli K4 recombinant strain of example 1, M is 15kb Ladder Marker, lanes 1-5 represent colony PCR verification of randomly picked 5 transformants, and 80% is E.coli K4 recombinant strain.
Detailed Description
The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:
example 1 site-directed insertion of the T7RNAP Gene into E.coli K4
1. The pCas9 plasmid was point-transduced into escherichia coli K4, designated as escherichia coli K4 pCas, comprising the following steps:
(1) selecting single colony of Escherichia coli K4, inoculating in 5mL LB liquid test tube, culturing for 12h, activating for the second timeInoculating the secondarily activated bacterial liquid into 100mL of fresh LB liquid culture medium according to the ratio of 1: 100, and performing shaking culture at 220rpm until OD is reached600The culture was stopped about 0.6, the cell suspension was placed in ice for 30min, centrifuged at 4 ℃ and 6000rpm for 10min, the supernatant was discarded, the cells were washed with 50mL of precooled ultrapure water, centrifuged at 4 ℃ and 6000rpm for 10min, the supernatant was discarded, and 25mL of precooled ultrapure water was subjected to secondary washing, centrifuged, the supernatant was discarded, after the secondary washing, the cells were resuspended in 1mL of precooled ultrapure water, 100. mu.L of each tube was dispensed into 1.5mL centrifuge tubes, and the tubes were rapidly stored in a-80 ℃ refrigerator.
(2) And (3) transformation: escherichia coli K4 competent cells stored in a refrigerator at-80 ℃ were thawed in an ice box, 2 to 6. mu.L of pCas plasmid was added to 100. mu.L of competent cells, gently flicked to mix them uniformly, added to a precooled electric shock cup (0.1cm), the condensed water outside the electric shock cup was wiped off, and placed in the cup well of an electric converter (Bio-Rad), and the conversion conditions were as follows: 1.8KV, 200 omega resistance and 25 muF capacitance, adding 900 muL LB liquid culture medium after electric shock, standing and culturing for 2h at 30 ℃ for recovery, centrifuging for 3min at 8000g/min, discarding the surplus supernatant, coating the thallus after heavy suspension on LB solid culture medium (Kan, final concentration of 50mg/L), and culturing at 30 ℃ overnight. Transformants were verified by colony PCR. Is marked as Escherichia coli K4 pCas.
2. Construction of helper plasmid pTargetF-lacZ
(1) A linearized pTargetF-lacZ PCR product was obtained by PCR using pTarget-F plasmid (derived from Jiang et al, apple Environ Microbiol, 2015, 81: 2506-2514) as a template and using the primers pTargetF-lacZF (containing lacZ 20 nucleotides, i.e., N20) and pTargetF-lacZR.
pTargetF-lacZF：CATTTTTTGATGGACCATTTGTTTTAGAGCTAGAAATAGCAAGTT(SEQ ID NO.1)；
pTargetF-lacZR：ACTAGTATTATACCTAGGACTGAGC(SEQ ID NO.2)；
The specific conditions for PCR were:
preferably, the temperature is 10s at 98 ℃, 5s at 55 ℃ and 3min at 72 ℃, and the cycle is 30; storing at 16 ℃.
The PCR amplified product was identified by 1% agarose gel electrophoresis as shown in FIG. 2. As a result of the electrophoresis, a single specific band appeared at the theoretical size position, which was purified and recovered using the DNA Fragment Purification Kit (available from TaKaRa).
(2) Treatment of the purified PCR product with DpnI degrades the template plasmid:
preferably, the reaction is carried out in a water bath at 37 ℃ for 15min, and after the reaction is finished, the kit purifies and recovers the reaction.
(3) Phosphorylation, T4DNA ligase ligation:
preferably, incubation is carried out at 37 ℃ for 30-40min and inactivation is carried out at 65 ℃ for 20 min. Ligation was carried out overnight at 16 ℃.
(4) Transforming 50 μ L of E.coli DH5 α competent cells with the product obtained in step (3):
preferably, ice bath is carried out for 30min, heat shock is carried out for 90s at 42 ℃, then the mixture is quickly placed on ice for 1-2 min, the mixture is added into LB culture medium preheated at 950 mu L and 37 ℃, the mixture is uniformly mixed for 30 ℃, cultured for 1h at 200rpm, coated on LB agar culture medium containing 100 mu g/mL spectinomycin, cultured for 12h at 37 ℃, positive colonies are picked, sent to the company for sequencing (Jinwei Zhi), and sent to the sequencing primer:
P7：AACCGTATTACCGCCTTTG(SEQ ID NO.3)
as a result of the sequence analysis, pTargetF-lacZ containing the correct N20 portion was obtained, and the plasmid map was shown in FIG. 1. The sequence was determined as follows (SEQ ID NO. 4):
Figure BSA0000226489690000041
Figure BSA0000226489690000051
3. preparation of homologous repair DNA (DONOR DNA).
(1) Using Escherichia coli K4(ATCC23502) as a template, performing colony PCR to amplify two sections of DNA fragments of upstream and downstream homology arms of lacZ, wherein the primers are as follows:
P1：GGATCCGCCAGACGCCACTGCTGCCA；(SEQ ID NO.5)
P2：TTCGATGGTGTCCGGGATCTCGTCAGTATCCCCGTTTACA；SEQ ID NO.6)
P5：ACGCCAAATCAATACGACTCCGGATACCACATACAGGCCGTAGCG；(SEQ ID NO.7)
P6：AAGCTTGAAAATGGTCTGCTGCTGCT；(SEQ ID NO.8)
(2) colony PCR was performed using E.coli BL21(DE3) as a template to amplify the T7RNAP fragment with the following primers:
P3：TGTAAACGGGGATACTGACGAGATCCCGGACACCATCGAA；(SEQ ID NO.9)
P4：CGCTACGGCCTGTATGTGGTATCCGGAGTCGTATTGATTTGGCGT；(SEQ ID NO.10)
(3) performing fusion PCR by using the PCR product as a template and using P1 and P6 as primers to prepare a DONOR DNA fragment; (SEQ ID NO.11)
The PCR products were identified by 1% agarose gel electrophoresis, as shown in FIG. 3; the fusion PCR electrophoresis results are shown in FIG. 4; the results all have single specific bands with the sizes of 526bp, 4482bp, 526bp and 5454bp respectively, and the specific bands are purified and recovered for later use;
the specific conditions for PCR were:
preferably, the temperature is 98 ℃ for 10s, the temperature is 55 ℃ for 5s, the temperature is 72 ℃ for 10s, and the cycle is 30; storing at 16 deg.C;
the specific conditions for fusion PCR were:
preferably, 95 ℃ for 5 min; 1min at 95 ℃, 30s at 55 ℃ and 2min at 72 ℃ for 30 cycles; extending for 10min at 72 ℃; storing at 15 ℃.
The fusion PCR product was subjected to sequencing analysis (Jinzhi) to detect the presence of the T7RNAP gene portion, and was accompanied by a primer for detection.
The primers for detection were as follows:
P10：AACCGTATTACCGCCTTTG；(SEQ ID NO.12)
the sequence was determined as follows (SEQ ID NO. 11):
Figure BSA0000226489690000061
Figure BSA0000226489690000071
Figure BSA0000226489690000081
Figure BSA0000226489690000091
4. competent preparation of E.coli K4 pCas
(1) Picking a single colony, and transferring the single colony into a test tube filled with 10mL of LB liquid culture medium; culturing at 30 ℃ at 220rpm, OD600When the concentration is approximately equal to 0.1, 20mM L-Arabinose is added; the cultivation was continued at 220rpm at 30 ℃ until OD600≈0.4；
(2) Placing in ice and pre-cooling for 30 min; sucking 1mL of culture solution into a pre-cooled 1.5mL sterile EP tube, and centrifuging at 4 ℃ for 10min at 4000 g;
(3) discarding the supernatant, adding 1mL of precooled sterilized distilled water to resuspend the thalli; centrifuging at 4000g at 4 deg.C for 10 min; discarding the supernatant on a super clean bench, adding 1mL of pre-cooled 10% glycerol to gently resuspend the thalli, and repeating the step for 3 times; centrifuging at 4000g at 4 deg.C for 10 min; the supernatant was discarded in a clean bench, and 80. mu.L of 10% glycerol, which had been cooled in advance, was added to the supernatant to gently resuspend the cells for use.
5. And (3) transformation: mu.g of pTargetF-lacZ plasmid (SEQ ID NO.4) prepared in step 2 and 4. mu.g of DONOR DNA fragment (SEQ ID NO.11) prepared in step 3 were mixed with 100. mu.L of Escherichia coli K4 pCas competent cells, ice-cooled for 30min, the mixture was heat-shocked at 42 ℃ for 90s, rapidly placed on ice for 1-2 min, added to 950. mu.L of LB medium preheated at 30 ℃ and mixed well, and cultured at 30 ℃ and 200rpm for 1 h.
The mass ratio of the pTargetF-lacZ plasmid to the DONOR DNA product is 1: 2-1: 8, preferably 1: 4.
6. Centrifuging the bacterial liquid obtained in the step 5, discarding 800 mu L of supernatant, uniformly mixing the rest part, coating 50 mu L of bacterial liquid on an LB agar culture medium containing 50 mu g/mL kanamycin and 50 mu g/mL spectinomycin, culturing at 30 ℃ for 12-24 h, and selecting transformants.
7. Colony PCR was performed using identifying primers P8 and P9 to verify transformants, and the results are shown in FIG. 5. The identification primer is positioned outside the target gene, the length of the sequence targeted by the identification primer in a wild strain is 1643bp (lane 2), the length of the sequence in an inserted strain is 6537bp (lanes 1 and 3-5) due to the replacement of the original target gene by the T7RNAP gene, and the experimental result is consistent with the expectation, which indicates that the method can successfully obtain the Escherichia coli K4T 7RNAP recombinant strain.
P8：TCGGCCTGGTAATGGCCCGC；(SEQ ID NO.13)
P9：GCGCCTTTCGGCGGTGAAAT；(SEQ ID NO.14)
4/5 of target genes in all the detected transformants are replaced by T7RNAP genes, so that the positive rate of knocking out the Escherichia coli by the method can reach 80%.
In conclusion, the invention establishes a quick, simple and efficient escherichia coli gene site-specific insertion method mediated by the CRISPR/Cas9 system, combines the traditional and modern gene editing technologies, and provides an effective tool for research on escherichia coli K4 gene editing. Lays a scientific theory and practical foundation for producing fructose chondroitin by fermentation.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Figure ISA0000226489710000011
Figure ISA0000226489710000021
Figure ISA0000226489710000031
Figure ISA0000226489710000041
Figure ISA0000226489710000051
Figure ISA0000226489710000061
Figure ISA0000226489710000071
Figure ISA0000226489710000081
Figure ISA0000226489710000091
Figure ISA0000226489710000101

Claims (5)

1. A method for carrying out site-directed insertion on an Escherichia coli K4 genome comprises the following steps:
(1) transferring the plasmid pCas9 into Escherichia coli K4 to obtain Escherichia coli K4 pCas 9;
(2) designing 1 pair of reverse complementary primers according to a target gene, wherein one of the primers contains 20 nucleotide sequences of the target gene, taking pTarget-F plasmid as a template, carrying out PCR amplification, transforming Escherichia coli DH5 alpha competent cells after the obtained PCR product is subjected to Dpn I digestion, phosphorylation and T4DNA ligase connection, and screening to obtain pTarget-F plasmid containing 20 nucleotide sequences of the target gene, namely auxiliary plasmid pTarget-F;
(3) constructing a Donor DNA segment carrying upstream and downstream homologous sequences of a T7RNAP gene and a lacZ gene;
(4) and (3) transferring the helper plasmid pTarget-F obtained in the step (2) and the DNA fragment obtained in the step (3) into escherichia coli K4 pCas9 competent cells by an electric shock transformation method to obtain the recombinant escherichia coli inserted with the target gene.
2. The method for site-directed insertion of the genome of E.coli K4 according to claim 1, wherein E.coli K4(ATCC23502) is ordered to Addgene in step (1).
3. The method for site-directed insertion of the genome of Escherichia coli K4 according to claim 1, wherein the 20 nucleotide sequences of the target gene in step (2) are designed by: the design was performed using the www.rgenome.net/cas-designer website.
4. The method for site-directed insertion of the genome of E.coli K4 according to claim 1, wherein the T7RNA polymerase of step (3) is derived from E.coli BL21(DE 3).
5. The method for site-directed insertion of the genome of escherichia coli K4 according to claim 1, wherein the target gene is a LacZ gene, and the method comprises:
(1) transferring the plasmid pCas9 into Escherichia coli K4 to obtain Escherichia coli K4 pCas 9;
(2) designing 2 pairs of reverse complementary primers pTarget-F-LacZF and pTarget-F-LacZR according to the target gene and the inserted gene, wherein the primers pTarget-F-LacZF contain 20 nucleotide sequences of the target gene, taking a pTarget-F plasmid as a template, carrying out PCR amplification, transforming Escherichia coli DH5 alpha competent cells by obtained PCR products, and screening to obtain an auxiliary plasmid pTarget-F-LacZ containing 20 nucleotide sequences of the target gene;
pTarget-F-LacZF：CATTTTTTGATGGACCATTTGTTTTAGAGCTAGAAATAGCAAGTT；
pTarget-F-LacZR：ACTAGTATTATACCTAGGACTGAGC；
(3) using Escherichia coli BL21(DE3) genome as template, designing primers P3 and P4 according to T7RNAP nucleotide sequence, and PCR amplifying DNA fragment of T7 RNAP;
P3：TGTAAACGGGGATACTGACGAGATCCCGGACACCATCGAA；
P4：CGCTACGGCCTGTATGTGGTATCCGGAGTCGTATTGATTTGGCGT；
(4) using Escherichia coli K4 genome as template, designing primers P1, P2, P5 and P6 according to upstream and downstream homology arms of target gene lacZ, and carrying out PCR amplification on DNA fragments of homology arm 1 and homology arm 2;
P1：GGATCCGCCAGACGCCACTGCTGCCA；
P2：TTCGATGGTGTCCGGGATCTCGTCAGTATCCCCGTTTACA；
P5：ACGCCAAATCAATACGACTCCGGATACCACATACAGGCCGTAGCG；
P6：AAGCTTGAAAATGGTCTGCTGCTGCT；
(5) performing PCR amplification by using the three DNA fragments obtained in the steps (3) and (4) as templates and using the primers P1 and P6 obtained in the step (4) to obtain a DONOR DNA fragment;
(6) and (3) transforming the helper plasmid pTarget-F obtained in the step (2) and the DNA fragment obtained in the step (5) into competent cells of Escherichia coli K4 pCas 9. Transformants were verified by colony PCR (primers P1/P6).
CN202011384236.1A 2020-12-01 2020-12-01 Method for gene insertion of Escherichia coli K4 based on CRISPR technology Pending CN112322647A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202011384236.1A CN112322647A (en) 2020-12-01 2020-12-01 Method for gene insertion of Escherichia coli K4 based on CRISPR technology

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202011384236.1A CN112322647A (en) 2020-12-01 2020-12-01 Method for gene insertion of Escherichia coli K4 based on CRISPR technology

Publications (1)

Publication Number Publication Date
CN112322647A true CN112322647A (en) 2021-02-05

Family

ID=74308650

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202011384236.1A Pending CN112322647A (en) 2020-12-01 2020-12-01 Method for gene insertion of Escherichia coli K4 based on CRISPR technology

Country Status (1)

Country Link
CN (1) CN112322647A (en)

Similar Documents

Publication Publication Date Title
CN106480083B (en) CRISPR/Cas 9-mediated large-fragment DNA splicing method
CN105624187A (en) Site-directed mutation method for genomes of saccharomyces cerevisiae
EP2588615B1 (en) Self-deleting plasmid
CN111454927B (en) Efficient salmonella traceless gene editing system and application thereof
CN110551668B (en) Enterotoxin gene LT-knocked-out escherichia coli and construction method thereof
CN112538495A (en) Method for gene insertion of Escherichia coli K4 based on CRISPR technology
CN117025651B (en) Laccase gene knockout method in Erwinia
CN110591994B (en) Sodium hydroxide stimulation-based vibrio harveyi homologous recombination gene knockout method
CN112980891B (en) Coli genome editing tool based on CRISPR-Cas
CN112011539A (en) Cell line for targeted knockout of porcine GDPD2 gene based on CRISPR-Cas9 technology and construction method thereof
CN112322647A (en) Method for gene insertion of Escherichia coli K4 based on CRISPR technology
CN110591993A (en) Vibrio harveyi homologous recombination gene knockout method based on hydrochloric acid stimulation
CN111004813A (en) Super-large plasmid construction kit, super-large plasmid construction method and application thereof
CN112646811B (en) CRISPR/Cas9 system suitable for multi-gene knockout of yeast and construction method and application thereof
CN108486140A (en) A kind of cloning vector preparation method and kit based on seamless clone technology
CN103540587A (en) Method of target-integrating foreign DNA (Deoxyribonucleic Acid) sequence to Rosa26 sites of rat and mouse as well as application thereof
CN111139258A (en) Linearized DNA vector pHB-1 plasmid and kit prepared from same and used for editing bacterial genome
CN110982834A (en) Plasmid construction kit, plasmid construction method and application thereof
CN115927426B (en) Screening system of Pasteurella multocida gene deletion mutant strain and application thereof
CN109593730B (en) Duck plague virus Lorf5 gene traceless deletion strain DPV CHv-delta Lorf5 and construction method thereof
CN115976086B (en) Method for editing bacteria CRISPR-Cas9 gene and application thereof
WO2023241567A1 (en) Wild-type-mutant π protein switching expression system capable of increasing efficiency of preparing screening-tag-free plasmid
CN115786229B (en) Recombination system for rhodococcus gene knockout and application thereof
CN117286166A (en) Bacterial genome multiple editing method and application thereof
CN112980862A (en) Preparation method of high-purity micro-ring DNA

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication