CN112322513A

CN112322513A - Acetic acid and furfural resistant fermentation strain and construction method thereof

Info

Publication number: CN112322513A
Application number: CN202011119884.4A
Authority: CN
Inventors: 汤岳琴; 陈栋; 李波; 缪晡; 吴娅婧
Original assignee: Sichuan University; China Petroleum and Chemical Corp; Sinopec Shanghai Engineering Co Ltd
Current assignee: Sichuan University; China Petroleum and Chemical Corp; Sinopec Shanghai Engineering Co Ltd
Priority date: 2020-10-19
Filing date: 2020-10-19
Publication date: 2021-02-05

Abstract

The invention provides an acetic acid and furfural resistant fermentation strain and a construction method thereof, wherein the Saccharomyces cerevisiae strain is SEB16 which is named as Saccharomyces cerevisiae by classification, and the preservation number is CGMCC No. 19589. The invention uses CRISPR/Cas9 gene editing technology, uses strain SEB5 capable of efficiently utilizing xylose as an original strain, replaces the promoters of genes (HAA1 and TYE7) for coding target transcription factors and functional genes (FDH1) with the promoters of UBI4 which has higher expression quantity and is stable under the stress of various typical inhibitors, and simultaneously over-expresses the genes HAA1, TYE7 and FDH1 to obtain the strain SEB 16. The SEB16 strain has strong acetic acid and furfural tolerance, the ethanol yield reaches 85% of the theoretical yield, and the SEB16 strain has important significance for producing fuel ethanol by utilizing lignocellulose raw materials.

Description

Acetic acid and furfural resistant fermentation strain and construction method thereof

Technical Field

The invention relates to the technical field of construction of fermentation strains, in particular to an acetic acid and furfural resistant fermentation strain and a construction method thereof.

Background

The production of fuel ethanol by taking agricultural straws as raw materials is one of the straw resource utilization ways. During the pretreatment and saccharification of the straws, cellulose and hemicellulose are hydrolyzed into monosaccharide mainly comprising glucose and xylose, and meanwhile, a plurality of byproducts including weak acids, furans and phenols are generated, and the byproducts can inhibit the growth and fermentation of the ethanol-producing microorganism saccharomyces cerevisiae. Therefore, the cultivation of the saccharomyces cerevisiae strain which can tolerate various inhibitors and can efficiently ferment glucose and xylose to produce ethanol is the basis for realizing the industrial production of the straw fuel ethanol.

Acetic acid and furfural are typical representatives of weak acid and furan inhibitors, respectively, and are widely present in lignocellulose hydrolysate from different sources. Acetic acid is mainly produced by xylose deacetylation during lignocellulose pretreatment, and furfural is mainly produced along with depolymerization of hemicellulose and formation of xylose. In view of the ubiquitous nature and higher stress concentration of acetic acid and furfural, constructing a saccharomyces cerevisiae strain tolerant to mixed inhibitors is of great significance for producing fuel ethanol from lignocellulosic feedstocks.

Disclosure of Invention

The invention aims to overcome the defects in the prior art and provide an acetic acid and furfural resistant fermentation strain and a construction method thereof, wherein an industrial flocculation-type saccharomyces cerevisiae strain with excellent glucose and xylose fermentation capacity is used as an initial strain, a CRISPR/Cas9 gene editing technology is adopted, and promoters of genes (HAA1 and TYE7) and functional genes (FDH1) for coding target transcription factors are replaced by promoters of UBI4 which have higher expression amount and are stable under the stress of various typical inhibitors, so that the aim of high expression is fulfilled. After a target transformant is obtained, evaluating the performance of the transformant by synthesizing culture medium batch fermentation and straw hydrolysate fermentation to obtain a strain with strong acetic acid and furfural tolerance.

The invention adopts the following technical scheme for solving the technical problems:

the invention provides an acetic acid and furfural resistant fermentation strain which is SEB16 and is classified and named as Saccharomyces cerevisiae with the preservation number of CGMCC No.19589, the preservation date of 2020 and 20 months, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit address is No. 3 of West Lu 1 of North Chen of the sunward area in Beijing.

The second aspect of the invention is to provide the construction method of the acetic acid and furfural resistant fermentation strain, and the promoters of HAA1, TYE7 and FDH1 genes of the starting strain SEB5 are replaced by UBI4 promoters through a CRISPR/Cas9 gene editing technology, so that the acetic acid and furfural resistant fermentation strain SEB16 is constructed.

Further, the construction method specifically comprises the following steps:

step one, amplification of the repair fragment (UBI4 promoter): using genome DNA of the strain SEB5 as a template, amplifying a UBI4 promoter by PCR and purifying;

step two, constructing a double-chain gRNA fragment and amplifying a gRNA linear framework: determining PAM sites of HAA1, TYE7 and FDH1 gene promoters, and constructing a double-chain gRNA fragment; carrying out PCR amplification by taking pMEL13 plasmid as a template and primers of SEQ ID No. 17-18 to obtain a gRNA linear framework and purifying the gRNA linear framework;

connecting the gRNA fragment with the digested gRNA linear skeleton, and then converting to obtain a gRNA plasmid;

transferring the extracted Cas9 plasmid into a strain SEB5, and then performing coating plate culture, screening and PCR reaction verification to obtain the Saccharomyces cerevisiae containing the Cas9 plasmid;

and step five, transferring the gRNA plasmid and the repair fragment into Saccharomyces cerevisiae containing Cas9 plasmid, then performing coating plate culture and screening, and performing PCR (polymerase chain reaction) verification to obtain a bacterial colony of the fermentation strain SEB16 resistant to acetic acid and furfural.

Further, the construction method also comprises removing the Cas9 plasmid and the gRNA plasmid in the colony of the fermentation strain SEB 16.

Further, the sequence of the primer adopted by PCR amplification in the first step is SEQ ID No. 1-2.

Further, the sequence of the homology arms required for constructing the double-stranded gRNA fragment is:

tgR F：TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGAT CN20GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC；

tgR R：GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC N20GATCATTTATCTTTCACTGCGGAGAAGTTTCGAACGCCGAAACATGCGCA。

further, the sequences of the PAM sites of the HAA1, TYE7 and FDH1 gene promoters are SEQ ID No.19, SEQ ID No.20 and SEQ ID No.21, respectively.

Further, in the third step, the gRNA fragment and the gRNA linear skeleton are connected by a Gibson connection method; the gRNA fragment and the gRNA linear framework are mixed according to the mass ratio of 5: 1 to make a connection.

Further, the Cas9 plasmid was extracted from e.coli containing Cas9 plasmid in step four.

Further, the culture medium used in spread plate culture in step four was 2% YPD medium containing 0.005% NAT; the 2% YPD medium consisted of 1% yeast extract powder, 2% peptone and 2% glucose.

Further, the primer sequence adopted by the PCR reaction in the fourth step is SEQ ID No. 15-16.

Further, the medium used in the spread plate culture in the fifth step included 0.5% yeast extract powder, 1% peptone, 1% NaCl, 0.01% G418, and 0.005% NAT.

Further, the primer sequences adopted in the PCR reaction in the fifth step are SEQ ID No. 5-6, SEQ ID No. 9-10 and SEQ ID No. 13-14.

By adopting the technical scheme, compared with the prior art, the invention has the following technical effects:

the invention uses CRISPR/Cas9 gene editing technology, uses strain SEB5 capable of efficiently utilizing xylose as an initial strain, replaces the promoters of genes (HAA1 and TYE7) and functional genes (FDH1) for coding target transcription factors with the promoters of UBI4 with higher expression amount and stability under the stress of various typical inhibitors, and simultaneously over-expresses the genes HAA1, TYE7 and FDH1 to obtain strain SEB 16. The SEB16 strain has strong acetic acid and furfural tolerance, the ethanol yield reaches 85% of the theoretical yield, and the SEB16 strain has important significance for producing fuel ethanol by utilizing lignocellulose raw materials.

Drawings

FIG. 1 shows the results of fermentation of strains SEB5 and SEB16 in the absence of inhibitors in an example of the present invention;

FIG. 2 shows the fermentation results of strains SEB5 and SEB16 under acetic acid stress in one example of the present invention;

FIG. 3 shows the fermentation results of strains SEB5 and SEB16 under furfural stress in an example of the present invention;

FIG. 4 is the fermentation results of strains SEB5 and SEB16 under mixed acetic acid and furfural stress in one example of the invention;

FIG. 5 shows the pre-saccharification-simultaneous saccharification and fermentation results of strains SEB5 and SEB16 using pretreated straw materials according to an embodiment of the present invention; wherein: panel A shows an inoculum size of 0.05 g-stem cells/100 g-pretreated material; panel B shows an inoculum size of 0.5 g-stem cells/100 g-pretreated material.

Detailed Description

The invention provides an acetic acid and furfural resistant fermentation strain which is SEB16 and is classified and named as Saccharomyces cerevisiae with the preservation number of CGMCC No.19589, the preservation date of 20 days 04-2020, the preservation unit is the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit address is No. 3 of West Lu No.1 of the sunward area of Beijing.

The present invention will be described in detail and specifically with reference to the following examples and drawings so as to provide a better understanding of the invention, but the following examples do not limit the scope of the invention.

The materials used in the following examples are as follows:

(1) culture medium

The media used are shown in Table 1. If the culture medium is a solid medium, 1.5% agar powder is added before sterilization. The sterilization condition is 121 deg.C, 15 min. All antibiotics are added after being cooled to 50-60 ℃ after the culture medium is sterilized.

TABLE 1 Medium composition

(2) Plasmid, strain and primer

Taking a strain SEB5 (strain preservation number: CGMCC No.11325) capable of efficiently utilizing xylose as an original strain, and simultaneously performing over-expression on genes HAA1, TYE7 and FDH1 by a promoter replacement method to obtain a strain SEB16, wherein plasmids and strains are shown in Table 2; primers and fragments used for strain transformation are shown in Table 3; the desired homologous wall sequences and 20bp target sequences upstream of the PAM site (NGG) for constructing gRNA plasmids are shown in table 4.

TABLE 2 plasmids and Strain information used in the construction of Strain SEB16

TABLE 3 primers and fragments required for transformation of strains

Note: RF: repair fragment, V_p: verifying the primer; f: an upstream primer; r: a downstream primer; underlining: homologous arm

TABLE 4 homology arm sequences required for the construction of gRNAs and 20bp target sequences upstream of the PAM site (NGG)

Note: n20: a target sequence of 20bp upstream of a PAM site (NGG) contained in the gRNA; underlining: PAM locus (NGG)

Example 1

The embodiment provides a method for constructing an acetic acid and furfural resistant fermentation strain SEB16, which comprises the following steps:

step one, amplification of the UBI4 promoter (repair fragment)

A UBI4 promoter (namely, a repair fragment) was amplified by PCR using genomic DNA of the strain SEB5 as a template (the base sequence is shown as SEQ ID No.22 in Table 5); the PCR reaction system and reaction conditions are shown in Table 6. RF F/RF R is a primer of UBI4 containing a homology arm, and the sequence is shown in Table 3. The PCR product was electrophoresed (100V, 30min) using 1% agarose gel, stained in EB for 30min, and observed under UV light for the presence of a target band. The PCR product was stored in a refrigerator at-20 ℃ for further use.

TABLE 5 UBI4 promoter Gene sequence Listing

TABLE 6 PCR amplification of UBI4 promoter (repair fragment)

Step two, constructing double-chain gRNA fragment

The nucleotide sequence of the promoter region of the target gene was searched on the Saccharomyces Genome Database (SGD https:// www.yeastgenome.org /) website. The sequence was imported into the E-CRISP (http:// www.e-CRISP. org/E-CRISP /) website to find the target sequence of 20bp upstream of the PAM site (NGG) of the target fragment (Table 4). gRNA fragments containing upstream and downstream 50bp homology arms and 20bp target sequences (total 120bp) were artificially synthesized. After synthesis, two complementary sequence solutions were diluted to 100 μ M with sterile water in a volume ratio of 1: 1, and thermally shocking the mixture on a PCR instrument for 5min at 95 ℃ to obtain double-chain gRNA fragments.

Step three, amplifying the gRNA linear skeleton

The linear backbone of gRNA was amplified using pMEL13 plasmid as template, and the PCR reaction system and reaction conditions are shown in table 7. The PCR product was electrophoresed (100V, 30min) using 1% agarose gel, stained in EB for 30min, and observed under UV light for the presence of a target band. The PCR product was stored in a refrigerator at-20 ℃ for further use.

TABLE 7 PCR amplification of gRNA Linear frameworks

Step four, purifying the repair fragment (UBI4 promoter) and gRNA linear framework

Because the product obtained after PCR amplification contains the template, DNA polymerase and corresponding buffer solution, the method utilizes

The PCR Purification Kit was purified. The specific method comprises the following steps: and (3) adding a binding buffer solution with the volume 5 times that of a PCR product of 50-100 mu L, uniformly mixing, adding into a centrifugal column, standing at room temperature for 1min, centrifuging at 10000 Xg for 1min, and discarding an effluent liquid. Adding 650 μ L of washing buffer, centrifuging at 10000 Xg for 1min, and discarding the effluent. Centrifugation at 10000 Xg for 2min completely removed residual wash buffer. The column was placed in a clean centrifuge tube, and 30-50 μ L of sterile water was added to the center of the column (to increase the purification yield,preheating sterilized water at 60 deg.C), standing at room temperature for 1min, centrifuging at 10000 Xg for 1min, and eluting DNA. The resulting DNA was stored at-20 ℃ or placed on ice for future use.

Step five, digesting the gRNA linear skeleton template

The digestion system and reaction conditions are shown in Table 8. The Quick cut Dpn1 added in the reaction system is determined according to the template amount of pMEL13 added when the linear framework of gRNA is amplified. The linear framework of gRNA is obtained after purification.

TABLE 8 gRNA Linear backbone template digestion System

Step six, Gibson links gRNA fragments and gRNA linear frameworks

(1) The resulting gRNA fragments were ligated to the gRNA linear backbone by Gibson ligation, as shown in table 9. The gRNA (120bp) and pMEL13 linear skeletons are 5: 1 is added to the linking system. mu.L of the reaction system was ligated on a PCR instrument (50 ℃, 15 min).

(2) mu.L or the whole reaction solution was used for E.coli transformation.

(3) After transformation, the cells were first plated on LB-Amp plates. After the strain grows out, the strain is streaked on an LB-Kana plate and cultured for 12 hours at 37 ℃. A small amount of the bacteria are picked up by toothpicks and transferred to a test tube containing 5mL of LB + Kana liquid culture medium for culture for 12-16 h (140rpm, 37 ℃).

(4) Collecting thalli, and extracting gRNA plasmid from escherichia coli by using a SanPrep column type plasmid DNA small extraction kit.

(5) The gRNA plasmids were electrophoresed (100V, 30min) on a 1% agarose gel, stained in EB for 30min, and observed under an ultraviolet lamp for the presence of a target band. Sequencing and confirming the obtained gRNA plasmid to obtain the gRNA plasmid with correct sequence.

TABLE 9 Gibson-Linked reaction System

Step seven, Cas9 plasmid extraction

Coli strains containing Cas9 plasmid were taken and activated on LB + NAT solid plates in a constant temperature incubator (37 ℃, 24 h). Cells are picked by toothpicks and transferred into a test tube containing 5mL of LB + NAT liquid culture medium for culture for 12-16 h (140rpm, 37 ℃). The cells were collected and the Cas9 plasmid was extracted from escherichia coli using a SanPrep column plasmid DNA miniprep extraction kit. Cas9 plasmid was electrophoresed on a 1% agarose gel (100V, 30min), stained in EB for 30min, and the bands were observed under an ultraviolet lamp to confirm whether the extraction was successful.

Step eight, transferring the Cas9 plasmid into a target saccharomyces cerevisiae strain

(1) The target strain was activated for 24h on a 2% YPD solid plate, and the cells picked with toothpick were transferred to a tube containing 5mL of 2% YPD liquid medium for 16h (160rpm, 30 ℃ C.).

(2) The test tube is shaken uniformly on a super clean bench, 2-3 mL of the test tube is taken to be placed into a 500-mL conical flask containing 300mL of 2% YPD liquid culture medium, and the test tube is cultured for 2-3 h (180rpm, 29 ℃) on a shaking table.

(3) Samples were taken every 1 hour, the culture solution was centrifuged at 8,000 Xg, the cells were dispersed in 0.05mM EDTA solution, and the absorbance (OD) at 600nm was measured₆₀₀). To be OD₆₀₀When the concentration of the microorganism reaches 0.2-0.3, centrifuging at 8,000 Xg for 2min to collect the microorganism, washing the microorganism with sterilized water for 2 times, and centrifuging to remove the supernatant.

(4) Then, the cells were dispersed in 0.6mL of sterilized water and placed on ice for use. Taking prepared salmon sperm DNA, heating in boiling water bath for 5min, and immediately placing on ice for use. A sterilized 1.5mL centrifuge tube was taken several times, and 60% PEG4000 (115. mu.L), 4M lithium acetate solution (5. mu.L) and salmon sperm DNA (10. mu.L) were added thereto, respectively. Cas9 plasmid (100ng) was added to the experimental group and an equal amount of sterile water was added to the control group, which was mixed by vortexing on a vortex shaker.

(5) Adding 50 mu L of host cells into the centrifuge tube after mixing, and mixing by slight vortex oscillation. The mixture is heated at 42 ℃ for 40min, and taken out and inverted for several times every 20 min. Centrifuge at 8,000 Xg for 2min and discard the transformation solution.

(6) Cells were washed 2 times with sterile water, then 1mL of 2% YPD broth was added to the centrifuge tube and incubated on a shaker for 4h (160rpm, 30 ℃). The culture medium was centrifuged at 8,000 Xg for 2min and washed 2 times with sterile water.

(7) Adding 1mL of sterilized water-dispersed bacteria, taking 100 μ L of the bacterial suspension, coating the bacterial suspension on a 2% YPD plate containing 0.005% of NAT, and culturing in a constant-temperature incubator at 30 ℃ for 1-2 days.

Step nine, PCR verification of Cas9 plasmid transformed colonies

Transformants growing on the 2% YPD + NAT plate were selected, streaked on the 2% YPD + NAT solid plate, cultured for 24h, and colony PCR verified. The specific method comprises the following steps:

(1) colonies on 2% YPD + NAT plates were picked into 1.5mL centrifuge tubes containing 95. mu.L of 1% SDS and 5. mu.L of 4M lithium acetate solution, and heat-shocked at 75 ℃ for 10min with vortex shaking. Add 300. mu.L of absolute ethanol to the centrifuge tube and vortex. Centrifuging at 13000rpm for 3min at room temperature, discarding the supernatant, opening the centrifuge tube cover, and drying in an incubator at 37 ℃.

(2) Add 100. mu.L of sterile water to the centrifuge tube, vortex thoroughly and centrifuge at 13000rpm for 1min at room temperature.

(3) The above clear solution was used as a template for PCR verification, and the PCR reaction system and reaction conditions were as shown in Table 10.

(4) The PCR product was electrophoresed (100V, 30min) using 1% agarose gel, stained in EB for 30min, and observed under UV light for the presence of a target band.

TABLE 10 Cas9 plasmid validation PCR System

Step ten, yeast transformation

Transformation of yeast strains is similar to the transformation of Cas9 plasmid, except that it contains antibiotics and a transformation system. The specific method comprises the following steps:

(1) saccharomyces cerevisiae containing Cas9 plasmid was activated on 2% YPD + NAT solid plates for 24h, and cells picked with toothpick were transferred to tubes containing 5mL of 2% YPD + NAT liquid medium for 16h (160rpm, 30 ℃).

(2) The test tube is shaken uniformly on a super clean bench, 2-3 mL of the test tube is taken to be placed into a 500-mL conical flask containing 300mL of 2% YPD + NAT liquid culture medium, and the test tube is cultured for 2-3 h (180rpm, 29 ℃) on a shaking table. Samples were taken every 1 hour, centrifuged at 8,000 Xg for 2min, the culture was discarded, the cells were dispersed in 0.05mM EDTA solution, and OD was measured₆₀₀The value is obtained. To be OD₆₀₀When the concentration of the microorganism reaches 0.2-0.3, the microorganism is collected by centrifugation at 8,000 Xg for 2min, washed with sterile water for 2 times, and then dispersed with 0.6mL of sterile water and placed on ice for later use. Taking prepared salmon sperm DNA, heating in boiling water bath for 5min, and immediately placing on ice for use.

(3) A sterilized 1.5mL centrifuge tube was taken several times, to which 60% PEG4000 (240. mu.L), 4M lithium acetate (9. mu.L) and salmon sperm DNA (25. mu.L) were added, respectively. gRNA plasmids (300-600 ng) and repair fragments (800-1600 ng) are added into an experimental group, and the same amount of sterilized water is added into a control group, and the mixture is shaken and uniformly mixed on a vortex shaker. Add 50. mu.L of host cells to the well mixed tubes and mix by gentle shaking. The mixture is thermally shocked at 42 ℃ for 40min and taken out and inverted up and down for several times every 20 min. Centrifuge at 8,000 Xg for 2min and discard the transformation solution.

(4) The cells were washed 2-3 times with sterile water, 1mL of 2% YPD liquid medium was added to the centrifuge tube, and cultured for 4h (160rpm, 30 ℃) on a shaker. Centrifuge at 8,000 Xg for 2min and discard the culture. After washing with sterile water 2 times, the cells were dispersed in 150. mu.L of sterile water. All the cells were spread on a 2% YPD plate containing 0.005% NAT and 0.01% G418, and cultured in a constant temperature incubator at 30 ℃ for 2 days.

Eleventh step, PCR verification of target strain transformed colony

Transformants growing on 2% YPD + NAT + G418 plates were selected, streaked on 2% YPD + NAT + G418 solid plates, cultured for 24h, and colony PCR verified. The fragments obtained by replacing the promoter of the target gene were amplified using the verification primers for the target gene (Table 3). The PCR reaction system and reaction conditions are shown in Table 10, in which the annealing temperature and the fragment extension time are determined by the corresponding verification primers.

Step twelve, plasmid removal

Transformants were picked for confirmation by colony PCR and the Cas9 plasmid and gRNA plasmid were removed. The specific method comprises the following steps:

(1) the correct transformants were picked and streaked onto 2% YPD solid plates (30 ℃ C., 24 h).

(2) Colonies on 2% YPD solid plates were picked and grown in tubes containing 5mL of liquid medium (30 ℃ C., 16 h).

(3) 1mL of the bacterial solution was aspirated, centrifuged at 8000 Xg for 2min, and the supernatant was discarded. Gradient dilution with sterile Water 10⁵Taking 100 mu L of bacterial liquid for coating, and culturing in a constant temperature incubator at 30 ℃ for 1-2 d.

(4) Single colonies were picked and spotted on plates of 2% YPD, 2% YPD + NAT and 2% YPD + G418, respectively, and cultured in a 30 ℃ incubator for 1-2 days. If the colony can only grow on 2% YPD, it is confirmed that the plasmid of the colony has been removed.

Verification examples

In the embodiment, the fermentation performance of the strain SEB16 under various stress conditions is verified by taking a starting strain SEB5 as a control group. The specific test procedures and results are as follows:

evaluation of fermentation in batches

The target strain was inoculated into 2% YPD solid medium and activated in an incubator at 30 ℃ for 24 hours. The inoculated cells were inoculated into a 500-mL Erlenmeyer flask containing 100mL of 5% YPD medium, and shake-cultured for 16 hours (30 ℃ C., 160rpm) using a shaker. The preculture solution was centrifuged at 8000 Xg for 2min at 4 ℃ and then wet cells were collected and inoculated into a 300-mL Erlenmeyer flask containing 100mL of 10% YPDX medium at an initial cell concentration of 5g dry cells/L. Adding the target inhibitor into sterilized and subpackaged culture medium according to the concentration requirement, placing the conical flask into a constant-temperature water bath kettle, and fermenting under magnetic stirring (35 ℃, 200 rpm). Batch fermentation evaluations included no inhibitors, acetic acid (Aa, 40mM), furfural (Fur, 20mM), and mixed acetic acid and furfural (Aa _ Fur, 40+20mM), with timed sampling for analysis of residual glucose and xylose, ethanol, xylitol, and glycerol concentrations, with results as shown in figures 1-4.

As shown in FIG. 1, when fermented for 18h without inhibitor, the strain SEB5 has 8.03g/L of residual xylose, 1.65g/L/h of ethanol production rate and 0.31g/g of ethanol yield to total sugar; the residual xylose content of the strain SEB16 was 1.47g/L, the ethanol production rate was 1.82g/L/h, and the ethanol yield was 0.36 g/g-total sugar. Compared with SEB5, the xylose consumption rate of strain SEB16 is increased by 12.86%, and the ethanol yield is increased by 16.13%. This shows that the fermentation performance of the strain SEB16 constructed by simultaneously highly expressing HAA1, TYE7 and FDH1 is obviously improved under the condition of no inhibitor.

As shown in FIG. 2, when fermented for 24h under the stress of acetic acid, the residual xylose of the strain SEB5 was 15.47g/L, the ethanol production rate was 1.24g/L/h, and the ethanol yield was 0.33 g/g-total sugar; the residual xylose content of the strain SEB16 was 5.50g/L, the ethanol production rate was 1.42g/L/h, and the ethanol yield was 0.37 g/g-total sugar. Compared with SEB5, the xylose consumption rate of strain SEB16 is improved by 49.18%, and the ethanol yield is improved by 12.12%. This shows that the fermentation performance of the strain SEB16 constructed by simultaneously highly expressing HAA1, TYE7 and FDH1 is remarkably improved under the stress of acetic acid.

As shown in FIG. 3, when fermented for 24 hours under the stress of furfural, the residual xylose content of the strain SEB5 was 9.02g/L, the ethanol production rate was 1.31g/L/h, and the ethanol yield was 0.34 g/g-total sugar; the residual xylose content of the strain SEB16 was 3.97g/L, the ethanol production rate was 1.39g/L/h, and the ethanol yield was 0.36 g/g-total sugar. Compared with SEB5, the xylose consumption rate of the strain SEB16 is increased by 16.41%, and the ethanol yield is increased by 5.88%. This shows that the fermentation performance of the strain SEB16 constructed by simultaneously highly expressing HAA1, TYE7 and FDH1 is improved under the stress of furfural.

As shown in FIG. 4, when fermented for 24 hours under the stress of mixed acetic acid and furfural, the residual xylose content of the strain SEB5 was 18.19g/L, the ethanol production rate was 1.25g/L/h, and the ethanol yield was 0.33 g/g-total sugar; the residual xylose content of the strain SEB16 was 6.79g/L, the ethanol production rate was 1.38g/L/h, and the ethanol yield was 0.36 g/g-total sugar. Compared with SEB5, the xylose consumption rate of strain SEB16 is improved by 53.26%, and the ethanol yield is improved by 9.10%. This shows that the fermentation performance of the strain SEB16 constructed by simultaneously highly expressing HAA1, TYE7 and FDH1 is obviously improved under the stress of mixed acetic acid and furfural.

Evaluation of straw material fermentation

In a synthetic culture medium, compared with SEB5, the fermentation performance of the strain SEB16 under the stress of acetic acid and furfural is remarkably improved, and straw materials are further selected for fermentation evaluation. And (3) evaluating the fermentation and the inhibitor tolerance capability of the target strain by adopting pre-saccharification synchronous saccharification and fermentation. The composition of the straw material used is shown in table 11. The material solids content was adjusted to 20% with PBS buffer pH 5, CTec3 was added at 30FPU/(g of cellulose) and penicillin concentration was 100 mg/kg. Mixing, packaging into 500-mL conical bottles, packaging 120g per bottle, and pre-saccharifying at 50 deg.C and 200rpm for 11 h. Pre-saccharification, mixing, adjusting pH to 5.0, and packaging into 300mL conical bottles. 0.05g or 0.5g (dry weight) of the target cell was inoculated into the pre-saccharified material using a predetermined volume of PBS. Each vial contained 100g of the total mass of the batch and PBS (2mL or 6 mL). Carrying out simultaneous saccharification and fermentation under the conditions of 200rpm and 35 ℃ water bath.

3mL of mash was withdrawn at pre-saccharification 0 and 11h, and

fermentation

24, 48, 72, 96 and 120h, respectively. A certain amount of the mixture was weighed and diluted, and the concentrations of ethanol, reducing sugar (or total sugar), xylitol and glycerol were measured after filtration through a 0.22 μm filter membrane, and the results are shown in FIG. 5. The ethanol yield based on total sugars was calculated as shown in (1) and (2).

Note: a is HPLC or GC data, mg/L, C is g/(kg wet material), ethanol yield is g/(g total sugar), concentration of ethanol and sugar is g/(kg wet material)

TABLE 11 composition of pretreated straw Material

As shown in FIG. 5, the glucose and xylose contents were 57.12. + -. 3.30g/kg and 8.00. + -. 1.75g/kg, respectively, 11h after the pre-saccharification. Based on the total content of glucose and xylose in the pretreated straw material, the saccharification efficiency of glucose is 60.84% and the saccharification efficiency of xylose is 54.02% when the straw is saccharified for 11 hours.

Compared with the high inoculation amount, the ethanol concentration accumulation is higher when the fermentation is carried out for 120h with the low inoculation amount. When the SEB16 is fermented for 120 hours, the ethanol concentration is 47.10g/kg under the condition of low inoculation amount, and the ethanol yield is 0.433 (g-ethanol/g-total sugar); the ethanol concentration was 43.47g/kg with a high inoculum size and the ethanol yield was 0.400 (g-ethanol/g-total sugars). Compared with SEB5, the ethanol yield of SEB16 based on total sugars was improved by 5.85% and 5.46% under low and high inoculation conditions, respectively. Fermentation results in a synthetic culture medium are synthesized, and the bacterial strain SEB16 is remarkably improved in acetic acid and furfural tolerance and has certain industrial application potential.

The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications or alterations to this practice will occur to those skilled in the art and are intended to be within the scope of this invention. Accordingly, equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered by the present invention.

Reference to the literature

[1]Zhang G C,Kong I I,Kim H,et al.Construction of a quadruple auxotrophic mutant of an industrial polyploid Saccharomyces cerevisiae strain by using RNA-guided Cas9 nuclease[J].Applied and Environmental Microbiology,2014, 80(24):7694-7701.

[2]Mans R,van Rossum H M,Wijsman M,et al.CRISPR/Cas9:a molecular swiss army knife for simultaneous introduction of multiple genetic modifications in Saccharomyces cerevisiae[J].FEMS Yeast Research,2015,15(2):fov004。

Sequence listing

<110> China petrochemical Co., Ltd

SINOPEC SHANGHAI ENGINEERING Co.,Ltd.

SICHUAN University

<120> acetic acid and furfural resistant fermentation strain and construction method thereof

<160> 22

<170> SIPOSequenceListing 1.0

<210> 1

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 1

cttcaaataa cccgttca 18

<210> 2

<211> 18

<212> DNA

<213> Artificial Sequence

<400> 2

aatctattag ttaaagta 18

<210> 3

<211> 58

<212> DNA

<213> Artificial Sequence

<400> 3

agttcacgtt ttataagtcc tttccgttct ctttatcagt cttcaaataa cccgttca 58

<210> 4

<211> 58

<212> DNA

<213> Artificial Sequence

<400> 4

acctctcaca ggcatacttt atgccattta tcaagaccat aatctattag ttaaagta 58

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

acagcaccag cacttgattg 20

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 6

aagcggttga tctgtatgat 20

<210> 7

<211> 78

<212> DNA

<213> Artificial Sequence

<400> 7

ttggaccaac agcccaagcg gcttatccct tttctttttt tcccttataa tcgggaattt 60

cttcaaataa cccgttca 78

<210> 8

<211> 78

<212> DNA

<213> Artificial Sequence

<400> 8

ctgctcttca gcatgcttac caccttcgta aagaaccagc aaaacctttc ccttcgacat 60

aatctattag ttaaagta 78

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 9

gagaagctcc gtaggagacc gt 22

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 10

tccctgtcta ccgttgaggt 20

<210> 11

<211> 75

<212> DNA

<213> Artificial Sequence

<400> 11

cttaccctag tagtaattca ttgtgcccac gtacgaaccg tacaatggga ttctgccctt 60

caaataaccc gttca 75

<210> 12

<211> 78

<212> DNA

<213> Artificial Sequence

<400> 12

ttcaggttta attaaagtag tttcgctaga tctaacattt ctgtctaaaa tagagttcat 60

aatctattag ttaaagta 78

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 13

ccttctggag tgggattgag 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 14

gatgcagaaa gaactgacga 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 15

tcacccttac gttgtttgaa 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 16

aggggacgtt atcactcttc 20

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence

<400> 17

gttttagagc tagaaatagc aagttaaaat aaggctagtc 40

<210> 18

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 18

gatcatttat ctttcactgc ggagaag 27

<210> 19

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 19

aagcttttcc aaggaaaaga ggg 23

<210> 20

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 20

gtatcggtgc cttcctagta agg 23

<210> 21

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 21

ggcgaactgt gaacgtgcgc agg 23

<210> 22

<211> 590

<212> DNA

<213> Artificial Sequence

<400> 22

cttcaaataa cccgttcaga tgattttaga gtcttccttg accaatcatc ttattcgcgc 60

agggcaaccc atgataggaa atgtcccttt aaacgaactg tgggaaatcc tgcaaaagtg 120

atgaaagtga cgttttatga aaagaaagtg aaaaagttct tgtttgacaa tattctattc 180

cgaaaagtct ttgtggtcag tattgtttct agaacgttct agaataatcc tggataaacc 240

aatttcggta ccaaaaaaaa aaatagccgc ccagtggagc atcacacagc cgtacatccg 300

gccacacacg gtggttaccc cacttcgttt cttttttcag gggcgatgcc acttatcagt 360

tgtttttaga attcagtgtc atttgagggc ggttcctcct tttgggggta tatatagaga 420

ggctccgggt tttgccacct ttgaattcgc ctgcttatct ttcttcttcc gaaagtgcta 480

cttcagaaag agcaagaact gtacggataa ggataagtat atcttctatc tactacaata 540

cgacaagaac tctcgaactc tccctcccac tttactttaa ctaatagatt 590

Claims

1. A fermentation strain resistant to acetic acid and furfural is characterized by being SEB16, being classified and named as Saccharomyces cerevisiae with the preservation number of CGMCC No.19589, the preservation date of 20 days 04-2020, the preservation unit being the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation unit being No. 3 of West Lu No.1 of Beijing Kogyo-oriented Anthoku-Showa.

2. A method for constructing a fermentation strain as claimed in claim 1, wherein promoters of HAA1, TYE7 and FDH1 genes of an original strain SEB5 are replaced by UBI4 promoters through a CRISPR/Cas9 gene editing technology, so that the acetic acid and furfural resistant fermentation strain SEB16 is constructed.

3. The method for constructing a fermentation strain according to claim 2, comprising the steps of:

step one, amplification of repair fragments: using genome DNA of the strain SEB5 as a template, amplifying a UBI4 promoter by PCR and purifying;

step two, constructing a double-chain gRNA fragment and amplifying a gRNA linear framework: determining PAM sites of the HAA1, TYE7 and FDH1 gene promoters, and constructing a double-chain gRNA fragment; carrying out PCR amplification by taking pMEL13 plasmid as a template and primers of SEQ ID No. 17-18 to obtain a gRNA linear framework and purifying the gRNA linear framework;

connecting the gRNA fragment and the digested gRNA linear skeleton, and then converting to obtain a gRNA plasmid;

and fifthly, transferring the gRNA plasmid and the repair fragment into the Saccharomyces cerevisiae containing the Cas9 plasmid, then performing coating plate culture, screening, and verifying PCR reaction to obtain a bacterial colony of the fermentation strain SEB16 resistant to acetic acid and furfural.

4. The method for constructing the fermentation strain according to claim 3, further comprising removing the Cas9 plasmid and the gRNA plasmid from the colony of the fermentation strain SEB 16.

5. The method for constructing the fermentation strain according to claim 3, wherein the sequence of the primer used for PCR amplification in the step one is SEQ ID No. 1-2.

6. The method of claim 3 wherein the sequences of the homology arms required to construct the double-stranded gRNA fragments are:

tgR F：TGCGCATGTTTCGGCGTTCGAAACTTCTCCGCAGTGAAAGATAAATGATCN20GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAAC；

tgR R：GTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAACN20GATCATTTATCTTTCACTGCGGAGAAGTTTCGAACGCCGAAACATGCGCA。

7. the method for constructing a fermentation strain according to claim 3, wherein the sequences of the PAM site of the HAA1, TYE7 and FDH1 gene promoters are SEQ ID No.19, SEQ ID No.20 and SEQ ID No.21, respectively.

8. The method of claim 3, wherein the gRNA fragment and the gRNA linear backbone are ligated by Gibson ligation in step three; the gRNA fragment and the gRNA linear framework are mixed according to a mass ratio of 5: 1 to make a connection.

9. The method for constructing the fermentation strain according to claim 3, wherein the primer sequence adopted in the PCR reaction in the fourth step is SEQ ID No. 15-16.

10. The method for constructing the fermentation strain according to claim 3, wherein primer sequences adopted in the PCR reaction in the fifth step are SEQ ID Nos. 5-6, 9-10 and 13-14.