CN112280803B

CN112280803B - Construction method of Tks4 gene knock-out mouse

Info

Publication number: CN112280803B
Application number: CN202011164525.0A
Authority: CN
Inventors: 何潇潇; 李胜男; 王亘垚; 朱筱娟
Original assignee: Northeast Normal University
Current assignee: Northeast Normal University
Priority date: 2020-10-27
Filing date: 2020-10-27
Publication date: 2022-07-01
Anticipated expiration: 2040-10-27
Also published as: CN112280803A

Abstract

The invention provides a construction method of a Tks4 gene knock-out mouse, belonging to the technical field of genetic engineering, wherein a Tks4 gene of a mouse is knocked out by utilizing sgRNA1 and sgRNA9 to obtain a Tks4 gene knock-out mouse; the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of the sgRNA9 is shown in SEQ ID No. 2. The invention utilizes sgRNA1 and sgRNA9 to knock out the Tks4 gene of a mouse, and obtains a Tks4 gene knock-out mouse.

Description

Construction method of Tks4 gene knock-out mouse

Technical Field

The invention belongs to the technical field of genetic engineering, and particularly relates to a construction method of a Tks4 gene knock-out mouse.

Background

Tks4(Tyrosine kinase substrate with four SH3 domains) is a protein product of SH3PXD2B (also called Tks4 gene) which is a disease-causing gene of a recessive genetic disease-FTHS syndrome (Frank-Ter Haar syndrome), and has 1 PX structural domain and 4 SH3 structural domains. Previous studies have shown that Tks4 plays a major role in pseudopodia formation and motility, actin cytoskeleton remodeling, reactive oxygen species production, and adipose tissue generation and differentiation. The Tks4 gene is located on chromosome 11 of the mouse genome, approximately spanning the 80.4kb genome range, and contains 13 exons and 12 introns. As an important pathogenic factor, the prior art has not reported how to knock out the Tks4 gene.

Disclosure of Invention

In view of the above, the invention aims to provide a construction method of a Tks4 gene knock-out mouse, and the invention utilizes sgRNA1 and sgRNA9 to knock out the Tks4 gene of the mouse, so as to obtain a Tks4 gene knock-out mouse.

In order to achieve the above purpose, the invention provides the following technical scheme:

the invention provides a construction method of a Tks4 gene knock-out mouse, which comprises the steps of knocking out a Tks4 gene of a mouse by utilizing sgRNA1 and sgRNA9 to obtain a Tks4 gene knock-out mouse;

the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of the sgRNA9 is shown in SEQ ID No. 2.

Preferably, the mass ratio of the sgRNA1 to the sgRNA9 is 0.5-1.5: 0.5-1.5.

Preferably, the mass ratio of the sgRNA1 to the sgRNA9 is 1: 1.

Preferably, the method further comprises the following steps: cas9mRNA, sgRNA1 and sgRNA9 are introduced into the nucleus of a mouse fertilized egg cell to obtain a Tks4 gene knock-out mouse.

Preferably, the nucleotide sequence of the Cas9mRNA is shown as SEQ ID No. 3.

Preferably, the mass ratio of the Cas9mRNA to the sgRNA1 and the sgRNA9 is 1.5-2.5: 0.3-0.8.

Preferably, the mass ratio of the Cas9mRNA to the sgRNA1 and the sgRNA9 is 2:0.5: 0.5.

Preferably, Tks4 gene knock-out mice are identified by using a primer pair, wherein the nucleotide sequences of the upstream primer and the downstream primer of the primer pair are shown as SEQ ID No.4 and 5 respectively.

The invention provides a construction method of a Tks4 gene knock-out mouse, which comprises the steps of knocking out a Tks4 gene of a mouse by utilizing sgRNA1 and sgRNA9 to obtain a Tks4 gene knock-out mouse; the sgRNA1 has a nucleotide sequence shown in SEQ ID No.1, and the sgRNA9 has a nucleotide sequence shown in SEQ ID No. 2.

The mechanism of knocking out the Tks4 gene is as follows: after Cas9mRNA and sgRNA1 and sgRNA9 are injected into the nucleus of fertilized eggs, Cas9mRNA is translated to generate Cas9 protein, Cas9 protein binds to sgRNA1 or sgRNA9 respectively, and is targeted to bind to intron No.2 and intron No.3 of Tks4 gene respectively by virtue of the sequence specificity of sgRNA1 or sgRNA9, so that DNA double-strand cleavage is formed in the two regions, and the exon No.3 region between intron No.2 and intron No.3 is deleted from chromosome 11, so that Tks4 protein cannot be expressed correctly.

Drawings

Fig. 1 is a test of sgRNA gene editing efficiency;

fig. 2 shows the results of in vitro transcription and purification of single-stranded sgrnas;

FIG. 3 is a schematic diagram of gene editing in Tks4 knockout mice;

FIG. 4 shows the genotype identification results of F0 mouse;

FIG. 5 shows the genotype identification results of F1 mouse;

FIG. 6 shows the detection of the knockout efficiency of Tks4 gene knockout mice.

Detailed Description

The invention provides a construction method of a Tks4 gene knock-out mouse, which comprises the steps of knocking out a Tks4 gene of a mouse by utilizing sgRNA1 and sgRNA9 to obtain a Tks4 gene knock-out mouse; the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of the sgRNA9 is shown in SEQ ID No. 2. In the invention, the mass ratio of the sgRNA1 to the sgRNA9 is preferably 0.5-1.5: 0.5-1.5, and more preferably 1: 1.

The sgRNA1 and sgRNA9 are designed according to the sequence characteristics of a Tks4 Gene (Gene ID is 268396) by using http:// criprp. mit. edu/website aiming at intron sequences on both sides of a No.3 exon of Tks4 and are used for knocking out the Tks4 Gene, wherein the sgRNA1 is designed according to a 3 'end intron region of the No.3 exon of Tks4, and the sgRNA9 is designed according to a 5' end intron region of the No.3 exon of Tks 4. The invention selects and cuts the exon No.3 for two reasons, the first reason, should lean to the front as much as possible while choosing and cutting the exon, the knockout effect reached after cutting is most obvious, the second reason, the exon cut can not be the multiple of 3 in length, otherwise may cause a new reading frame to produce, can not reach the goal of gene knockout completely, combine these two factors, the exon No.3 is the exon that the first length of the gene is not the multiple of 3, so is chosen as constructing and knocking off the target of the mouse. In the invention, the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.1, and specifically comprises the following steps:

CTGTTGTAACTCGCCAATGA；

the nucleotide sequence of the sgRNA9 is shown in SEQ ID No.2, and specifically comprises the following steps:

TGGTCGTATAAAGATGGTGC。

in the present invention, the construction method of the Tks4 gene knock-out mouse preferably further comprises: cas9mRNA, sgRNA1 and sgRNA9 are introduced into mouse fertilized egg cell nucleus to obtain Tks4 gene knockout mouse. The source of the mouse is not particularly limited, and C57BL/6J mice which are used for gene knockout in a conventional way can be adopted, and C57BL/6J mice can be purchased.

In the present invention, the Cas9mRNA functions as: translation into Cas9 protein in fertilized eggs, followed by cleavage of the genomic DNA molecule by Cas9 protein under the guidance of the sgrnas. In the invention, the nucleotide sequence of the Cas9mRNA is shown as SEQ ID No.3, which is specifically as follows:

ATGGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAGAGATCTTCAGCAACGAGATGGCCAAGGTGGACGACAGCTTCTTCCACAGACTGGAAGAGTCCTTCCTGGTGGAAGAGGATAAGAAGCACGAGCGGCACCCCATCTTCGGCAACATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGAGAAAGAAACTGGTGGACAGCACCGACAAGGCCGACCTGCGGCTGATCTATCTGGCCCTGGCCCACATGATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACAGCGACGTGGACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAAAACCCCATCAACGCCAGCGGCGTGGACGCCAAGGCCATCCTGTCTGCCAGACTGAGCAAGAGCAGACGGCTGGAAAATCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAATGGCCTGTTCGGAAACCTGATTGCCCTGAGCCTGGGCCTGACCCCCAACTTCAAGAGCAACTTCGACCTGGCCGAGGATGCCAAACTGCAGCTGAGCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAGATCGGCGACCAGTACGCCGACCTGTTTCTGGCCGCCAAGAACCTGTCCGACGCCATCCTGCTGAGCGACATCCTGAGAGTGAACACCGAGATCACCAAGGCCCCCCTGAGCGCCTCTATGATCAAGAGATACGACGAGCACCACCAGGACCTGACCCTGCTGAAAGCTCTCGTGCGGCAGCAGCTGCCTGAGAAGTACAAAGAGATTTTCTTCGACCAGAGCAAGAACGGCTACGCCGGCTACATTGACGGCGGAGCCAGCCAGGAAGAGTTCTACAAGTTCATCAAGCCCATCCTGGAAAAGATGGACGGCACCGAGGAACTGCTCGTGAAGCTGAACAGAGAGGACCTGCTGCGGAAGCAGCGGACCTTCGACAACGGCAGCATCCCCCACCAGATCCACCTGGGAGAGCTGCACGCCATTCTGCGGCGGCAGGAAGATTTTTACCCATTCCTGAAGGACAACCGGGAAAAGATCGAGAAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCTCTGGCCAGGGGAAACAGCAGATTCGCCTGGATGACCAGAAAGAGCGAGGAAACCATCACCCCCTGGAACTTCGAGGAAGTGGTGGACAAGGGCGCTTCCGCCCAGAGCTTCATCGAGCGGATGACCAACTTCGATAAGAACCTGCCCAACGAGAAGGTGCTGCCCAAGCACAGCCTGCTGTACGAGTACTTCACCGTGTATAACGAGCTGACCAAAGTGAAATACGTGACCGAGGGAATGAGAAAGCCCGCCTTCCTGAGCGGCGAGCAGAAAAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAAGTGACCGTGAAGCAGCTGAAAGAGGACTACTTCAAGAAAATCGAGTGCTTCGACTCCGTGGAAATCTCCGGCGTGGAAGATCGGTTCAACGCCTCCCTGGGCACATACCACGATCTGCTGAAAATTATCAAGGACAAGGACTTCCTGGACAATGAGGAAAACGAGGACATTCTGGAAGATATCGTGCTGACCCTGACACTGTTTGAGGACAGAGAGATGATCGAGGAACGGCTGAAAACCTATGCCCACCTGTTCGACGACAAAGTGATGAAGCAGCTGAAGCGGCGGAGATACACCGGCTGGGGCAGGCTGAGCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACAATCCTGGATTTCCTGAAGTCCGACGGCTTCGCCAACAGAAACTTCATGCAGCTGATCCACGACGACAGCCTGACCTTTAAAGAGGACATCCAGAAAGCCCAGGTGTCCGGCCAGGGCGATAGCCTGCACGAGCACATTGCCAATCTGGCCGGCAGCCCCGCCATTAAGAAGGGCATCCTGCAGACAGTGAAGGTGGTGGACGAGCTCGTGAAAGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATCGAAATGGCCAGAGAGAACCAGACCACCCAGAAGGGACAGAAGAACAGCCGCGAGAGAATGAAGCGGATCGAAGAGGGCATCAAAGAGCTGGGCAGCCAGATCCTGAAAGAACACCCCGTGGAAAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAATGGGCGGGATATGTACGTGGACCAGGAACTGGACATCAACCGGCTGTCCGACTACGATGTGGACCATATCGTGCCTCAGAGCTTTCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCAGAAGCGACAAGAACCGGGGCAAGAGCGACAACGTGCCCTCCGAAGAGGTCGTGAAGAAGATGAAGAACTACTGGCGGCAGCTGCTGAACGCCAAGCTGATTACCCAGAGAAAGTTCGACAATCTGACCAAGGCCGAGAGAGGCGGCCTGAGCGAACTGGATAAGGCCGGCTTCATCAAGAGACAGCTGGTGGAAACCCGGCAGATCACAAAGCACGTGGCACAGATCCTGGACTCCCGGATGAACACTAAGTACGACGAGAATGACAAGCTGATCCGGGAAGTGAAAGTGATCACCCTGAAGTCCAAGCTGGTGTCCGATTTCCGGAAGGATTTCCAGTTTTACAAAGTGCGCGAGATCAACAACTACCACCACGCCCACGACGCCTACCTGAACGCCGTCGTGGGAACCGCCCTGATCAAAAAGTACCCTAAGCTGGAAAGCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATGATCGCCAAGAGCGAGCAGGAAATCGGCAAGGCTACCGCCAAGTACTTCTTCTACAGCAACATCATGAACTTTTTCAAGACCGAGATTACCCTGGCCAACGGCGAGATCCGGAAGCGGCCTCTGATCGAGACAAACGGCGAAACCGGGGAGATCGTGTGGGATAAGGGCCGGGATTTTGCCACCGTGCGGAAAGTGCTGAGCATGCCCCAAGTGAATATCGTGAAAAAGACCGAGGTGCAGACAGGCGGCTTCAGCAAAGAGTCTATCCTGCCCAAGAGGAACAGCGATAAGCTGATCGCCAGAAAGAAGGACTGGGACCCTAAGAAGTACGGCGGCTTCGACAGCCCCACCGTGGCCTATTCTGTGCTGGTGGTGGCCAAAGTGGAAAAGGGCAAGTCCAAGAAACTGAAGAGTGTGAAAGAGCTGCTGGGGATCACCATCATGGAAAGAAGCAGCTTCGAGAAGAATCCCATCGACTTTCTGGAAGCCAAGGGCTACAAAGAAGTGAAAAAGGACCTGATCATCAAGCTGCCTAAGTACTCCCTGTTCGAGCTGGAAAACGGCCGGAAGAGAATGCTGGCCTCTGCCGGCGAACTGCAGAAGGGAAACGAACTGGCCCTGCCCTCCAAATATGTGAACTTCCTGTACCTGGCCAGCCACTATGAGAAGCTGAAGGGCTCCCCCGAGGATAATGAGCAGAAACAGCTGTTTGTGGAACAGCACAAGCACTACCTGGACGAGATCATCGAGCAGATCAGCGAGTTCTCCAAGAGAGTGATCCTGGCCGACGCTAATCTGGACAAAGTGCTGTCCGCCTACAACAAGCACCGGGATAAGCCCATCAGAGAGCAGGCCGAGAATATCATCCACCTGTTTACCCTGACCAATCTGGGAGCCCCTGCCGCCTTCAAGTACTTTGACACCACCATCGACCGGAAGAGGTACACCAGCACCAAAGAGGTGCTGGACGCCACCCTGATCCACCAGAGCATCACCGGCCTGTACGAGACACGGATCGACCTGTCTCAGCTGGGAGGCGACTAA。

in the invention, the mass ratio of the Cas9mRNA to the sgRNA1 and the sgRNA9 is preferably 1.5-2.5: 0.3-0.8, and more preferably 2:0.5: 0.5.

In the present invention, after the Cas9mRNA, the sgRNA1 and the sgRNA9 are introduced into fertilized eggs of mice, the mice are obtained, and preferably identified by using primer pairs, the nucleotide sequences of the upstream and downstream primers of the primer pairs are respectively shown in SEQ id nos. 4 and 5, specifically as follows:

SEQ ID No.4：GAAGGGCATTCTAACACACCTGTCA；

SEQ ID No.5：CAGAGGCCAACCAAGAGAGAGAAGC。

in the invention, PCR amplification is carried out on the obtained rat tail tissue of the mouse by using the primer pair, and when the amplified fragment is 700-800bp, a Tks4 gene knock-out mouse is obtained. In the invention, the system used for PCR amplification comprises a system of 1 mu L of mouse tail DNA solution, 0.5 mu L of Taq enzyme, 1 mu L of dNTPs, 1 mu L of each primer and 10 mu L of Buffer, and 5.5 mu L of distilled water, wherein the total amount is 20 mu L; the reaction program used for the PCR amplification comprises: 94 ℃ for 2 min; 10s at 98 ℃, 30s at 67 ℃ (-0.7 ℃/cycle), 1kb/min at 68 ℃ and 15 cycles; 10s at 98 ℃, 30s at 56 ℃, 1kb/min at 68 ℃ and 25 cycles; 10min at 68 ℃; storing at 4 ℃.

The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.

Example 1

Using UCA^TM(Universal CRISPRACTIVITY Assay) method the gene editing efficiency of sgRNA1 and sgRNA9 was examined in an in vitro acellular system, and the results are shown in FIG. 1.

The method is used for detecting the shearing efficiency of the sgRNA1, and the results of three experiments are respectively 25.42%; 26.34% and 38.08%. The shear efficiency of the sgRNA9 is detected by the method, and the results of three experiments are 23.36% respectively; 22.89% and 23.24%

Comparative example 1

sgRNA2-7 was designed based on the 3' intron region of exon 3 of Tks4, with the following sequence:

sgRNA2(SEQ ID No.6)：TACCATGGAGCCGTCCCTCC；

sgRNA3(SEQ ID No.7)：CATGCATACAGCATAGGACC；

sgRNA4(SEQ ID No.8)：CAACATGTCGCTCTGTATTC；

sgRNA5(SEQ ID No.9)：CGTGTGAGATACCACAAAAC；

sgRNA6(SEQ ID No.10)：GTGGCTCATGCATACAGCAT；

sgRNA7(SEQ ID No.11)：CAGAGCATACAAGAATTGAG。

sgRNA8/10-14 was designed from the 5' intron region of exon 3 of Tks4, the sequence is as follows:

sgRNA8(SEQ ID No.12)：GCTCTACACCCGTGTCACAA；

sgRNA10(SEQ ID No.13)：TGAGAATGGTCGTATAAAGA；

sgRNA11(SEQ ID No.14)：AAGGAGGAACTGGGTCCCGG；

sgRNA12(SEQ ID No.15)：GCCAGATCTGGGATGCAAAC；

sgRNA13(SEQ ID No.16)：CATTTATAGGGATCCAAGAA；

sgRNA14(SEQ ID No.17)：TGTTGTTGCTCATATATGAC。

the gene editing efficiency of sgRNA was examined in the same manner as in example 1, and the results are shown in fig. 1.

The cleavage efficiencies mediated by the different sgrnas are shown in table 1.

TABLE 1 cleavage efficiency mediated by different sgRNAs

sgRNA2	sgRNA3	sgRNA4	sgRNA5	sgRNA6	sgRNA7
						24.48％	21.8％	0.77％	5.59％	6.59％	7.33％
22.28％	19.07％	0.69％	6.5％	8.76％	7.11％
						35.59％	31.75％	1.23％	8.84％	8.7％	9.65％
sgRNA8	sgRNA10	sgRNA11	sgRNA12	sgRNA13	sgRNA14
						10.09％	12.33％	16.97％	5.94％	6.67％	22.7％
9.76％	13.38％	18.41％	6.13％	7.99％	23.4％
						10.17％	14.85％	19.87％	6.57％	8.42％	23.9％

As can be seen from example 1 and comparative examples, sgRNA1 and sgRNA9 had the highest DNA cleavage efficiency at the 3 'and 5' ends of exon 3 of Tks4, respectively, and therefore sgRNA1 and sgRNA9 were selected to knock out the Tks4 gene. The sgRNA1 and the sgRNA9 were separately transcribed in vitro to obtain purified single-stranded sgrnas (fig. 2) for subsequent fertilized egg injection experiments.

Example 2

The sgRNA1 and the sgRNA9 purified in example 1 were mixed in equal mass ratio to prepare a sgRNA solution with a concentration of 50 ng/. mu.L, and then mixed with 100 ng/. mu.L of Cas9mRNA, with the mixing ratio of sgRNA to Cas9mRNA being 1: 2. Mixing, injecting into mouse fertilized egg nuclei, culturing fertilized egg in vitro to embryo stage, transferring into surrogate mother mouse uterus, performing PCR identification in born mice, and determining whether gene editing of Tks4 gene of each mouse exists, wherein the specific editing is shown in FIG. 3.

After injection, six F0 mice were obtained in total, and PCR detection was performed by using the primers shown in Table 2, wherein 1787bp bands should be obtained by PCR in wild type mice, and about 700-800bp bands should be obtained in knockout mice.

TABLE 2 Tks4 Gene knock-out mouse identification primers

The system used for PCR amplification is a system with 20 mu L of mouse tail DNA solution 1 mu L, Taq enzyme 0.5 mu L, dNTPs 1 mu L, primers 1 mu L and Buffer 10 mu L respectively, and distilled water 5.5 mu L; the reaction procedure is as follows: 94 ℃ for 2 min; 10s at 98 ℃, 30s at 67 ℃ (-0.7 ℃/cycle), 1kb/min at 68 ℃ and 15 cycles; 10s at 98 ℃, 30s at 56 ℃, 1kb/min at 68 ℃ and 25 cycles; 10min at 68 ℃; storing at 4 ℃.

The PCR results showed that, among the six F0-generation mice obtained, the 6 mouse showed the results of homozygous knockout, the 1, 2, 3 and 5 mice showed the results of heterozygous knockout, and the PCR results of the other mouse were identical to that of the wild type (fig. 4).

To determine the specific knock-out fragment, the genomes of mice from

generations

1, 2, 3 and 5 of F0 were sequenced and the results showed that each mouse had a deletion of a different fragment length.

TABLE 3 sequencing of the F0 mouse genome

In which F0 generation 5 mice were mated with C57BL6 mice to obtain stably inherited F1 generation mice, two of the

F1 generation

2 and 4 mice were Tks4 +/-mice, and the remainder were Tks4+/+ (FIG. 5). The Tks4 gene of No.2 and No.4 mice is sequenced and identified, and the size of the fragment knocked out by the offspring mouse is consistent with that of the parent and is 1200 bp.

Example 3

Detection of knockout efficiency of Tks4 gene knockout mouse

After F2-generation mice were obtained by mating the F1-generation heterozygous mice obtained in example 2 with C57 mice, Tks4 +/-heterozygote was made to mate with each other, and F3 mice were obtained, and genotype identification was performed using two pairs of primers shown in Table 1, and the genotype of the mice was judged as wild type, heterozygous knockout type, and homozygous knockout type by PCR bands (shown as A in FIG. 6, for example). After obtaining a homozygous mouse, protein samples of brain, heart, lung, liver and other regions of a Tks4#2 gene knock-out mouse and a littermate wild type #4 mouse are extracted, and the knock-out condition of a Tks4 gene knock-out mouse is verified by a Tks4 antibody (B in figure 6), and the result shows that the Tks4 protein cannot be detected at each part of the knock-out mouse. This result demonstrates the success of the construction of the Tks4 gene knock-out mouse.

In fig. 6, a is to identify the progeny of the Tks4 gene knock-out mouse, and firstly, primers in table 1 are used to verify whether the genomic DNA of the progeny mouse contains a Tks4 fragment after knock-out, and the band after knock-out is 768 bp. Primers (F: GAAGGGCATTCTAACACACCTGTCA and R: GAAAGCTCAAAAGCTGCAAGAGACC) are then used to verify whether the genomic DNA of the progeny mouse contains the wild type, the band is 366bp, and the PCR identification results of the wild type mouse, the heterozygous mouse and the homozygous knockout mouse are shown in the figure respectively. Western Blot experiment examined whether Tks4 was completely knocked out in Tks4 knock-out mice of generation F3, and completed knock-out of Tks4 was confirmed in brain, lung and heart of mice by using littermate wild-type mice as controls.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> northeast university

<120> construction method of Tks4 gene knock-out mouse

<160> 17

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctgttgtaac tcgccaatga 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggtcgtata aagatggtgc 20

<210> 3

<211> 4107

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atggacaaga agtacagcat cggcctggac atcggcacca actctgtggg ctgggccgtg 60

atcaccgacg agtacaaggt gcccagcaag aaattcaagg tgctgggcaa caccgaccgg 120

cacagcatca agaagaacct gatcggagcc ctgctgttcg acagcggcga aacagccgag 180

gccacccggc tgaagagaac cgccagaaga agatacacca gacggaagaa ccggatctgc 240

tatctgcaag agatcttcag caacgagatg gccaaggtgg acgacagctt cttccacaga 300

ctggaagagt ccttcctggt ggaagaggat aagaagcacg agcggcaccc catcttcggc 360

aacatcgtgg acgaggtggc ctaccacgag aagtacccca ccatctacca cctgagaaag 420

aaactggtgg acagcaccga caaggccgac ctgcggctga tctatctggc cctggcccac 480

atgatcaagt tccggggcca cttcctgatc gagggcgacc tgaaccccga caacagcgac 540

gtggacaagc tgttcatcca gctggtgcag acctacaacc agctgttcga ggaaaacccc 600

atcaacgcca gcggcgtgga cgccaaggcc atcctgtctg ccagactgag caagagcaga 660

cggctggaaa atctgatcgc ccagctgccc ggcgagaaga agaatggcct gttcggaaac 720

ctgattgccc tgagcctggg cctgaccccc aacttcaaga gcaacttcga cctggccgag 780

gatgccaaac tgcagctgag caaggacacc tacgacgacg acctggacaa cctgctggcc 840

cagatcggcg accagtacgc cgacctgttt ctggccgcca agaacctgtc cgacgccatc 900

ctgctgagcg acatcctgag agtgaacacc gagatcacca aggcccccct gagcgcctct 960

atgatcaaga gatacgacga gcaccaccag gacctgaccc tgctgaaagc tctcgtgcgg 1020

cagcagctgc ctgagaagta caaagagatt ttcttcgacc agagcaagaa cggctacgcc 1080

ggctacattg acggcggagc cagccaggaa gagttctaca agttcatcaa gcccatcctg 1140

gaaaagatgg acggcaccga ggaactgctc gtgaagctga acagagagga cctgctgcgg 1200

aagcagcgga ccttcgacaa cggcagcatc ccccaccaga tccacctggg agagctgcac 1260

gccattctgc ggcggcagga agatttttac ccattcctga aggacaaccg ggaaaagatc 1320

gagaagatcc tgaccttccg catcccctac tacgtgggcc ctctggccag gggaaacagc 1380

agattcgcct ggatgaccag aaagagcgag gaaaccatca ccccctggaa cttcgaggaa 1440

gtggtggaca agggcgcttc cgcccagagc ttcatcgagc ggatgaccaa cttcgataag 1500

aacctgccca acgagaaggt gctgcccaag cacagcctgc tgtacgagta cttcaccgtg 1560

tataacgagc tgaccaaagt gaaatacgtg accgagggaa tgagaaagcc cgccttcctg 1620

agcggcgagc agaaaaaggc catcgtggac ctgctgttca agaccaaccg gaaagtgacc 1680

gtgaagcagc tgaaagagga ctacttcaag aaaatcgagt gcttcgactc cgtggaaatc 1740

tccggcgtgg aagatcggtt caacgcctcc ctgggcacat accacgatct gctgaaaatt 1800

atcaaggaca aggacttcct ggacaatgag gaaaacgagg acattctgga agatatcgtg 1860

ctgaccctga cactgtttga ggacagagag atgatcgagg aacggctgaa aacctatgcc 1920

cacctgttcg acgacaaagt gatgaagcag ctgaagcggc ggagatacac cggctggggc 1980

aggctgagcc ggaagctgat caacggcatc cgggacaagc agtccggcaa gacaatcctg 2040

gatttcctga agtccgacgg cttcgccaac agaaacttca tgcagctgat ccacgacgac 2100

agcctgacct ttaaagagga catccagaaa gcccaggtgt ccggccaggg cgatagcctg 2160

cacgagcaca ttgccaatct ggccggcagc cccgccatta agaagggcat cctgcagaca 2220

gtgaaggtgg tggacgagct cgtgaaagtg atgggccggc acaagcccga gaacatcgtg 2280

atcgaaatgg ccagagagaa ccagaccacc cagaagggac agaagaacag ccgcgagaga 2340

atgaagcgga tcgaagaggg catcaaagag ctgggcagcc agatcctgaa agaacacccc 2400

gtggaaaaca cccagctgca gaacgagaag ctgtacctgt actacctgca gaatgggcgg 2460

gatatgtacg tggaccagga actggacatc aaccggctgt ccgactacga tgtggaccat 2520

atcgtgcctc agagctttct gaaggacgac tccatcgaca acaaggtgct gaccagaagc 2580

gacaagaacc ggggcaagag cgacaacgtg ccctccgaag aggtcgtgaa gaagatgaag 2640

aactactggc ggcagctgct gaacgccaag ctgattaccc agagaaagtt cgacaatctg 2700

accaaggccg agagaggcgg cctgagcgaa ctggataagg ccggcttcat caagagacag 2760

ctggtggaaa cccggcagat cacaaagcac gtggcacaga tcctggactc ccggatgaac 2820

actaagtacg acgagaatga caagctgatc cgggaagtga aagtgatcac cctgaagtcc 2880

aagctggtgt ccgatttccg gaaggatttc cagttttaca aagtgcgcga gatcaacaac 2940

taccaccacg cccacgacgc ctacctgaac gccgtcgtgg gaaccgccct gatcaaaaag 3000

taccctaagc tggaaagcga gttcgtgtac ggcgactaca aggtgtacga cgtgcggaag 3060

atgatcgcca agagcgagca ggaaatcggc aaggctaccg ccaagtactt cttctacagc 3120

aacatcatga actttttcaa gaccgagatt accctggcca acggcgagat ccggaagcgg 3180

cctctgatcg agacaaacgg cgaaaccggg gagatcgtgt gggataaggg ccgggatttt 3240

gccaccgtgc ggaaagtgct gagcatgccc caagtgaata tcgtgaaaaa gaccgaggtg 3300

cagacaggcg gcttcagcaa agagtctatc ctgcccaaga ggaacagcga taagctgatc 3360

gccagaaaga aggactggga ccctaagaag tacggcggct tcgacagccc caccgtggcc 3420

tattctgtgc tggtggtggc caaagtggaa aagggcaagt ccaagaaact gaagagtgtg 3480

aaagagctgc tggggatcac catcatggaa agaagcagct tcgagaagaa tcccatcgac 3540

tttctggaag ccaagggcta caaagaagtg aaaaaggacc tgatcatcaa gctgcctaag 3600

tactccctgt tcgagctgga aaacggccgg aagagaatgc tggcctctgc cggcgaactg 3660

cagaagggaa acgaactggc cctgccctcc aaatatgtga acttcctgta cctggccagc 3720

cactatgaga agctgaaggg ctcccccgag gataatgagc agaaacagct gtttgtggaa 3780

cagcacaagc actacctgga cgagatcatc gagcagatca gcgagttctc caagagagtg 3840

atcctggccg acgctaatct ggacaaagtg ctgtccgcct acaacaagca ccgggataag 3900

cccatcagag agcaggccga gaatatcatc cacctgttta ccctgaccaa tctgggagcc 3960

cctgccgcct tcaagtactt tgacaccacc atcgaccgga agaggtacac cagcaccaaa 4020

gaggtgctgg acgccaccct gatccaccag agcatcaccg gcctgtacga gacacggatc 4080

gacctgtctc agctgggagg cgactaa 4107

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gaagggcatt ctaacacacc tgtca 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cagaggccaa ccaagagaga gaagc 25

<210> 6

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taccatggag ccgtccctcc 20

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

catgcataca gcataggacc 20

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caacatgtcg ctctgtattc 20

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

cgtgtgagat accacaaaac 20

<210> 10

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

gtggctcatg catacagcat 20

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

cagagcatac aagaattgag 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

gctctacacc cgtgtcacaa 20

<210> 13

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tgagaatggt cgtataaaga 20

<210> 14

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

aaggaggaac tgggtcccgg 20

<210> 15

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gccagatctg ggatgcaaac 20

<210> 16

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

catttatagg gatccaagaa 20

<210> 17

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

tgttgttgct catatatgac 20

Claims

1. A construction method of a Tks4 gene knock-out mouse is characterized in that Cas9mRNA, sgRNA1 and sgRNA9 are introduced into fertilized eggs of a mouse, and the Tks4 gene of the mouse is knocked out by utilizing sgRNA1 and sgRNA9 to obtain a Tks4 gene knock-out mouse;

the nucleotide sequence of the sgRNA1 is shown in SEQ ID No.1, and the nucleotide sequence of the sgRNA9 is shown in SEQ ID No. 2;

the Tks4 gene knockout is realized by cutting a No.3 exon of the Tks4 gene.

2. The construction method of claim 1, wherein the sgRNA1 and the sgRNA9 are in a mass ratio of (0.5-1.5): (0.5-1.5).

3. The method for constructing the recombinant vector according to claim 2, wherein the sgRNA1 and the sgRNA9 are in a mass ratio of 1: 1.

4. The construction method according to claim 3, wherein the nucleotide sequence of the Cas9mRNA is shown as SEQ ID No. 3.

5. The construction method of claim 1, wherein the mass ratio of Cas9mRNA to sgRNA1 and sgRNA9 is (1.5-2.5): (0.3-0.8).

6. The construction method of claim 5, wherein the mass ratio of Cas9mRNA to sgRNA1 and sgRNA9 is 2:0.5: 0.5.

7. The construction method according to claim 1, wherein the Tks4 gene knock-out mouse is identified by using a primer pair, and the nucleotide sequences of the upstream and downstream primers of the primer pair are shown as SEQ ID No.4 and SEQ ID No.5 respectively.