CN112301143B - Method for identifying floral erythema trait of Asian cotton by using KASP marker - Google Patents
Method for identifying floral erythema trait of Asian cotton by using KASP marker Download PDFInfo
- Publication number
- CN112301143B CN112301143B CN202010969065.2A CN202010969065A CN112301143B CN 112301143 B CN112301143 B CN 112301143B CN 202010969065 A CN202010969065 A CN 202010969065A CN 112301143 B CN112301143 B CN 112301143B
- Authority
- CN
- China
- Prior art keywords
- erythema
- floral
- kasp
- detection site
- parts
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for identifying the floral erythema trait of Asian cotton by using KASP marker. The method comprises the following steps: step 1, extracting Asian cotton genomic DNA; step 2, developing Asian cotton-based erythema KASP markers; 3, carrying out KASP genotyping, wherein KASP-PCR reaction is carried out on a Douglas Array Tape platform; and 4, determining the floral substrate erythema character by using the KASP molecular marker. The judgment accuracy of each KASP mark of the method is more than 92%, 5 KASP marks are judged simultaneously, and the judgment efficiency is more than 96%. Can achieve the purpose of identifying the color of the flower base at early stage.
Description
Technical Field
The invention relates to the field of cotton molecular breeding application, in particular to a method for identifying the physalis alkekengi trait of Asian cotton by using KASP marker.
Background
The planting of Asian cotton in China has a history of more than two thousand years, the Asian cotton has the characteristics of early maturity, drought resistance, disease and insect resistance and the like, is easy to plant, good in pipe and less in insect damage, has short fiber and high strength, and is suitable for manufacturing quilts and soil cloths and weaving corduroy, napping and blended carpets. And Asian cotton is various in color, gorgeous in color and extremely high in ornamental value, and the comprehensive value of the garden is further highlighted. The flower base red spot character means that when the flower buds of the Asian cotton are full, the flower petals are milk white, and the bottom ends of the flower petals are provided with deep red flower spots, the character is bright in color and easy to distinguish, and the flower spots can be clearly distinguished until the flower petals wither and dry.
In the prior art, the pure line variety with the floral erythema character and the variety without the floral erythema character are hybridized, so that the truth and the purity of the hybrid can be identified according to the proportion of the floral erythema character, namely the floral erythema character can be used as an indication character for testing the truth and the purity of the hybrid cotton.
For example, the invention patent with Chinese patent publication No. CN102057862A discloses the application of a upland cotton floral-based erythema marker trait, which is to use a hybrid cotton parent or a pure line variety with the floral-based erythema marker trait as a male parent or a female parent to hybridize with other hybrid cotton parent and pure line variety with or without the floral-based erythema marker trait to produce hybrid seeds, and after the produced hybrid seeds are sown, the authenticity and purity of the hybrid seeds are visually identified and checked according to the proportion of the floral-based erythema; the hybrid cotton parent with the floral base erythema marking character comprises a two-line sterile line, a three-line sterile line, a maintainer line and a restorer line. The method can effectively control the production quality of the cotton seeds, avoid counterfeit and inferior seeds and poor purity from impacting the market, provide technical support and protection for producing and selling qualified seeds, maintain the legal rights and interests of enterprises and farmers, promote the healthy development of the cotton seed industry, and have high application value.
The prior art has at least the following problems:
because Asian cotton takes at least two months from sowing to flowering and flowering is also influenced by season, light and temperature, the early prediction purpose cannot be achieved by using the Asian cotton as an indicator trait. Therefore, by means of a molecular marker technology, a method for identifying Asian cotton-based erythema by using seeds or seedlings is found, and the method has important significance for the application of the trait in identifying the truth and purity of the hybrid.
Aiming at the problems that in the prior art, Asian cotton needs at least two months from sowing to flowering, and flowering is influenced by seasons, illumination and temperature, and the aim of early prediction cannot be achieved by using the Asian cotton as an indication character, an effective solution is not provided at present.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a method for identifying the Asian cotton based erythema trait by using a KASP marker.
The method comprises the following steps:
step 1, obtaining Asian cotton genomic DNA:
step 1.1, extracting, namely placing the Asian cotton into a 2ml centrifugal tube precooled by liquid nitrogen, placing 2 small steel balls with the diameter of 8mm, adding 750ml CTAB extracting solution, grinding for 8min by a grinder with the rotating speed of 1800r/min, taking out, and placing on ice for 5 min;
step 1.2, cracking, namely centrifuging for 15min at 12000r/min at 4 ℃ by using a centrifuge, obliquely flowing out upper liquid from a centrifuge tube, discarding supernatant, taking out 1 steel ball, adding 750ml of lysate, placing the centrifuge tube on a foam float, carrying out water bath at 65 ℃ for 30-45min, and shaking the centrifuge tube for 15s every 5 min;
step 1.3, extracting, cooling to room temperature, adding chloroform/isoamylol (24:1) with the same amount, slightly reversing and uniformly mixing, centrifuging at 5000r/min for 15min, taking supernatant, and repeatedly extracting once again;
step 1.4, precipitating, namely precooling isopropanol in a refrigerator at the temperature of-20 ℃ for 2 hours, subpackaging isoamyl alcohol with the volume of 2/3 of supernatant in the step 1.3 into a centrifugal tube of 1.5ml, injecting the supernatant into the isoamyl alcohol, inverting and uniformly mixing, standing for 20min in a refrigerator at the temperature of-20 ℃, centrifuging for 10min at 10000r/min when white flocculent precipitates appear, inclining the centrifugal tube, and discarding the supernatant;
step 1.5, cleaning, adding 70% ethanol into a centrifugal tube, vibrating the lower part of the centrifugal tube, bouncing DNA sediment attached to a centrifugal bottom, shaking the centrifugal tube, placing the centrifugal tube in a centrifugal machine, centrifuging for 1min at 5000r/min, inclining the centrifugal tube, discarding supernatant, repeatedly washing the sediment for 2 times by using 70% ethanol, cleaning for 1 time by using 100% ethanol, and placing the sediment in a fume hood for air drying;
step 1.6, fixing the volume, dissolving the air-dried DNA precipitate in 30-40ul of ultrapure water, adding ribonuclease, standing at normal temperature for 1h, and then placing in a refrigerator at 4 ℃ for later use;
step 2.1, detecting 25 non-synonymous mutation sites and 3 frame-shift mutation sites in a floral base erythema segregation population, wherein 5 sites are closely linked with the floral base erythema trait and are respectively named Ga27640-C/CAA (INDEL4), Ga27640-T/G (SNP11), Ga27646-A/G (SNP17), Ga27648-A/T (SNP18) and Ga27650-C/G (SNP 22);
step 2.2, respectively developing KASP marks aiming at 5 sites closely linked with the floral base erythema traits in the step 2.1, designing a PCR 3' end amplification Primer according to the SNP sites by using Primer3, wherein the Tm value of the Primer is between 55 and 65 ℃, and each SNP site is provided with two SNP specific primers and one universal Primer;
step 3, KASP genotyping, KASP-PCR reaction on Douglas Array Tape platform:
step 3.1, adding array tape into DNA and PCR mix on a NEXAR liquid processing workstation, and completing PCR reaction in a SOELLEX high-throughput PCR water bath;
step 3.1.1, PCR reaction components comprise Master Mix and primer Mix:
the Master Mix includes: FAMTM and HEXTM special fluorescence resonance energy transfer group, modified Taq enzyme for amplifying allelic specific base and reaction buffer solution;
the primer Mix comprises: two forward sequence allelic specific primers, wherein the 5' -end of each primer contains a joint sequence which is not subjected to fluorescent labeling and a reverse sequence primer;
step 3.1.2, PCR reaction system:
after the DNA is subpackaged into the PCR reaction container, the LGC platform places the subpackaged DNA in an oven at 65 ℃ for 30min for drying;
step 3.1.3, PCR reaction program:
step 3.1.3.1, performing denaturation at the temperature of 94 ℃ for 15 mins;
3.1.3.2, enriching template DNA containing SNP sites, carrying out denaturation at 94 ℃ for 20S, carrying out annealing/extension at 55-61 ℃, carrying out 60S gradient annealing, reducing each cycle by 0.6 ℃, and repeating 15 cycles;
3.1.3.3, amplifying the fluorescence signal, performing denaturation at 94 ℃ for 20S, performing annealing/extension at 55 ℃, performing gradient annealing for 60S, and repeating 26 cycles;
step 3.2, reading a fluorescence signal on an ARAYA fluorescence reader, respectively placing a 384-hole plate and a Tape into an Omega fluorescence signal reader and an Araya fluorescence detection system when a KASP detection PCR reaction program is finished, converting the fluorescence signal into a basic group genotype by the Araya fluorescence detection system, and performing genotype analysis by using KrakenTM;
3.3, importing the fluorescence signal result into a database, and carrying out SNP typing on the sample on the Douglas Scientific Dashboard according to the principles that the typing is clear and the NTC has no specific amplification;
step 4, KASP molecular marker determination of floral base erythema character:
marking Ga27640-C/CAA (INDEL4), and if the genotype of the detection site is CAA/CAA, determining the detection site is non-flowering erythema; if C/C, it is homozygous for erythema with floral base; if the gene is C/CAA, it is heterozygote with physalis rosea;
marking Ga27640-T/G (SNP11), and if the genotype of the detection site is G/G, determining the non-flower-based erythema; if the ratio is T/T, the flower base erythema homozygote is obtained; if G/T, it is heterozygote with floral base erythema;
the marker is Ga27646-A/G (SNP17), and if the genotype of the detection site is G/G, the marker is the non-flower-based erythema; if A/A, it is homozygous for erythema with floral base; if the A/G is the floral base erythema heterozygote;
the marker Ga27648-A/T (SNP18), if the genotype of the detection site is T/T, the detection site is the non-flower-based erythema; if A/A, it is homozygous for erythema with flower base; if the A/T is the floral base erythema heterozygote;
the marker Ga27650-C/G (SNP22), if the genotype of the detection site is G/G, the detection site is the non-flower-based erythema; if C/C, it is homozygous for erythema with floral base; if it is C/G, it is heterozygote for rosette erythema.
Further, in the PCR reaction components of step 3.1.1 including Master Mix and primer Mix, the reaction buffer solution is composed of the following raw materials in parts by weight:
10 parts of dNTP mixture;
4 parts of a magnesium chloride solution;
3 parts of DNA polymerase;
3 parts of Taq enzyme;
5 parts of trihydroxymethyl aminomethane hydrochloride;
4 parts of sodium nitride;
10 parts of deionized water;
2 parts of glycerol;
4 parts of magnesium chloride;
3 parts of potassium acetate;
4 parts of dithiothreitol;
5 parts of ammonium sulfate.
Compared with the prior art, the method has the following remarkable advantages:
1, the judgment accuracy of each KASP mark of the method is more than 92%, 5 KASP marks are judged simultaneously, and the judgment efficiency is more than 96%. The purpose of identifying the color of the flower base at early stage can be achieved.
2, the molecular marker or the functional marker which is closely linked with the floral-based erythema can accurately and efficiently predict the Asian cotton floral-based erythema character and promote the application of the floral-based erythema character in the identification of the truth and the purity of the hybrid.
3, the method of the invention can effectively improve the reaction efficiency of PCR by adding magnesium chloride, ammonium sulfate, potassium acetate and sodium nitride into the raw materials of the reaction buffer solution, and has the advantages of reliable, accurate and sensitive result, simple operation, efficiency improvement and the like.
Drawings
FIG. 1 is a typing chart of KASP marker Ga27640-C/CAA (INDEL4) according to the method of the present invention;
FIG. 2 is a typing chart of KASP marker Ga27640-T/G (SNP11) according to the method of the present invention;
FIG. 3 is a typing chart of KASP marker Ga27646-A/G (SNP17) according to the method of the present invention;
FIG. 4 is a diagram showing typing of KASP marker Ga27648-A/T (SNP18) according to the method of the present invention;
FIG. 5 is a typing chart of KASP marker Ga27650-C/G (SNP22) according to the method of the present invention;
FIG. 6 is a schematic comparison of single petal tissue with flower-based erythema and non-flower-based erythema on the day of flowering in Asian cotton described in the present invention;
FIG. 7 is a schematic representation of a comparison of single petal tissue with and without flower-based erythema during Asian cotton petals development according to the present invention;
FIG. 8 is a schematic representation of the tissue of a cotton flower with a floral erythema trait on the day of Asian cotton flowering according to the present invention;
FIG. 9 is a schematic diagram of a cotton flower tissue without the floral erythema trait of the day of Asian cotton blooming.
Detailed Description
The invention is described in further detail below with reference to the drawings and the detailed description.
Example 1
Screening a homozygous material with flower base erythema by using KASP molecular markers;
the method comprises the steps of taking a large flower-based erythema material 6605 as a male parent, taking a dwarf and high-strength Asian cotton Ga-62 female parent without the flower-based erythema, and breeding strains with practical value and ornamental value, namely the strains with the flower-based erythema, dwarfing and high strength for multiple generations after hybridization. In the breeding process, DNA can be extracted in a seedling stage, the color of the floral base can be identified by KASP typing, a single plant without the floral base erythema can be pulled out according to the identification result before final singling, and whether the floral base erythema character can be separated can be judged according to whether each locus genotype is homozygous or not.
In order to obtain Asian cotton-based erythema candidate areas, research teams constructed floral-based erythema F by using Asian cotton materials with floral-based erythema and without floral-based erythema as parents and by hybridization 2 Separating the colony, combining a BSA mixed pool (20+20) and a high-throughput sequencing (parent sequencing depth is 10x), performing association analysis by using SNP-index and InDel-index association algorithms, taking intersection, and obtaining 1 candidate region related to the character with the total length of 5.15Mb in total, wherein the total length is shown in Table 1, 25 non-synonymous mutation SNP sites and 3 frameshift mutation sites are provided in the association region, and the total length is shown in Table 2. The differential sites may be associated with asian cotton-based color. The research team develops KASP functional markers aiming at the different sites, screens the functional markers closely linked with the flower base color, wherein 5 KASP markers are closely linked with the flower base erythema character, and the 5 KASP markers are utilized as shown in the table 3The markers will likely enable rapid prediction of asian cotton-based colors.
In order to verify the effect, in the F2 generation, 100 individuals were identified by the KASP marker, and 24 individuals were classified as CAA/CAA in the marker Ga27640-C/CAA (INDEL4), T/T in the marker Ga27648-A/T (SNP18), and G/G in the marker Ga27640-T/G (SNP11), Ga27646-A/G (SNP17), and Ga27650-C/G (SNP22), and judged as florescence-free erythema individuals. The total 37 individuals were judged to be homozygous for flower base erythema because they were typed with the marker Ga27640-C/CAA (INDEL4) as C/C, with the marker Ga27640-T/G (SNP11) as T/T, with the markers Ga27646-A/G (SNP17) and Ga27648-A/T (SNP18) as A/A, and with the marker Ga27650-C/G (SNP22) as C/C. In total, 39 individuals were classified as being C/CAA when the marker Ga27640-C/CAA (INDEL4) was used, G/T when the marker Ga27640-T/G (SNP11) was used, T/A when the marker Ga27646-A/G (SNP17) was used, G/A, Ga27648-A/T (SNP18) was used, and C/G when the marker Ga27650-C/G (SNP22) was used, and they were judged as being floral erythema heterozygotes. In order to verify the accuracy, the color of the floral base is investigated in the full-bloom stage and compared with the typing result, the judgment accuracy rate of the florid-free florid is up to 100%, and the judgment accuracy rate of the florid-free florid is up to 98.6%. According to the field characters, the homozygous type or the heterozygous type of the floral erythema can not be judged, materials are labeled, inbred single plants are harvested and sown for F3, F4 and F5 generations, and the survey shows that 37 single plants judged to be homozygous type of the floral erythema all have the floral erythema characteristics of the third generation, and 38 single plants in 39 single plants marked as the heterozygous type have the floral erythema characteristics of the third generation and have no floral erythema characteristics of the third generation. As shown above, the present invention using the KASP marker is effective in contemporary judgment, and whether or not stable inheritance of floral base erythema can be determined based on the genotype.
To further evaluate the beneficial effects of this invention, 200 individuals were randomly selected from floral erythema line YR and non-floral erythema line YW from selfing of F2 and harvested separately depending on whether the floral base had erythema, to F5 generations, tested for genotype and investigated for phenotype.
In total, 19 individuals in YR were classified as CAA/CAA at the marker Ga27640-C/CAA (INDEL4), as T/T at the marker Ga27648-A/T (SNP18), as G/G at the markers Ga27640-T/G (SNP11), Ga27646-A/G (SNP17) and Ga27650-C/G (SNP22), and as non-flower-based erythema. The total of 172 individuals were classified as C/C when the marker Ga27640-C/CAA (INDEL4) was used for typing, T/T when the marker Ga27640-T/G (SNP11) was used for typing, A/A when the marker Ga27646-A/G (SNP17) and Ga27648-A/T (SNP18) were used for typing, and C/C when the marker Ga27650-C/G (SNP22) was used for typing, and they were judged to be homozygous for the flower-based erythema. In total, 9 individuals were classified as having C/CAA as a result of typing at the marker Ga27640-C/CAA (INDEL4), G/T as a result of typing at the marker Ga27640-T/G (SNP11), T/A as a result of typing at the marker Ga27646-A/G (SNP17), T/A as a result of typing at the marker G/A, Ga27648-A/T (SNP18), and C/G as a result of typing at the marker Ga27650-C/G (SNP22), and were judged to be rosette heterozygotes. The accuracy is judged according to the floral character in the full-bloom stage, and the result shows that: the accuracy rate of judging whether the flower base has erythema is 98.0 percent according to KASP marks.
The typing result of 195 individuals in total marked Ga27640-C/CAA (INDEL4) in YW is CAA/CAA, the result of typing at marker Ga27648-A/T (SNP18) is T/T, the typing results of the marker Ga27640-T/G (SNP11), the marker Ga27646-A/G (SNP17) and the marker Ga27650-C/G (SNP22) are G/G, the marker is judged to be florescent erythema, 5 individuals are typed by the marker Ga27640-C/CAA (INDEL4) to be C/C, the result of typing at marker Ga27640-T/G (SNP11) was T/T, when the markers Ga27646-A/G (SNP17) and Ga27648-A/T (SNP18) are typed, the typing result is A/A, the marker Ga27650-C/G (SNP22) was classified as C/C, and it was judged to be homozygous for flower base erythema. The accuracy is judged according to the floral character in the full-bloom stage, and only 3 plants have the floral erythema character. The results show that: the accuracy rate of judging whether the flower base has erythema is 99.0% according to KASP marks.
Example 2
The purity of the Asian cotton hybrid is identified early by using KASP molecular markers;
in 2011, Asian cotton with floral erythema is found in a cotton resource garden, the cotton is homozygous after 5 generations of selfing purification, 6605 is used as a female parent in 6605,2016 years, high-strength and drought-resistant material Ga-6 is used as a male parent to prepare a hybridization combination, and the hybrid is obtained in 12 months in the current year after artificial emasculation and pollination. Culturing 200 seeds in water in a laboratory in the same year, culturing in water for 10 days, extracting DNA from the seedlings, and performing KASP marking and typing identification according to the steps, wherein the marking Ga27640-C/CAA (INDEL4) has a typing result of C/C or C/CAA; the marking Ga27640-T/G (SNP11) has a T/T or G/T typing result; the marking Ga27646-A/G (SNP17) has the typing result of A/A or A/G; the typing result of the marker Ga27648-A/T (SNP18) is A/A or A/T; the typing result of marker Ga27650-C/G (SNP22) is C/C or C/G. If the 5 conditions are met simultaneously, the material with the flower-based erythema is selected and judged. According to this method, 196 plants having the trait of flower-based erythema accounted for 98.0% of the total. The method has the advantages of good seed production quality, high hybrid purity and capability of being popularized in field planting. In order to verify the marking effect, the same batch of hybrids are planted in a Xiaoan House test station in 4 months in 2017, the flower color is investigated in the full bloom stage in 7 months in the same year, the purity of the hybrids is judged according to the floral base erythema character, 500 plants are investigated, 492 plants with the floral base erythema character are calculated in a proportion of 98.4%, and the purpose of early prediction of the purity of the hybrids can be achieved by utilizing the KASP marker.
TABLE 1 floral base erythema candidate regions
| Chromosome number | Initiation of | Terminate | Size of area | Number of genes |
| CA_chr01 | 113,640,000 | 118,790,000 | 5.15 | 117 |
| Total of | - | - | - | 117 |
TABLE 2 statistics of Gene function annotation results in SNP, InDel within candidate regions
| Annotation database | Base factor | Number of nonsynonymous mutated genes | Frameshift mutant gene |
| NR | 98 | 10 | 3 |
| NT | 99 | 10 | 3 |
| trEMBL | 97 | 10 | 3 |
| SwissProt | 62 | 5 | 3 |
| GO | 52 | 2 | 2 |
| KEGG | 25 | 0 | 0 |
| COG | 29 | 3 | 2 |
| Total | 99 | 10 | 3 |
Further, the method comprises the steps of:
step 1, acquiring Asian cotton genome DNA:
step 1.1, extracting, namely placing the Asian cotton into a 2ml centrifugal tube precooled by liquid nitrogen, placing 2 small steel balls with the diameter of 8mm, adding 750ml CTAB extracting solution, grinding for 8min by a grinder with the rotating speed of 1800r/min, taking out, and placing on ice for 5 min;
step 1.2, cracking, namely centrifuging for 15min at 12000r/min at 4 ℃ by using a centrifuge, obliquely flowing out upper liquid from a centrifuge tube, discarding supernatant, taking out 1 steel ball, adding 750ml of lysate, placing the centrifuge tube on a foam float, carrying out water bath at 65 ℃ for 30-45min, and shaking the centrifuge tube for 15s every 5 min;
step 1.3, extracting, cooling to room temperature, adding chloroform/isoamylol (24:1) with the same amount, slightly reversing and uniformly mixing, centrifuging at 5000r/min for 15min, taking supernatant, and repeatedly extracting once again;
step 1.4, precipitating, namely precooling isopropanol in a refrigerator at the temperature of minus 20 ℃ for 2 hours, subpackaging isoamyl alcohol with the volume of 2/3 of supernatant in the step 1.3 into a centrifugal tube of 1.5ml, injecting the supernatant into the isoamyl alcohol, turning upside down and uniformly mixing, standing for 20min in the refrigerator at the temperature of minus 20 ℃, centrifuging for 10min at the speed of 10000r/min when white flocculent precipitates appear, inclining the centrifugal tube, and discarding the supernatant;
step 1.5, cleaning, adding 70% ethanol into a centrifugal tube, vibrating the lower part of the centrifugal tube, bouncing DNA sediment attached to a centrifugal bottom, shaking the centrifugal tube, placing the centrifugal tube in a centrifugal machine, centrifuging for 1min at 5000r/min, inclining the centrifugal tube, discarding supernatant, repeatedly washing the sediment for 2 times by using 70% ethanol, cleaning for 1 time by using 100% ethanol, and placing the sediment in a fume hood for air drying;
step 1.6, fixing the volume, dissolving the air-dried DNA precipitate in 30-40ul of ultrapure water, adding ribonuclease, standing at normal temperature for 1h, and then placing in a refrigerator at 4 ℃ for later use;
step 2.1, detecting 25 non-synonymous mutation sites and 3 frame-shift mutation sites in a floral base erythema segregation population, wherein 5 sites are closely linked with the floral base erythema trait and are respectively named Ga27640-C/CAA (INDEL4), Ga27640-T/G (SNP11), Ga27646-A/G (SNP17), Ga27648-A/T (SNP18) and Ga27650-C/G (SNP 22);
step 2.2, respectively developing KASP marks aiming at 5 sites closely linked with the floral base erythema traits in the step 2.1, designing a PCR 3' end amplification Primer according to the SNP sites by using Primer3, wherein the Tm value of the Primer is between 55 and 65 ℃, and each SNP site is provided with two SNP specific primers and one universal Primer;
TABLE 35 KASP marker amplification sites and sequence information
| Name of label | Amplification site location | FAM primer sequences | VIC primer sequences | COM primer sequence |
| G a 27640-C/CAA(INDEL4) | Chr01-118444577 | AGCTGTATATCCCGGGGTTTTTTTG | GAGCTGTATATCCCGGGGTTTTTTTT | CTTTGGAGCTGCATCCGGAAATGTT |
| G a 27640-T/G(SNP11) | Chr01-118445602 | GTAATCTAATCCACGGGCTGCAA | TAATCTAATCCACGGGCTGCAC | CTCCTCTCACCTGGAAACAGAGATT |
| G a 27646-A/G(SNP17) | Chr01-118637518 | TACAGTGTTCACCTTTTTTGCTATCAT | CAGTGTTCACCTTTTTTGCTATCAC | TATAATCCTTGCGTCCCAGACCCTA |
| G a 27648-A/T(SNP18) | Chr01-118729707 | AGCTATTTCAATGGAAACCAACAGCA | AGCTATTTCAATGGAAACCAACAGCT | CTCCAATTGTTCGTCGTTGGCGATA |
| G a 27650-C/G(SNP22) | Chr01-118736807 | GTGGTCCAACATTTGTCGAGGTG | GTGGTCCAACATTTGTCGAGGTC | GAAGAGCAACACCAGTTACGAGTGTA |
It should be noted that the KASP notation naming principle is: subspecies abbreviation + Gene number + typing results, e.g.
Ga27640-C/CAA (INDEL4) shows that the detection site is positioned on Asian cotton gene 27640, and the marked detection site is C/CAA.
Step 3, KASP genotyping, KASP-PCR reaction is carried out on Douglas Array Tape platform:
step 3.1, adding array tape into DNA and PCR mix on a NEXAR liquid processing workstation, and completing PCR reaction in a SOELLEX high-throughput PCR water bath;
step 3.1.1, PCR reaction components comprise Master Mix and primer Mix:
the Master Mix includes: FAMTM and HEXTM special fluorescence resonance energy transfer group, modified Taq enzyme for amplifying allelic specific base and reaction buffer solution;
the primer Mix comprises: two forward sequence allelic specific primers, wherein the 5' -end of each primer contains a joint sequence which is not subjected to fluorescent labeling and a reverse sequence primer;
step 3.1.2, PCR reaction system as shown in table 4:
after the DNA is subpackaged into the PCR reaction container, the LGC platform places the subpackaged DNA in an oven for 30min at 65 ℃ for drying;
TABLE 4KASP detection PCR reaction System
Step 3.1.3, PCR reaction program:
step 3.1.3.1, performing denaturation at the temperature of 94 ℃ for 15 mins;
3.1.3.2, enriching template DNA containing SNP sites, carrying out denaturation at the temperature of 94 ℃, carrying out annealing/extension at the temperature of 55-61 ℃ for 20S, carrying out 60S gradient annealing, reducing the temperature by 0.6 ℃ in each cycle, and repeating 15 cycles;
3.1.3.3, amplifying the fluorescence signal, denaturing at 94 deg.C for 20S, annealing/extending at 55 deg.C, gradient annealing for 60S, and repeating 26 cycles;
step 3.2, reading a fluorescence signal on an ARAYA fluorescence reader, respectively placing a 384-hole plate and a Tape into an Omega fluorescence signal reader and an Araya fluorescence detection system when a KASP detection PCR reaction program is finished, converting the fluorescence signal into a basic group genotype by the Araya fluorescence detection system, and performing genotype analysis by using KrakenTM;
3.3, importing the fluorescence signal result into a database, and carrying out SNP typing on the sample on the Douglas Scientific Dashboard according to the principles that the typing is clear and the NTC has no specific amplification;
step 4, KASP molecular marker determination of floral base erythema character:
marking Ga27640-C/CAA (INDEL4), and if the genotype of the detection site is CAA/CAA, determining the detection site is non-flowering erythema; if C/C, it is homozygous for erythema with flower base; if the gene is C/CAA, it is heterozygote with physalis rosea;
marking Ga27640-T/G (SNP11), and if the genotype of the detection site is G/G, determining that the site is an anaanthotic erythema; if the ratio is T/T, the flower base erythema homozygote is obtained; if G/T, it is heterozygote with floral base erythema;
the marker is Ga27646-A/G (SNP17), and if the genotype of the detection site is G/G, the marker is the non-flower-based erythema; if A/A, it is homozygous for erythema with flower base; if the A/G is the floral base erythema heterozygote;
the marker Ga27648-A/T (SNP18), if the genotype of the detection site is T/T, the detection site is the non-flower-based erythema; if A/A, it is homozygous for erythema with floral base; if the A/T is the floral base erythema heterozygote;
marking Ga27650-C/G (SNP22), and if the genotype of the detection site is G/G, determining that the site is an anaanthotic erythema; if C/C, it is homozygous for erythema with floral base; if it is C/G, it is heterozygote for rosette erythema.
Further, in the step 3.1.1, the PCR reaction components include Master Mix and primer Mix, and the reaction buffer consists of the following raw materials in parts by weight:
10 parts of dNTP mixture;
4 parts of magnesium chloride solution;
3 parts of DNA polymerase;
3 parts of Taq enzyme;
5 parts of trihydroxymethyl aminomethane hydrochloride;
4 parts of sodium nitride;
10 parts of deionized water;
2 parts of glycerol;
4 parts of magnesium chloride;
3 parts of potassium acetate;
4 parts of dithiothreitol;
5 parts of ammonium sulfate.
Further, as shown in FIG. 1, for the marker Ga27640-C/CAA (INDEL4), if the genotype of the detection site is CAA/CAA, the red spot at the upper left part in FIG. 1 is the non-anthony erythema; if C/C, the blue color point at the bottom right corner in FIG. 1 is homozygous for floral-based erythema (note: homozygous selfing has floral-based erythema); if CAA/C (C/CAA), the green spots in the middle of FIG. 1 are heterozygotes with floral erythema (selfing progeny will have both floral erythema and non-floral erythema).
Furthermore, as shown in FIG. 2, for the marker Ga27640-T/G (SNP11), if the genotype of the detection site is G/G, the red spot at the upper left of FIG. 1 is the non-flower-based erythema; if it is T/T, it is homozygous for floral erythema (note: homozygous selfing has floral erythema) as blue spot at the lower right part of FIG. 1; if G/T is the green spot in the middle of FIG. 1, it is a floral-based erythema heterozygote (the selfed progeny will have both floral and non-floral erythema).
Furthermore, as shown in FIG. 3, for the marker Ga27646-A/G (SNP17), if the genotype of the detection site is G/G, the red spot at the upper left of FIG. 3 is the non-flower-based erythema; if the ratio is A/A, the flower-based erythema homozygote is shown in the blue spot at the lower right part of the figure 3 (note: homozygote selfing has the flower-based erythema); if it is A/G, the green spots in the middle of FIG. 3, it is a floral-based erythema heterozygote (the selfed progeny will have both floral-based erythema and non-floral erythema).
Further, as shown in FIG. 4, for the marker Ga27648-A/T (SNP18), if the genotype of the detection site is T/T, red spots at the upper left of FIG. 4 are non-flower-based erythema; if the ratio is A/A, the color point is blue at the lower right part of the figure 4, the flower-based erythema is homozygous (note: homozygous selfing has flower-based erythema); if the A/T is the green spot in the middle of the graph in FIG. 4, the hybrid type is the floral base erythema hybrid (the selfed offspring will have both floral base erythema and non-floral base erythema).
Furthermore, as shown in FIG. 5, for the marker Ga27650-C/G (SNP22), if the genotype of the detection site is G/G, as shown by the blue spot at the lower right of FIG. 5, the marker is a basal erythema; if C/C, as shown in the red spot at the upper left of FIG. 5, it is homozygous for floral erythema (note: homozygous selfing has floral erythema); if C/G, as shown in the middle green spot of FIG. 5, it is a floral-based erythema heterozygote (the selfed progeny will have both floral and non-floral erythema).
Further, as shown in fig. 6 and 7, the asian cotton tissue was peeled open in the laboratory, and it was found that the left side was the asian cotton tissue with erythema trait and the right side was the asian cotton tissue without erythema trait.
Further, as shown in fig. 8, the tissue was an asian cotton tissue in the experimental field, which was seen as an erythema trait, and as shown in fig. 9, the tissue was an asian cotton tissue in the experimental field, which was seen as an asian cotton tissue without an erythema trait.
The above description is only for the preferred embodiment of the present invention and should not be construed as limiting the present invention, and various modifications and changes can be made by those skilled in the art without departing from the spirit and principle of the present invention, and any modifications, equivalents, improvements, etc. should be included in the scope of the claims of the present invention.
Claims (2)
1. A method for identifying the floral erythema trait of Asian cotton by using KASP markers, which is characterized by comprising the following steps:
step 1, obtaining Asian cotton genomic DNA:
step 1.1, extracting, namely placing Asian cotton into a liquid nitrogen precooled 2ml centrifuge tube, placing 2 small steel balls with the diameter of 8mm, adding 750ml CTAB extracting solution, grinding for 8min by a grinder with the rotating speed of 1800r/min, taking out, and placing on ice for 5 min;
step 1.2, cracking, namely centrifuging for 15min at 12000r/min at 4 ℃ by using a centrifuge, obliquely flowing out the upper liquid from a centrifuge tube, discarding the supernatant, taking out 1 steel ball, adding 750ml of lysate, placing the centrifuge tube on a foam float, carrying out water bath at 65 ℃ for 30-45min, and shaking the centrifuge tube for 15s every 5 min;
step 1.3, extracting, cooling to room temperature, adding chloroform/isoamylol (24:1) with the same amount, slightly reversing and uniformly mixing, centrifuging at 5000r/min for 15min, taking supernatant, and repeatedly extracting once again;
step 1.4, precipitating, namely precooling isopropanol in a refrigerator at the temperature of-20 ℃ for 2 hours, subpackaging isoamyl alcohol with the volume of 2/3 of supernatant in the step 1.3 into a centrifugal tube of 1.5ml, injecting the supernatant into the isoamyl alcohol, inverting and uniformly mixing, standing for 20min in a refrigerator at the temperature of-20 ℃, centrifuging for 10min at 10000r/min when white flocculent precipitates appear, inclining the centrifugal tube, and discarding the supernatant;
step 1.5, cleaning, adding 70% ethanol into a centrifugal tube, shaking the lower part of the centrifugal tube, bouncing the DNA precipitate attached to the centrifugal bottom, shaking the centrifugal tube, placing the centrifugal tube in a centrifugal machine, centrifuging for 1min at 5000r/min, inclining the centrifugal tube, discarding the supernatant, repeatedly washing the precipitate with 70% ethanol for 2 times, washing with 100% ethanol for 1 time, and placing the centrifugal tube in a fume hood for air drying;
step 1.6, fixing the volume, dissolving the air-dried DNA precipitate in 30-40ul of ultrapure water, adding ribonuclease, standing at normal temperature for 1h, and then placing in a refrigerator at 4 ℃ for later use;
step 2, developing Asian cotton-based erythema KASP markers:
step 2.1, detecting 25 non-synonymous mutation sites and 3 frameshift mutation sites in the florescence erythema separation population, wherein 5 sites are closely linked with the florescence erythema character and are respectively named Ga27640-C/CAA, Ga27640-T/G, Ga27646-A/G, Ga27648-A/T and Ga 27650-C/G;
step 2.2, respectively developing KASP markers for 5 sites closely linked with the floral base erythema trait in the step 2.1, designing a PCR 3' terminal amplification Primer according to the SNP sites by using Primer3, wherein the Tm value of the Primer is between 55 and 65 ℃, and each SNP site is provided with two SNP specific primers and one universal Primer;
step 3, KASP genotyping, KASP-PCR reaction on Douglas Array Tape platform:
step 3.1, adding array tape into DNA and PCR mix on a NEXAR liquid processing workstation, and completing PCR reaction in a SOELLEX high-throughput PCR water bath;
step 3.1.1, PCR reaction components comprise Master Mix and primer Mix:
the Master Mix includes: FAMTM and HEXTM special fluorescence resonance energy transfer group, modified Taq enzyme for amplifying allele specific base and reaction buffer solution;
the primer Mix comprises: two forward sequence allelic specific primers, wherein the 5' -end of each primer contains a joint sequence which is not subjected to fluorescent labeling and a reverse sequence primer;
step 3.1.2, PCR reaction system:
after the DNA is subpackaged into the PCR reaction container, the LGC platform places the subpackaged DNA in an oven for 30min at 65 ℃ for drying;
step 3.1.3, PCR reaction program:
step 3.1.3.1, performing denaturation at the temperature of 94 ℃ for 15 mins;
3.1.3.2, enriching template DNA containing SNP sites, carrying out denaturation at the temperature of 94 ℃, carrying out annealing/extension at the temperature of 55-61 ℃ for 20S, carrying out 60S gradient annealing, reducing each cycle by 0.6 ℃, and repeating 10 cycles;
3.1.3.3, amplifying the fluorescence signal, performing denaturation at 94 ℃ for 20S, performing annealing/extension at 55 ℃, performing gradient annealing for 60S, and repeating 26 cycles;
step 3.2, reading a fluorescence signal on an ARAYA fluorescence reader, respectively placing a 384-hole plate and a Tape into an Omega fluorescence signal reader and an Araya fluorescence detection system when a KASP detection PCR reaction program is finished, converting the fluorescence signal into a basic group genotype by the Araya fluorescence detection system, and performing genotype analysis by using KrakenTM;
3.3, importing the fluorescence signal result into a database, and carrying out SNP typing on the sample on the Douglas Scientific Dashboard according to the principles that the typing is clear and the NTC has no specific amplification;
step 4, KASP molecular marker determination of floral base erythema character:
marking Ga27640-C/CAA, wherein the detection site position is Chr01-118444577, the FAM primer sequence is AGCTGTATATCCCGGGGTTTTTTTG, VIC, the primer sequence is GAGCTGTATATCCCGGGGTTTTTTTT, COM, the primer sequence is CTTTGGAGCTGCATCCGGAAATGTT, and if the detection site genotype is CAA/CAA, the detection site locus is the non-flower-based erythema; if C/C, it is homozygous for erythema with flower base; if the gene is C/CAA, it is heterozygote with physalis rosea;
marking Ga27640-T/G, wherein the detection site position is Chr01-118445602, the FAM primer sequence is GTAATCTAATCCACGGGCTGCAA, VIC, the primer sequence is TAATCTAATCCACGGGCTGCAC, COM, the primer sequence is CTCCTCTCACCTGGAAACAGAGATT, and if the detection site genotype is G/G, the detection site locus is non-flower-based erythema; if the ratio is T/T, the flower base erythema homozygote is obtained; if G/T, it is heterozygote with floral base erythema;
marking Ga27646-A/G, wherein the detection site position is Chr01-118637518, the FAM primer sequence is TACAGTGTTCACCTTTTTTGCTATCAT, VIC, the primer sequence is CAGTGTTCACCTTTTTTGCTATCAC, COM, the primer sequence is TATAATCCTTGCGTCCCAGACCCTA, and if the detection site genotype is G/G, the detection site locus is the non-flower-based erythema; if A/A, it is homozygous for erythema with floral base; if the gene is A/G, the gene is heterozygote with phytyl erythema;
marking Ga27648-A/T, wherein the detection site is Chr01-118729707, the FAM primer sequence is AGCTATTTCAATGGAAACCAACAGCA, VIC, the primer sequence is AGCTATTTCAATGGAAACCAACAGCT, COM, the primer sequence is CTCCAATTGTTCGTCGTTGGCGATA, and the detection site is T/T, so that the detection site is non-anthoceanic erythema; if A/A, it is homozygous for erythema with floral base; if the A/T is the floral base erythema heterozygote;
marking Ga27650-C/G, wherein the detection site position is Chr01-118736807, the FAM primer sequence is GTGGTCCAACATTTGTCGAGGTG, VIC, the primer sequence is GTGGTCCAACATTTGTCGAGGTC, COM, the primer sequence is GAAGAGCAACACCAGTTACGAGTGTA, and if the detection site genotype is G/G, the detection site locus is the non-flower-based erythema; if C/C, it is homozygous for erythema with flower base; if it is C/G, it is heterozygote for rosette erythema.
2. The method of identifying the floral-based erythema trait of Asian cotton using KASP markers as claimed in claim 1, wherein the PCR reaction components of step 3.1.1 comprises Master Mix and primer Mix, and the reaction buffer comprises the following raw materials in parts by weight:
10 parts of dNTP mixture;
4 parts of a magnesium chloride solution;
3 parts of DNA polymerase;
3 parts of Taq enzyme;
5 parts of trihydroxymethyl aminomethane hydrochloride;
4 parts of sodium nitride;
10 parts of deionized water;
2 parts of glycerol;
4 parts of magnesium chloride;
3 parts of potassium acetate;
4 parts of dithiothreitol;
5 parts of ammonium sulfate.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010969065.2A CN112301143B (en) | 2020-09-15 | 2020-09-15 | Method for identifying floral erythema trait of Asian cotton by using KASP marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010969065.2A CN112301143B (en) | 2020-09-15 | 2020-09-15 | Method for identifying floral erythema trait of Asian cotton by using KASP marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112301143A CN112301143A (en) | 2021-02-02 |
| CN112301143B true CN112301143B (en) | 2022-09-13 |
Family
ID=74483683
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010969065.2A Active CN112301143B (en) | 2020-09-15 | 2020-09-15 | Method for identifying floral erythema trait of Asian cotton by using KASP marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112301143B (en) |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102057862B (en) * | 2010-10-12 | 2013-06-19 | 安徽华韵生物科技有限公司 | Application of upland cotton flower based red spot marked character |
| CN105368830B (en) * | 2015-11-19 | 2019-01-04 | 中国农业科学院棉花研究所 | The core SNP marker for cotton crossbreed identification based on KASP technological development |
-
2020
- 2020-09-15 CN CN202010969065.2A patent/CN112301143B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112301143A (en) | 2021-02-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109735652B (en) | Wheat stripe rust resistant gene QYr.nwafu-6BL.2 linked KASP molecular marker, primer and application | |
| CN108103235B (en) | SNP molecular marker and primer for identifying cold resistance of apple rootstock and application of SNP molecular marker and primer | |
| CN113774161B (en) | KASP molecular marker of peanut pod and kernel size major QTL and application thereof | |
| CN109988862B (en) | PCR (polymerase chain reaction) marker related to male sterility of dominant nuclear gene of cabbage and application of PCR marker | |
| CN105256031B (en) | Utilize the method and its primer special of high-throughput molecular labeling transformation muskmelon female series | |
| CN110331222B (en) | Molecular marker related to cotton fertility restoration and application thereof | |
| CN116479163A (en) | Molecular marker linked with loose cauliflower leaf yellowing gene and application thereof | |
| CN112301143B (en) | Method for identifying floral erythema trait of Asian cotton by using KASP marker | |
| CN116515858A (en) | Peanut early leaf spot resistance major gene AhESR 1 and application of molecular marker thereof | |
| CN113736866B (en) | SNP locus combination for detecting tomato yellow leaf curl virus resistance and application thereof | |
| CN110373491A (en) | For detecting KASP molecular labeling and the application of rice anti-rice blast wide spectrum gene Pi 1 | |
| CN115852021A (en) | SNP molecular marker for identifying wheat grain weight and grain length and application thereof | |
| CN114908188A (en) | Application of KASP molecular marker related to wheat grain weight and grain length and primer composition thereof | |
| CN113528703A (en) | Development and application of KASP molecular marker of rice blast resistance gene Pid3-A4 | |
| CN108060247B (en) | Haplotype related to upland cotton No. 8 chromosome fiber strength | |
| CN116356073B (en) | Molecular marker linked with loose cauliflower short stem gene and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN116904638B (en) | Kasp markers linked to early females of quinoa and uses thereof | |
| CN116024379B (en) | Wheat stripe rust resistance gene YrAK58 functional molecular marker and application thereof | |
| CN113736906B (en) | SNP locus combination for detecting verticillium wilt resistance of tomatoes and application thereof | |
| CN113897352B (en) | Closely linked marker of southern rust resistance gene of corn and application thereof | |
| CN116334300B (en) | Molecular marker closely linked with main effect QTL of wheat spike number per spike and application thereof | |
| CN117604151B (en) | SNP molecular marker closely linked with cabbage type rape black shank gene BnRlm and application thereof | |
| CN116622877B (en) | SNP molecular marker related to lotus rhizome internode shape and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |