CN112301098A - Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence - Google Patents
Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence Download PDFInfo
- Publication number
- CN112301098A CN112301098A CN202011137777.4A CN202011137777A CN112301098A CN 112301098 A CN112301098 A CN 112301098A CN 202011137777 A CN202011137777 A CN 202011137777A CN 112301098 A CN112301098 A CN 112301098A
- Authority
- CN
- China
- Prior art keywords
- mitochondrial dna
- human mitochondrial
- primers
- single pair
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The application relates to the technical field of biology, and provides a method for amplifying a human mitochondrial DNA complete sequence, which comprises the following steps: designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows: a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3', reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively; human mitochondrial DNA is used as a template, and a single pair of primers is used for carrying out PCR amplification on the human mitochondrial DNA to obtain a human mitochondrial DNA complete sequence. According to the method provided by the application, a pair of primers is adopted to amplify the whole human mitochondrial amplification region to 16569bp, so that the whole circular mitochondrial DNA can be completely amplified, and all possible mutation types on the circular mitochondrial DNA can be covered. Compared with the prior art, the method improves the detection range and greatly reduces the possibility of missed detection.
Description
Technical Field
The application belongs to the technical field of biology, and particularly relates to a method for amplifying a human mitochondrial DNA complete sequence and a kit for amplifying the human mitochondrial DNA complete sequence.
Background
Mitochondria exist in eukaryotic cells and are important organelles containing genetic material (mitochondrial DNA, mtDNA). Unlike general nuclear genome DNA, human mtDNA is a double-stranded circular super-helical structure with a full length of 16569bp and can be divided into coding regions and non-coding regions, wherein the coding regions code 22 tRNA, 2 rRNA and 13 proteins and are mainly involved in the energy metabolism process of cells. mtDNA has a number of characteristics: (1) maternal inheritance, i.e. mother transfers her mtDNA to children, then daughter transfers it to next generation, father does not transfer its mtDNA to offspring; (2) heterogeneity, i.e., a cell or tissue may contain multiple types of mtDNA genomes simultaneously; (3) homogeneous, i.e., heterogeneous cells or tissues have the same genotype at mtDNA within a cell or tissue after multiple divisions; (4) multicopy, the number of copies of mtDNA contained in different types of cells can vary greatly; (5) threshold effect, when heterogeneous individuals contain a pathogenic mtDNA mutation, the ratio of wild type to mutant mtDNA often determines the clinical manifestation of the disease, when the level of mtDNA mutation reaches or exceeds a certain threshold, clinical manifestation symptoms will appear, and the severity of symptoms is positively correlated with the level of mutant mtDNA load, thus causing the threshold effect. The mutation load in the threshold range is typically between 60% and 80%, and may vary depending on the particular mtDNA mutation.
In many mitochondrial genetic diseases, point mutations, base insertions, repetitive deletions of large segments of mtDNA, and the like are important causes of mitochondrial diseases. To date, there are over 100 human mitochondrial genetic diseases associated with mtDNA mutations, such as MELAS syndrome, myoclonic epileptic broken red fibers, Leigh syndrome, Pearson syndrome, Kearns-Sayre syndrome, progressive extraocular paralysis, Leber's hereditary neuropathy, peripheral neuropathy, ataxia and retinitis pigmentosa, mitochondrial neurogastrointestinal encephalopathy, myopathy, lactic acidosis and sideroblasts anemia, Alpers syndrome, mitochondrial recessive ataxia syndrome, wolfram syndrome, and the like. Therefore, the detection of mitochondrial genes is of great importance in the process of the definitive diagnosis of mitochondrial diseases.
At present, there are many technical means for detecting mitochondrial gene variation, such as southern-blot hybridization technology, Gap-PCR technology, MLPA technology, etc., and many of these technologies have the disadvantages of single type of variation, small detection range, small flux, long time consumption, and weak universality. Methods for detecting mitochondrial variation by Sequencing can be mainly classified into two categories, one-Generation Sequencing (Sanger Sequencing) and one-Generation Sequencing (Next Generation Sequencing). One-generation sequencing one reaction can detect intervals up to about 1kb in length. Since mitochondria are 16kb or more in length, it is usually necessary to amplify and detect fragments of 20 or more primer pairs by one-generation sequencing. The method not only increases the cost, increases the requirement for the initial sample size, and increases a plurality of repeated operations, but also reads the result mainly by observing and comparing peak graphs by human eyes site by site, thereby being time-consuming, labor-consuming and error-prone (at present, part of software can automatically read the graph, but the effect is not good, and the result of automatic reading is error-prone). Compared with the first-generation sequencing, the second-generation sequencing realizes higher-degree automatic processing, and greatly reduces the trouble and error of manual image reading; meanwhile, if a plurality of samples are detected simultaneously, the detection cost, the consumed time and the operation are reduced. At present, two kinds of library establishing modes for next-generation sequencing generally exist, namely amplification library establishing and capture library establishing. The amplification library building is that a pair of primers is arranged every about 200bp, and a target region is amplified in two reaction tubes or a plurality of reaction tubes by segments by utilizing the principle of multiplex PCR. The capture and library construction also designs a hybridization probe at intervals of hundreds of bp, and a target region is pulled down in a segmented manner through a plurality of pairs of probes. In both of the above two ways, multiple pairs of primers or probes (tens to hundreds) are required to obtain the target region, which not only increases the time, cost and operation difficulty and the requirement for the initial DNA sample, but also may result in poor region coverage uniformity, waste of partial sequencing capacity, and difficulty in detecting and analyzing the duplication or deletion of large fragments.
Disclosure of Invention
The application aims to provide a method for amplifying a human mitochondrial DNA complete sequence and a kit for amplifying the human mitochondrial DNA complete sequence, and aims to solve the problems that the traditional library construction method for second generation sequencing has poor region coverage uniformity and is difficult to detect and analyze the repetition or deletion of a large segment in the case of amplifying the complete mitochondrial DNA complete sequence by using a plurality of pairs of primers.
In order to achieve the purpose, the invention adopts the following technical scheme:
in one aspect, the present invention provides a method for full-sequence amplification of human mitochondrial DNA, the method comprising:
designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively;
and carrying out PCR amplification on the human mitochondrial DNA by using the single pair of primers by using the human mitochondrial DNA as a template to obtain a human mitochondrial DNA complete sequence.
Preferably, in the step of performing PCR amplification on the human mitochondrial DNA by using the single pair of primers, a reaction system for the PCR amplification comprises the following components in the following volume ratio based on a total volume of 25 to 50 μ l:
wherein the primer is the single pair of primers, the concentration of the template DNA is 30-100 ng/mu L, the concentration of the primer is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
Preferably, the performing PCR amplification on the human mitochondrial DNA by using the single pair of primers comprises: preheating at 94-98 deg.C for 1-2 min;
denaturing at 98 deg.c for 10-15 sec; annealing at 65-68 deg.C for 30-60 sec; extending at 68 deg.C for 10-14 min; repeating the procedures of denaturation, annealing and extension for 30 cycles;
extending at 68-70 deg.C for 30-45 min;
keeping the temperature at 10-12 ℃.
Preferably, in the step of performing PCR amplification on the human mitochondrial DNA by using the single pair of primers, a reaction system for the PCR amplification includes the following components in the following volume ratio based on a total volume of 25 μ l:
wherein the concentration of the template DNA is 30-100 ng/. mu.l, the concentration of the primer is 10. mu. mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/. mu.l.
Preferably, the PCR amplification of the human mitochondrial DNA using the single pair of primers comprises:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
Preferably, the human mitochondrial DNA adopts a human whole genome kit
Blood L extraction.
Preferably, the method comprises:
designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively;
and carrying out PCR amplification on the human mitochondrial DNA by using the single pair of primers by using the human mitochondrial DNA as a template to obtain a human mitochondrial DNA complete sequence, wherein the reaction system for the PCR amplification comprises the following components in the following volume ratio by taking the volume of 25 mul as a reference:
wherein the concentration of the template DNA is 30-100 ng/. mu.l, the concentration of the primer is 10. mu. mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/. mu.l.
The PCR amplification process comprises the following steps:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
In a second aspect, the present application provides a kit for full-sequence amplification of human mitochondrial DNA, comprising a single pair of primers, wherein the sequences of the single pair of primers are:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3' are provided.
Preferably, the kit further comprises: ddH2O, PCR Buffer, primers and TKS Gflex DNA Polymerase, wherein the primers are the single pair of primers.
Preferably, in said kit, ddH2The volume ratio of the O, the PCR Buffer, the primers and the TKS Gflex DNA Polymerase is 11:12.5:0.5:0.5, wherein the concentration of the primers is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
According to the method for amplifying the complete sequence of the human mitochondrial DNA, the human mitochondrial DNA is amplified by adopting a specific single primer pair, the amplification area reaches 16569bp, and the complete sequence amplification of the human mitochondrial DNA is realized. The method provided by the application can completely amplify the whole circular mitochondrial DNA and cover all possible mutation types on the circular mitochondrial DNA. Compared with the existing database construction technology of the second-generation sequencing, the method improves the integrity and the accuracy of the human mitochondrial DNA amplification product, provides a more accurate sample for the second-generation sequencing, thereby being capable of amplifying the detection range and greatly reducing the possibility of missed detection of the second-generation sequencing. In addition, compared with the method for amplifying the whole mitochondria by using a plurality of pairs of primers, when amplification is carried out, the amplification of the DNA of the whole mitochondria can be realized by only one PCR (polymerase chain reaction) amplification time (about 6h) for a single sample, the operation is simpler and quicker, time and labor are saved, and the cost of the required reaction system is greatly reduced.
The kit for amplifying the human mitochondrial DNA complete sequence contains a single primer pair with a specific sequence, and the primer can realize the complete sequence amplification of the human mitochondrial DNA, so that only one DNA template is needed during single sample detection, the use amount of the template DNA is reduced, and the kit is particularly suitable for detection of precious samples and some special samples difficult to take materials.
Drawings
In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed to be used in the embodiments or the prior art descriptions will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings based on these drawings without inventive exercise.
FIG. 1 is an electrophoretogram of PCR products provided in examples 1 and 2 of the present invention;
FIG. 2 is an electrophoretogram of PCR products provided in comparative example 1 and comparative example 2 of the present invention;
FIG. 3 is a report of quality of sequencing of PCR products amplified to the full sequence of mitochondria by a single primer pair of example 1 and a triple primer pair of comparative example 1;
FIG. 4 is a graph of the depth of coverage per base obtained by second-generation sequencing after pooling of PCR products of mitochondrial full sequences amplified by a single primer pair of example 1 and a three primer pairs of comparative example 1;
FIG. 5 is a schematic of the mutation sites viewed by IGV software after second-generation sequencing of the PCR products of example 1;
FIG. 6 is a schematic of the mutation sites viewed by IGV software after second-generation sequencing of the PCR products of example 2.
Detailed Description
In order to make the technical problems, technical solutions and advantageous effects to be solved by the present invention more clearly apparent, the present invention is further described in detail below with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
In the description of the present invention, it is to be understood that the terms "first" and "second" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated, but not as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include one or more of that feature. In the description of the present invention, "a plurality" means two or more unless specifically defined otherwise.
As the human mitochondrial DNA has a double-chain circular supercoiled structure and a long sequence with a full length of 16569bp, the technology of single primer amplification has a bottleneck. For this reason, the current library construction of the next generation sequencing still realizes the amplification of the whole sequence of the human mitochondrial DNA based on multiple primer pairs, and related single primer pairs are not searched for to realize the amplification of the whole sequence of the human mitochondrial DNA. In view of this, it is preferable that,
in a first aspect, the embodiments of the present application provide a method for amplifying a complete sequence of human mitochondrial DNA, the method comprising:
s01, designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3' are provided.
The design of primers is especially important for the amplification of the complete sequence of human mitochondrial DNA. The single primer pair provided by the embodiment of the application has the sequence, and the amplification of the complete sequence of the human mitochondrial DNA can be realized through the single primer. Wherein, the forward primer has 23 bases and is designed at the base sequence of 15750-15772bp (from 5 'end to 3' end) of the human mitochondrial DNA; the reverse primer has 21 bases and is designed at the base sequence of 15729-15749bp (5 'end to 3' end) at the position of mitochondria. In addition, the primer pair having the above sequence avoids three hypervariable regions in the non-coding region of human mitochondrial DNA. These three hypervariable regions are: a first hypervariable region at position 16024-16365bp, a second hypervariable region at position 3-340bp and a third hypervariable region at position 438-574 bp. By avoiding the three hypervariable regions, the influence of the polymorphic sites on the integrity and accuracy of the amplified sequence can be reduced, thereby improving the accuracy of the amplified product. On the other hand, in the example of the present application, the forward primer was 15750-15772bp of the mitochondrial DNA, the reverse primer was 15729-15749bp of the mitochondrial DNA, the positions 15749 and 15750 were the linked base positions, and the forward primer and the reverse primer could be linked. In this case, when the whole mitochondria is amplified, the whole mitochondrial DNA can be amplified without gaps and without overlapping regions.
S02, using human mitochondrial DNA as a template, and performing PCR amplification on the human mitochondrial DNA by adopting a single pair of primers to obtain a human mitochondrial DNA complete sequence.
In some embodiments, human mitochondrial DNA is provided using a human whole genome kit
Blood L extraction. Exemplary, human genome-wide kits
The method for extracting human mitochondrial DNA by Blood L comprises the following steps: taking a 15ml Tube, adding 2ml of the Tube containing human mitochondriaUniformly mixing and oscillating a blood sample, 150ul of protease k and 2ml of Buffer BQ1 for 10s, and incubating for 15-20 min in a 56 ℃ water bath kettle; cooling the incubated mixed solution to room temperature, adding 2ml of absolute ethyl alcohol into the tube, and reversing and uniformly mixing for 10 times; taking a collecting pipe containing a filter column, adding the 3ml mixed solution into the collecting pipe, centrifuging at 4500g for 3min, continuously adding the rest mixed solution into the collecting pipe, centrifuging at 4500g for 5min, and discarding the filtrate; 2ml of Buffer BQ2 was added to the collection tube and washed by centrifugation at 4500g for 2 min; 2ml of Buffer BQ2 was added to the collection tube and centrifuged at 4500g for 10min for rewashing; the filter column in the collection tube was placed in a new collection tube, 200ul of preheated (70 ℃) Buffer BE solution was added, the mixture was left at room temperature for 2min to dissolve, 4500g was centrifuged for 2min to elute, and the eluted genomic DNA solution was absorbed in a 1.5ml EP tube and the concentration was measured for further use.
In the examples of this application, a single pair of primers is used to perform PCR amplification on human mitochondrial DNA, including: and (3) configuring a reaction system for PCR amplification. In some embodiments, the reaction system for PCR amplification comprises the following components in the following volume ratio based on the volume of 25-50 μ l in total volume:
wherein the primers are the single pair of primers, the concentration of the template DNA is 30-100 ng/mu L, the concentration of the primers is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
It is to be understood that the total volume of the reaction system is not limited to 25 to 50. mu.l, and when the total volume of the reaction system is not 25 to 50. mu.l, the contents of the above-mentioned respective components are adjusted with reference to the above-mentioned content range ratio.
The reaction system realizes the full-sequence amplification of a single primer pair, and can ensure that the whole mitochondrial DAN is amplified to carry out subsequent next-generation sequencing analysis under the condition of using a small amount of template DNA.
Illustratively, in the step of performing PCR amplification on human mitochondrial DNA by using a single pair of primers, the reaction system for PCR amplification comprises the following components in the following volume ratio based on a total volume of 25 μ l:
in some embodiments, PCR amplification of human mitochondrial DNA using a single pair of primers comprises the following protocol:
preheating at 94-98 deg.C for 1-2 min;
denaturing at 98 deg.c for 10-15 sec; annealing at 65-68 deg.C for 30-60 sec; extending at 68 deg.C for 10-14 min; repeating the procedures of denaturation, annealing and extension for 30 cycles;
extending at 68-70 deg.C for 30-45 min;
keeping the temperature at 10-12 ℃.
Under such PCR amplification conditions, the entire human mitochondrial DNA can be amplified using as little time as possible.
Illustratively, PCR amplification of human mitochondrial DNA using a single pair of primers includes:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
According to the method for amplifying the complete sequence of the human mitochondrial DNA, the human mitochondrial DNA is amplified by adopting a specific single primer pair, the amplification area reaches 16569bp, and the complete sequence amplification of the human mitochondrial DNA is realized. The method provided by the application can completely amplify the whole circular mitochondrial DNA and cover all possible mutation types on the circular mitochondrial DNA. Compared with the existing database construction technology of the second-generation sequencing, the method improves the integrity and the accuracy of the human mitochondrial DNA amplification product, provides a more accurate sample for the second-generation sequencing, thereby being capable of amplifying the detection range and greatly reducing the possibility of missed detection of the second-generation sequencing. In addition, compared with the method for amplifying the whole mitochondria by using a plurality of pairs of primers, when amplification is carried out, the amplification of the DNA of the whole mitochondria can be realized by only one PCR (polymerase chain reaction) amplification time (about 6h) for a single sample, the operation is simpler and faster, time and labor are saved, and the cost of the required reaction system is greatly reduced.
As a preferred embodiment, the method for amplifying the complete sequence of human mitochondrial DNA comprises:
designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively;
using human mitochondrial DNA as a template, and performing PCR amplification on the human mitochondrial DNA by adopting a single pair of primers to obtain a human mitochondrial DNA complete sequence, wherein the reaction system for the PCR amplification comprises the following components in the following volume ratio by taking the volume of 25 mul as a reference:
the PCR amplification process comprises the following steps:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
In a second aspect, the present invention provides a kit for amplifying a full sequence of human mitochondrial DNA, comprising a single pair of primers, wherein the sequences of the single pair of primers are:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3' are provided.
In some embodiments, the kit further comprises: ddH2O, PCR Buffer, template DNA, Primer and TKS Gflex DNA Polymerase. The reaction system can ensure that the whole mitochondrial DNA is amplified to carry out subsequent second-generation sequencing analysis under the condition of using a small amount of template DNA.
Preferably, in the kit, ddH2The volume ratio of the O, the PCR Buffer, the primers and the TKS Gflex DNA Polymerase is 11:12.5:0.5:0.5, wherein the concentration of the primers is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
When the kit provided by the application is used for detecting template DNA (human mitochondrial DNA sample to be detected), ddH (deoxyribose nucleic acid)2The volume ratio of the O, the PCR Buffer, the template DNA, the primers and the TKS Gflex DNA Polymerase is 11:12.5:0.5:0.5, wherein the concentration of the template DNA is 30-100 ng/mu L, the concentration of the primers is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
The kit for amplifying the complete sequence of the human mitochondrial DNA provided by the embodiment of the application contains a single primer pair with a specific sequence, and the primer can realize the complete sequence amplification of the human mitochondrial DNA, so that only one DNA template is needed during the detection of a single sample, the use amount of the template DNA is reduced, and the kit is suitable for the detection of precious samples and some special samples which are difficult to obtain materials.
The following description will be given with reference to specific examples.
Example 1
3 patients with mitochondrial maternally inherited deafness were examined, including:
(1) the collected 3 mitochondrial maternal hereditary hearing loss patients were labeled D1, D2 and D3, respectively, according to the human genome-wide kit
Blood L's instructions for DNA extraction from peripheral Blood of D1, D2, and D3, and the concentration of the extracted DNA was measured and diluted to 30-100 ng/ul.
(2) The human mitochondrial DNA was used as a template and a single pair of primers (forward 5'-CTAACCTGAATCGGAGGACAACC-3', reverse 5'-AATGAGGAGGTCTGCGGCTAG-3') was used to perform PCR amplification on D1, D2, and D3 to obtain the human mitochondrial DNA full sequence. Wherein, the reaction system for PCR amplification of a single pair of primers comprises the following components in the following volume ratio by taking the volume of 25 mul as the reference:
the PCR amplification process with a single pair of primers is as follows:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature was maintained at 12 ℃.
The PCR product obtained in example 1 was detected by 0.7% agarose gel electrophoresis, and the results of the electrophoresis are shown in FIG. 1. In the figure, marker is the molecular weight of lambda-Hind III digest DNA; d1, D2, D3 represent 3 samples of hereditary deafness of mitochondrial maternal line. As can be seen from FIG. 1, the band size of the amplification product of the PCR product obtained in example 1 is clear.
Comparative example 1
The difference from example 1 is that: in the step (2), three pairs of primer pairs D1, D2 and D3 are used simultaneously to perform PCR amplification of the whole mitochondrial complete sequence to obtain a PCR product. Wherein, the three pairs of primers are respectively as follows:
primer set 1
F1：CCCACTCCCATACTACTAATCTCATC
R1：TAAGGAGAAGATGGTTAGGTCTACGG
F2：TCTAGGTAACGACCACATCTACAACG
R2：TTTAGAAGGGCTATTTGTTGTGGG
F3：CTATAACCACCCTAACCCTGACTTC
R3：TCAGTGTATTGCTTTGAGGAGGTAAG
The PCR product obtained in comparative example 1 was detected by 0.7% agarose gel electrophoresis, and the results of the electrophoresis are shown in FIG. 2. In the figure, marker is the molecular weight of 1kb DNA; the serial numbers 1, 2 and 3 represent mitochondrial maternal hereditary hearing loss samples D1; numbers 4, 5, 6 represent mitochondrial maternal hereditary hearing loss sample D2; the numbers 7, 8 and 9 represent mitochondrial maternally inherited deafness samples D3. As can be seen from FIG. 2, the band result of the amplified product of the PCR product obtained in comparative example 1 is clear.
The PCR products of the mitochondria full sequence amplified by the single pair of primers in the example 1 and the three pairs of primers in the comparative example 1 are built on a library, detected by an Ion Torrent next-generation sequencing platform, and then subjected to bioinformatics analysis to generate a sequencing quality report, as shown in FIG. 3. And (4) report display: the mitochondrial DNA can reach 100% coverage and more than 99.9% homogeneity in the sequencing depth of the sample sequenced by the method of example 1 through the single pair primer amplified mitochondrial full sequence library.
The depth of coverage per base obtained by second-generation sequencing after library construction of PCR products amplified to have complete mitochondrial sequences by the single primer pair in example 1 and the three primer pairs in comparative example 1 is shown in FIG. 4. As can be seen from the figure: amplification with a single primer pair ( columns 1 and 3 fitted plots) was more uniform (more gentle curve) and highly reproducible (essentially uniform curve shape) across multiple samples when sequenced over the full length of the mitochondria than amplification with multiple primer pairs ( columns 2 and 4 fitted plots).
Example 1 complete m.1555A > G mutation was detected in deaf family samples in the second-generation sequencing after library construction of PCR products with a single pair of primers amplifying the complete sequence of mitochondria, wherein the mutation site schematic diagram viewed by IGV software after the second-generation sequencing of PCR products is shown in FIG. 5, which accords with the genetic pattern and clinical phenotype of the disease. It can be observed from the graph that the m.1555a > G mutation load at the central position of the graph (the first column of the longitudinal gray display area) reached 100% in all three examined samples, matching the clinical analysis results. From the size of the band generated by the electrophoresis of the PCR product of the sample in FIG. 1 and the analysis result of the second generation sequencing in FIG. 5, it can be seen that the amplification of the full sequence of the human mitochondrial DNA is realized in example 1, and the result is accurate.
Example 2
3 Leber hereditary optic neuropathy samples were tested, including:
(1) the 3 collected Leber hereditary optic neuropathy samples were labeled as L1, L2, L3, respectively, according to the human genome-wide kit
Blood L's instructions for DNA extraction of peripheral Blood L1, L2, L3, and the concentration of the extracted DNA was measured and diluted to 30-100 ng/ul.
(2) The human mitochondrial DNA was used as a template and a single pair of primers (forward 5'-CTAACCTGAATCGGAGGACAACC-3', reverse 5'-AATGAGGAGGTCTGCGGCTAG-3') was used to perform PCR amplification on D1, D2, and D3 to obtain the human mitochondrial DNA full sequence. Wherein, the reaction system for PCR amplification of a single pair of primers comprises the following components in the following volume ratio by taking the volume of 25 mul as the reference:
the PCR amplification process with a single pair of primers is as follows:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
The PCR product obtained in example 2 was detected by 0.7% agarose gel electrophoresis, and the results of the electrophoresis are shown in FIG. 1. In the figure, marker is the molecular weight of lambda-Hind III digestDNA; l1, L2, L3 represent 3 Leber hereditary optic neuropathy specimens. As can be seen from FIG. 1, the band size of the amplification product of the PCR product obtained in example 1 is clear.
Comparative example 2
The difference from example 2 is that: in the step (2), three pairs of primer pairs D1, D2 and D3 are used simultaneously to perform PCR amplification of the whole mitochondrial complete sequence to obtain a PCR product.
Wherein, the three pairs of primers are respectively as follows:
primer set 1
F1：CCCACTCCCATACTACTAATCTCATC
R1：TAAGGAGAAGATGGTTAGGTCTACGG
F2：TCTAGGTAACGACCACATCTACAACG
R2：TTTAGAAGGGCTATTTGTTGTGGG
F3：CTATAACCACCCTAACCCTGACTTC
R3：TCAGTGTATTGCTTTGAGGAGGTAAG
The PCR product obtained in comparative example 1 was detected by 0.7% agarose gel electrophoresis, and the results of the electrophoresis are shown in FIG. 2. In the figure, marker is the molecular weight of 1kb DNA; numbers 10, 11, 12 represent Leber hereditary optic neuropathy sample L1; sequence numbers 13, 14, 15 represent Leber hereditary optic neuropathy specimen L2; the numbers 16, 17, 18 represent the Leber hereditary optic neuropathy specimen L3. As can be seen from FIG. 2, the band result of the amplified product of the PCR product obtained in comparative example 1 is clear.
The depth of coverage per base obtained by second-generation sequencing after library construction of PCR products of the mitochondrial full sequence amplified by the single primer pair of example 2 and the three primer pairs of comparative example 2 is shown in FIG. 4. As can be seen from the figure: amplification with a single primer pair ( columns 1 and 3 fitted plots) was more uniform (more gentle curve) and highly reproducible (essentially uniform curve shape) across multiple samples when sequenced over the full length of the mitochondria than amplification with multiple primer pairs ( columns 2 and 4 fitted plots).
Example 2 Single primer amplification of mitochondrial full sequence PCR products in second-generation sequencing after pooling the Leber hereditary optic neuropathy samples detected the presence of m.14495A > G mutations in Leber hereditary optic neuropathy, and the mutation load conditions detected in the samples were consistent with the hereditary pattern and clinical phenotype of Leber hereditary optic neuropathy. The schematic diagram of the mutation sites after the second-generation sequencing of the PCR products and the inspection by IGV software is shown in FIG. 6. From the plot, m.14495A > G mutations present in Leber's hereditary optic neuropathy were observed at the central position of the plot (central longitudinal gray display region), and the mutation load profile detected in the sample corresponded to the genetic pattern and clinical phenotype of Leber's hereditary optic neuropathy. From the size of the band generated by the electrophoresis of the PCR product of the sample in FIG. 2 and the analysis result of the second generation sequencing in FIG. 6, it can be seen that the amplification of the full sequence of the human mitochondrial DNA is realized in example 2, and the result is accurate.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and improvements made within the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Claims (10)
1. A method for full-sequence amplification of human mitochondrial DNA, comprising:
designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively;
and carrying out PCR amplification on the human mitochondrial DNA by using the single pair of primers by using the human mitochondrial DNA as a template to obtain a human mitochondrial DNA complete sequence.
2. The method for amplifying the complete sequence of the human mitochondrial DNA according to claim 1, wherein the step of performing PCR amplification on the human mitochondrial DNA by using the single pair of primers comprises the following components in the following volume ratio in a reaction system for PCR amplification, based on a total volume of 25-50 μ l:
wherein the primer is the single pair of primers, the concentration of the template DNA is 30-100 ng/mu L, the concentration of the primer is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
3. The method of claim 1, wherein the PCR amplification of the human mitochondrial DNA using the single pair of primers comprises:
preheating at 94-98 deg.C for 1-2 min;
denaturing at 98 deg.c for 10-15 sec; annealing at 65-68 deg.C for 30-60 sec; extending at 68 deg.C for 10-14 min; repeating the procedures of denaturation, annealing and extension for 30 cycles;
extending at 68-70 deg.C for 30-45 min;
keeping the temperature at 10-12 ℃.
4. The method for amplifying the complete sequence of human mitochondrial DNA according to any one of claims 1 to 3, wherein the step of performing PCR amplification on the human mitochondrial DNA by using the single pair of primers comprises the following components in the following volume ratio in a reaction system for the PCR amplification, based on a total volume of 25 μ l:
wherein the concentration of the template DNA is 30-100 ng/. mu.l, the concentration of the primer is 10. mu. mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/. mu.l.
5. The method for amplifying the complete sequence of the human mitochondrial DNA according to any one of claims 1 to 3, wherein the PCR amplification of the human mitochondrial DNA using the single pair of primers comprises:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
6. The method for amplifying the complete sequence of human mitochondrial DNA according to any one of claims 1 to 3, wherein the human mitochondrial DNA is obtained by using a human whole genome kit
Blood L extraction.
7. The method for full-sequence amplification of human mitochondrial DNA according to any of claims 1 to 3, comprising:
designing a single pair of primers for amplifying the complete sequence of the human mitochondrial DNA, wherein the sequences of the single pair of primers are as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3', respectively;
and carrying out PCR amplification on the human mitochondrial DNA by using the single pair of primers by using the human mitochondrial DNA as a template to obtain a human mitochondrial DNA complete sequence, wherein the reaction system for the PCR amplification comprises the following components in the following volume ratio by taking the volume of 25 mul as a reference:
wherein the concentration of the template DNA is 30-100 ng/. mu.l, the concentration of the primer is 10. mu. mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/. mu.l;
the PCR amplification process comprises the following steps:
preheating at 94 deg.C for 1 min;
denaturing at 98 deg.C for 10 sec; annealing at 65 deg.C for 30 sec; extending for 10min at 68 deg.C; repeating the procedures of denaturation, annealing and extension for 30 cycles;
further extension for 30min at 68 deg.C;
the temperature is kept at 12 ℃.
8. A kit for full-sequence amplification of human mitochondrial DNA, comprising a single pair of primers, wherein the sequence of the single pair of primers is as follows:
a forward primer: 5'-CTAACCTGAATCGGAGGACAACC-3'
Reverse primer: 5'-AATGAGGAGGTCTGCGGCTAG-3' are provided.
9. The kit for full sequence amplification of human mitochondrial DNA according to claim 8, further comprising: ddH2O, PCR Buffer, primers and TKS Gflex DNA Polymerase, wherein the primers are the single pair of primers.
10. The kit for full-sequence amplification of human mitochondrial DNA according to claim 9, wherein in the kit, ddH2The volume ratio of the O, the PCR Buffer, the primers and the TKS Gflex DNA Polymerase is 11:12.5:0.5:0.5, wherein the concentration of the primers is 10 mu mol/L, and the concentration of the TKS Gflex DNA Polymerase is 1.25U/mu L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011137777.4A CN112301098A (en) | 2020-10-22 | 2020-10-22 | Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011137777.4A CN112301098A (en) | 2020-10-22 | 2020-10-22 | Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112301098A true CN112301098A (en) | 2021-02-02 |
Family
ID=74328518
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011137777.4A Pending CN112301098A (en) | 2020-10-22 | 2020-10-22 | Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112301098A (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101270390A (en) * | 2008-04-15 | 2008-09-24 | 西安交通大学 | 26-pair PCR primer for mitochondrion sequencing and parting method based on the primer |
| CN101768635A (en) * | 2009-01-05 | 2010-07-07 | 中南大学 | ARMS-PCR method for mtDNA allelic gene typing and point mutation detecting |
| CN101875966A (en) * | 2009-04-30 | 2010-11-03 | 海南大学 | Improved mitochondrial genome complete sequence determination method |
| CA2920588A1 (en) * | 2013-08-06 | 2015-02-12 | Bergen Teknologioverforing As | Method for detection of pyrethroid resistance in crustaceans and oligonucleotide sequences useful in detection of pyrethroid resistance. |
| CN105779590A (en) * | 2016-03-16 | 2016-07-20 | 北京迈基诺基因科技有限责任公司 | Capture probe set and kit for detecting human mitochondrial genes |
| CN106754903A (en) * | 2016-12-20 | 2017-05-31 | 北京信诺佰世医学检验所有限公司 | The primer pair and method of a kind of whole genome amplification for human mitochondrial |
| CN106755456A (en) * | 2017-01-09 | 2017-05-31 | 北京圣谷智汇医学检验所有限公司 | For the primer combination of mitochondria full-length genome detection and kit |
-
2020
- 2020-10-22 CN CN202011137777.4A patent/CN112301098A/en active Pending
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101270390A (en) * | 2008-04-15 | 2008-09-24 | 西安交通大学 | 26-pair PCR primer for mitochondrion sequencing and parting method based on the primer |
| CN101768635A (en) * | 2009-01-05 | 2010-07-07 | 中南大学 | ARMS-PCR method for mtDNA allelic gene typing and point mutation detecting |
| CN101875966A (en) * | 2009-04-30 | 2010-11-03 | 海南大学 | Improved mitochondrial genome complete sequence determination method |
| CA2920588A1 (en) * | 2013-08-06 | 2015-02-12 | Bergen Teknologioverforing As | Method for detection of pyrethroid resistance in crustaceans and oligonucleotide sequences useful in detection of pyrethroid resistance. |
| CN105779590A (en) * | 2016-03-16 | 2016-07-20 | 北京迈基诺基因科技有限责任公司 | Capture probe set and kit for detecting human mitochondrial genes |
| CN106754903A (en) * | 2016-12-20 | 2017-05-31 | 北京信诺佰世医学检验所有限公司 | The primer pair and method of a kind of whole genome amplification for human mitochondrial |
| CN106755456A (en) * | 2017-01-09 | 2017-05-31 | 北京圣谷智汇医学检验所有限公司 | For the primer combination of mitochondria full-length genome detection and kit |
Non-Patent Citations (3)
| Title |
|---|
| REYNIER, P.等: "Accumulation of Deletions in MtDNA During Tissue Aging: Analysis by Long PCR", 《BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS》 * |
| S.ANDERSON等: "Sequence and organization of the human mitochondrial genome", 《NATURE》 * |
| SUZANNE CHENG等: "Complete mitochondrial genome amplification", 《NATURE GENETICS》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106906211B (en) | Molecular joint and application thereof | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| CN109055532B (en) | Primer composition for genetic deafness gene detection before embryo implantation, kit and application | |
| CN113025701A (en) | Early screening method and kit for non-alcoholic fatty liver disease susceptibility gene | |
| CN108048565A (en) | A kind of primer for detecting ApoE gene pleiomorphisms and its detection method and application | |
| CN113151412B (en) | Specific primer and probe for detecting residual DNA content of MDCK cells and real-time fluorescent quantitative PCR kit | |
| CN109295500B (en) | Single cell methylation sequencing technology and application thereof | |
| CN110846409A (en) | Primer combination for detecting TNNI3K gene mutation and application thereof | |
| CN106755352A (en) | Nucleic acid, kit and method for quick detection ABCB1 gene C 3435T polymorphisms | |
| Almeida et al. | Authentication of human and mouse cell lines by short tandem repeat (STR) DNA genotype analysis | |
| CN112592981B (en) | Primer group, kit and method for DNA archive construction | |
| CN109280696B (en) | Method for splitting mixed sample by SNP detection technology | |
| CN111394434B (en) | CHO host cell DNA residue detection kit adopting TaqMan probe method and application thereof | |
| CN109182493A (en) | The primer and kit and its detection method of people's 16p11.2 microdeletion syndrome detection | |
| CN113005196A (en) | Primer and probe composition for detecting turner syndrome, non-diagnostic detection method and kit | |
| CN112301098A (en) | Method for amplifying human mitochondrial DNA complete sequence and kit for amplifying human mitochondrial DNA complete sequence | |
| CN113025702B (en) | Early screening method and kit for ankylosing spondylitis susceptibility genes | |
| CN113322317A (en) | Primer pair, probe set and kit for mitochondrial obesity gene mutation detection | |
| CN112080556A (en) | Method for performing multiple rapid sequencing on gonococcus drug-resistant gene | |
| CN110819701A (en) | Method for detecting CYP2D6 gene polymorphism by fluorescent quantitative PCR | |
| CN115961051A (en) | Screening of schistosoma japonicum W chromosome specific gene and application thereof in cercaria sex identification | |
| CN116445596B (en) | Product and method for human genotyping and application thereof | |
| CN116622862B (en) | Cotton mouse microsatellite molecular marker, primer pair and application thereof, and cotton mouse genetic detection method | |
| CN112646869B (en) | Guidance method and kit for atorvastatin personalized medicine genes | |
| CN112831558B (en) | Early screening method and kit for Crohn disease susceptibility genes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |