CN112315970B - Application of LncRNA inhibitor in preparation of weight-reducing medicine - Google Patents

Abstract

The invention discloses an application of an LncRNA inhibitor in preparation of a weight-losing medicine, and the LncRNA inhibitor can obviously reduce the increase of body weight and assist in treating breast cancer caused by obesity. The invention has the advantages of scientific and reasonable raw materials, simple preparation process, lower cost and better adjuvant therapy effect.

Description

Application of LncRNA inhibitor in preparation of weight-reducing medicine

(I) technical field

The invention relates to an application of an LncRNA inhibitor in preparing a weight-reducing medicine.

(II) background of the invention

With the rapid development of socioeconomic, the incidence of breast cancer in China increases year by year and shows a trend of youthfulness. Like other countries, breast cancer is the first incidence of malignant tumors in many women of our country. Among the new cases of breast cancer diagnosis worldwide, our country accounts for 12.2%. Investigation shows that 27.24 thousands of new breast cancer diagnosis cases account for 15% of all malignant tumors and 2.07 thousands of deaths in 2015 years in China seriously threaten the physical health and life quality of women. Therefore, effective treatment of breast cancer is of great social significance.

Obesity is a chronic metabolic disease caused by excessive fat accumulation or abnormal distribution in vivo, and the normal range of Chinese adult Body Mass Index (BMI) is 18.5kg/m according to Chinese guidelines for preventing and controlling overweight and obesity of adults²-23.9 kg/m²，<18.5kg/m²24.0-27.9kg/m for too low body weight²Is overweight, not less than 28kg/m²It is obese. The 'global malnutrition report' in 2019 shows that over 3 hundred million overweight and obese people exist in China, the incidence of various metabolic diseases induced by obesity is high, and the excessive obesity can promote the occurrence of cancers. The International Journal of Cancer (International Journal of Cancer) has fully and deeply described the relationship between overweight/obesity and various malignant tumors, and when BMI exceeds the overweight criteria, the overall malignant tumor occursThe risk begins to increase significantly. After BMI exceeded the overweight criteria, the risk of developing breast cancer increased by 11% for every 5 units increase. And in obese female breast cancer patients, high BMI is associated with poorer long-term prognosis.

Obesity can destroy the homeostasis of a human body, and the fat factors continuously attack the immune and endocrine systems of the human body in the body, which inevitably influences the metabolism of the body for a long time. Generally, the function of islet cells of obese people is damaged, and blood sugar cannot be effectively regulated in time, so that hyperglycemia, hyperlipidemia and hypertension are caused.

Lncrnas are a class of RNAs greater than 200 nucleotides in length that lack the ability to encode proteins, lacking an identifiable open reading frame. Although lncRNA was originally thought to be "noise" of genome transcription and not biologically functional, many studies in recent years have shown that lncRNA regulates many vital activities such as cell cycle, differentiation and epigenetics of cells by regulating the expression of proteins, DNA, RNA. Thus, cancer is triggered by aberrant expression of lncRNA, which may be a potential biomarker in tumor cells. More and more researches show that lncRNA plays an important role in the generation and development processes of cancer.

Disclosure of the invention

The invention aims to provide an application of an LncRNA inhibitor in preparing a weight-losing medicine, the LncRNA inhibitor can obviously reduce the weight increase, and has certain auxiliary effect on the treatment of breast cancer caused by obesity.

The technical scheme adopted by the invention is as follows:

the invention provides an application of an LncRNA inhibitor in preparing a weight-reducing medicine, wherein the LncRNA inhibitor has a nucleotide sequence as follows: 5'-GACCAGTGTTAACTGCTTCCTGATGACAG-3' (SEQ ID NO. 1).

Further, the medicine is a medicine for inhibiting the expression of LncRNALOC339535, and the LncRNALOC339535 nucleotide sequence is (SEQ ID NO. 2):

TGGAATTCAAGCTGTGGGTGAGAAGCTCTCTAGCAGGGACTCTGACCTTAT GGAGGATCGCTGTTTCCCCCATTTTTCCTTTTCACCCAAAAAAGTCCTGCTTCTC TCACCCTTCAAACAGCCTGTGAGCCTAAATTTTTGTGGCCATGGGACAGACAAG GACCCCGTCTTCAGCTGAACTAAGGAAAAGTCCTGCGACATCTTTGGTACGCAC TGTGGAGGCTCTACAAACAGCCATCAAACTCCAACCAGTCACCCAACCAGAGC CTCTGAGGATGGCCCCTTCTGCGGGGAACCCTTACATGGGCCTCTGACTGATGC TTCCCCAAAACAGTGCCCCCTGTCATCAGGAAGCAGTTAACACTGGTCTTCATT CTTACGCTTATCCTTATTCTAACAGCAGTTATATGTACTTCTTTAGACGGGGGAAT AAGACAGCCAGGTGGGAGGGGGTCTCTGGAAAACTCCATCTGGCCTGTGCACT AGGGTGGAACCTCAGGAAGTTGATGACATTTGTAGCTGGGAGCAGCCTGGCCC CTCCTCTTCCTGTGTGGAACCTGAAATTCCACCGGCTTGGCAGGAAGCGCTCTA GCAGGGACTCCGGCTTTGCAGAGCATCCCTGTTTCCCCGTTTTTCCCTTTTCACC CAATAAAACCCTGCTTCACTCACCCTTCAAACCATCTGCAAGCCTAAATTTTTGT GGCTGTGGGACGGACAAAGATGCCTTTAGCTGACTGAGGAAAAGTCCTGCAAC ACAGGTATCACTGCACATTTATAATATTGTTTCTCTGTTTTAAACCTTGTATAAATA GGAAAATATTGTATATAATCTCAAGCAGATTGTTTTCTTTTGAAAAGTATTCATATA TGTTAAAGATGTAGTTCTAGTTCATTCATTTTCTCTGTTTTGACTCTTTTATACATA TACTACAGCTCATTTATCCATTTTCCTACTGTTGCAACATAGATTGCTTATAATTCT TCTAATTACTAACAATGCTGGTATGAAATTGTTGTGTATATCTCTGGTAGATATGTG TTATTTCTTTTTTGCAATGCTAGATTATAATTATTTGTCTAAGGTGGAGATTACCAG GGTAGACTCGCTCTGGCCGTATGTAATGATGTCTGTGGCTACATAACCTGCCAAC ACTTAGTCTTATCACACATTTTATTTTAAAATCAATATGTAAAAAATACTAATTTAC TTGGTAGTAATTTAAATTTTTCTGATTATTACTGAGGTTGAATATGTTTTCATATGT TTACTGAATATTCCTGTTAATTTTCTCATGAATTTCAGTTAATGTTTCTGTTGATTT TATTAATTTGTAGTGGTTTTGAAACATATTCTAGAAACCAATATTTTGTCTGTTGTA TGTGTTACAAATATATTTATTTTGTATAGCTTCTTCATATTTAGTACTTTTACAATTT TAACAGTAAAATTAGTTTCATGTTTTATAGCTATAATTATTATAACTTTTAAATAAAT ATTTCCTCAATTAAAATAAAAATGCATTATCCTTAAAAAAAAAAA。

furthermore, the medicine is a medicine for adjuvant therapy of breast cancer caused by obesity.

Further, the medicine also comprises a pharmaceutically usable carrier, and the carrier is one or more of cholesterol, liposome and nano-particles.

The medicine is administrated in an injection mode, the injection administration mode comprises intramuscular injection, intravenous injection and subcutaneous injection, and the content of the LncRNA inhibitor in the medicine is 1 mg/mL.

The prognosis of obese breast cancer patients is worse, the survival rate is lower, and LncRNALOC339535 is specifically expressed in triple-negative breast cancer, experiments show that LncRNALOC339535 can induce obesity of mice, and the weight increase of the mice can be obviously inhibited by injecting LncRNA inhibitor. The LncRNA inhibitor provided by the invention can inhibit the expression of LncRNALOC339535, and is further used for adjuvant therapy of breast cancer caused by obesity.

Compared with the prior art, the invention has the following beneficial effects: the LncRNA inhibitor can obviously reduce the weight gain and assist in treating the breast cancer caused by obesity. The invention has the advantages of scientific and reasonable raw materials, simple preparation process, lower cost and better adjuvant therapy effect.

(IV) description of the drawings

FIG. 1 shows that overexpression of LncRNALOC339535 promotes obesity.

Figure 2 shows that LncRNALOC339535 is highly expressed in obese breast cancer patients.

Fig. 3 shows the inhibition of body weight gain in mice by LncRNALOC339535 inhibitor.

(V) detailed description of the preferred embodiments

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

the wild type mouse species in the experimental animals used in the examples below was FVB; the transgenic mouse was constructed by knocking LncRNALOC339535 gene (SEQ ID NO.2) into FVB, a wild-type mouse, by Setarian Biotech. The amplification enzyme and reverse transcriptase used were purchased from Nanjing Novozam Biotech GmbH. All the reagents are analytical grade reagents. The fat content of the high-fat feed is 60 percent, and the high-fat feed is purchased from Shanghai Saibo biotech Co.

Example 1 construction of mouse obesity model

The transgenic mice into which the LncRNALOC339535 gene was knocked in were divided into two groups of 7 mice each, namely, a normal diet feeding group (ND-KI) and a high fat diet feeding group (HFD-KI). Wild type mice were also divided into two groups of 7 mice each, namely a normal diet feeding group (ND-WT) and a high fat diet feeding group (HFD-WT). After 10 weeks, the transgenic mice knocked in by LncRNALOC339535, which were high-fat fed, were observed to be most obese by weighing (a and B in fig. 1).

Example 2 glucose tolerance test

1. Mouse preparation: example 1 after 10 weeks of culture, 6 mice were selected per group, and the mice were placed in a clean cage at 5 pm before the experiment and fasted for 16 hours to 9 pm the following day, during which time the mice remained normally drinking water.

2. At 9 am the next day, the glucose tolerance test was started, and the weight of each mouse was weighed and marked with a marker at the root of the mouse tail to identify the mouse quickly during the test.

3. Determination of fasting basal blood glucose: taking out the mouse from the cage, slightly placing on an iron net, cutting off the tail end of the mouse by 1-2mm with scissors, slightly squeezing the mouse tail to enrich blood into one drop, measuring fasting blood glucose with a glucometer, determining the measured value as the blood glucose value of 0min, and operating as gently as possible to prevent the mouse from being excessively frightened.

4. After the mice were acclimated to 30 mm, the intraperitoneal injection of glucose was started.

5. Intraperitoneal injection of glucose: the mice were gently grabbed and injected with a 20% glucose solution (saline) by mass concentration using a standard 1mL syringe for intraperitoneal injection. The volume of the injection is determined to be 0.01mL/g according to the weight of the mouse, and timing is started from the time of finishing the injection; generally, the operation interval of each mouse is 1min, so that the blood sugar measurement of each mouse can be accurately finished according to the specified time.

6. And (3) measuring the blood glucose value of each mouse at each time point at 15min,30min,60min,90min and 120min according to the operation of the step 3.

7. After the experiment was completed, each cage of mice was supplemented with feed.

Glucose tolerance experiments confirmed the successful construction of the mouse obesity model, indicating that mice knock-in with LncRNALOC339535 have reduced tolerance to glucose (fig. 1, C).

Example 3: LncRNALOC339535 is highly expressed in obese breast cancer patients

In the embodiment, a tumor sample of a breast cancer patient is selected, 46 clinical samples of a tumor prevention and treatment center of Zhongshan university are collected, 10 of the clinical samples are tissues beside cancer, 36 of the clinical samples are tissues of breast cancer, and the samples are collected to obtain informed consent of the patient. Extracting total RNA by using Trizol reagent, preparing cDNA, and detecting the expression quantity of LncRNA by using real-time fluorescent quantitative PCR.

1. Extraction of Total RNA

A proper amount of tissue of a breast cancer patient is selected, 1ml of Trizol is added, and a tissue grinder is used for grinding. Centrifuging at 12000rpm for 10min at 4 deg.C, and collecting supernatant. 0.2ml of chloroform was added to 1ml of Trizol, and after shaking vigorously for 15 seconds, the mixture was allowed to stand at room temperature for 3 min. The mixture was centrifuged at 12000rpm for 10min at 4 ℃ to separate the sample into three layers, and the upper colorless aqueous phase was transferred to a new 1.5ml EP tube.

Adding isopropanol into a new tube, turning upside down, mixing, and standing at room temperature for 10 min. Centrifuging at 12000rpm for 10min at 4 deg.C, and removing supernatant. The precipitate was washed with 75% ethanol prepared by adding 1ml of RNase-free water. Centrifuging at 8000rpm for 5min at 4 deg.C, and discarding the supernatant. Air drying at room temperature for 20min, adding appropriate amount of RNase-free water according to RNA precipitation amount, and dissolving RNA.

2. The RNA was reverse transcribed to cDNA using the Novowed reverse transcription kit. The cDNA is used as a template, and a real-time fluorescent quantitative PCR kit is adopted to detect the expression quantity of LncRNALOC 339535.

LncRNALOC339535 detection primers (LOC 339535F, LOC 339535R) and internal reference primers (18S F, 18S R) were designed based on NCBI BLAST:

LOC339535 F：5'-AAAACAGTGCCCCCTGTCA-3'，

LOC339535 R：5'-GTTCCACCCTAGTGCACAGG-3'。

18S F：5’-GGACACGGACAGGATTGACA-3’，

18S R：5’-GACATCTAAGGGCATCACAG-3’。

TABLE 1 reaction System

Reagent	Volume (microliter)
		SYBR MIX	5
cDNA template	1
		Primer F	0.2
Primer R	0.2
		Double distilled water	3.6

The conditions of the fluorescent quantitative PCR are as follows: pre-denaturation at 95 ℃ for 30s, denaturation at 95 ℃ for 15s, annealing at 60 ℃ for 30s, and extension at 72 ℃ for 20s for 40 cycles, and then calculating and analyzing the melting curve and the cycle number Cq value. Balance each group according to Cq value of internal reference 18s, calculate 2^-ΔΔCqIndicating the relative abundance of LncRNALOC339535, all tissue samples were assayed for LncRNALOC339535 content and statistically analyzed. Expression levels of LncRNALOC339535 in breast cancer tumors were examined, and LncRNALOC339535 was highly expressed in obese breast cancer patients (fig. 2).

Example 4: LncRNA inhibitor inhibition of body weight gain assay

In this example, LncRNALOC339535 knock-in mice, which were fed with the high-fat diet of example 1 for 10 weeks, were used as subjects, and divided into 2 groups of 6 mice each. One group was a control group, no drug was administered: the other group was the experimental group and administered.

1. Mouse preparation: the number of mice per group was 6 and each mouse was weighed first.

2. And (3) injection administration: the mice were gently grabbed and a 1mL syringe was operated to inject LncRNA inhibitor (SEQ ID No.1, nanoparticles as vehicle, solvent as water) at the fat pad site. The administration was carried out at a dose of 0.2 mg/kg.

3. The mice were gently returned to their cages and each cage was supplemented with mouse chow (high fat) and water.

4. The medicine is administered again after every other day, and the steps 1, 2 and 3 are repeated. The administration was 7 times for a total of 14 days.

Fig. 3 is a graph showing the change in body weight of mice after the administration of LncRNA inhibitor, and the results show that the increase in body weight of mice can be significantly inhibited by the administration of LncRNA inhibitor.

The LncRNA inhibitor can obviously reduce the weight gain, and is suitable for the adjuvant therapy of breast cancer caused by obesity. The invention has the advantages of scientific and reasonable raw materials, simple preparation process, lower cost and better adjuvant therapy effect.

The above description of the embodiments is provided for understanding the method and the main idea of the present invention. It should be noted that modifications could be made to the invention by those skilled in the art without departing from the principle of the invention, and these modifications are also within the scope of the invention as defined in the appended claims.

Sequence listing

<110> Zhejiang university

<120> application of LncRNA inhibitor in preparation of weight-losing medicine

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 29

<212> DNA

<213> Unknown (Unknown)

<400> 1

gaccagtgtt aactgcttcc tgatgacag 29

<210> 2

<211> 1540

<212> DNA

<213> Unknown (Unknown)

<400> 2

tggaattcaa gctgtgggtg agaagctctc tagcagggac tctgacctta tggaggatcg 60

ctgtttcccc catttttcct tttcacccaa aaaagtcctg cttctctcac ccttcaaaca 120

gcctgtgagc ctaaattttt gtggccatgg gacagacaag gaccccgtct tcagctgaac 180

taaggaaaag tcctgcgaca tctttggtac gcactgtgga ggctctacaa acagccatca 240

aactccaacc agtcacccaa ccagagcctc tgaggatggc cccttctgcg gggaaccctt 300

acatgggcct ctgactgatg cttccccaaa acagtgcccc ctgtcatcag gaagcagtta 360

acactggtct tcattcttac gcttatcctt attctaacag cagttatatg tacttcttta 420

gacgggggaa taagacagcc aggtgggagg gggtctctgg aaaactccat ctggcctgtg 480

cactagggtg gaacctcagg aagttgatga catttgtagc tgggagcagc ctggcccctc 540

ctcttcctgt gtggaacctg aaattccacc ggcttggcag gaagcgctct agcagggact 600

ccggctttgc agagcatccc tgtttccccg tttttccctt ttcacccaat aaaaccctgc 660

ttcactcacc cttcaaacca tctgcaagcc taaatttttg tggctgtggg acggacaaag 720

atgcctttag ctgactgagg aaaagtcctg caacacaggt atcactgcac atttataata 780

ttgtttctct gttttaaacc ttgtataaat aggaaaatat tgtatataat ctcaagcaga 840

ttgttttctt ttgaaaagta ttcatatatg ttaaagatgt agttctagtt cattcatttt 900

ctctgttttg actcttttat acatatacta cagctcattt atccattttc ctactgttgc 960

aacatagatt gcttataatt cttctaatta ctaacaatgc tggtatgaaa ttgttgtgta 1020

tatctctggt agatatgtgt tatttctttt ttgcaatgct agattataat tatttgtcta 1080

aggtggagat taccagggta gactcgctct ggccgtatgt aatgatgtct gtggctacat 1140

aacctgccaa cacttagtct tatcacacat tttattttaa aatcaatatg taaaaaatac 1200

taatttactt ggtagtaatt taaatttttc tgattattac tgaggttgaa tatgttttca 1260

tatgtttact gaatattcct gttaattttc tcatgaattt cagttaatgt ttctgttgat 1320

tttattaatt tgtagtggtt ttgaaacata ttctagaaac caatattttg tctgttgtat 1380

gtgttacaaa tatatttatt ttgtatagct tcttcatatt tagtactttt acaattttaa 1440

cagtaaaatt agtttcatgt tttatagcta taattattat aacttttaaa taaatatttc 1500

ctcaattaaa ataaaaatgc attatcctta aaaaaaaaaa 1540

Claims (5)

1. The application of LncRNA inhibitor in preparing weight-reducing medicine is characterized in that the LncRNA inhibitor has the nucleotide sequence as follows: 5'-GACCAGTGTTAACTGCTTCCTGATGACAG-3' are provided.

2. The use according to claim 1, wherein the medicament is an agent that inhibits LncRNA LOC339535 expression.

3. The use of claim 1, wherein said medicament further comprises a pharmaceutically acceptable carrier.

4. The use of claim 3, wherein said carrier is a liposome.

5. Use according to claim 3, wherein the carrier is a nanoparticle.

Images