CN112239508B

CN112239508B - Polypeptide with obesity inhibiting effect and application thereof

Info

Publication number: CN112239508B
Application number: CN202011132986.XA
Authority: CN
Inventors: 王中山; 张梦
Original assignee: Xuzhou Medical University
Current assignee: Xuzhou Medical University
Priority date: 2020-10-21
Filing date: 2020-10-21
Publication date: 2021-07-02
Anticipated expiration: 2040-10-21
Also published as: CN112239508A

Abstract

The invention discloses a polypeptide with the function of inhibiting obesity and application thereof, wherein the polypeptide is named as TAT-MC4R1 and is SEQ ID NO: 1. The polypeptide TAT-MC4R1 provided by the invention is derived from a MC4R1 receptor carboxyl terminal amino acid sequence, TAT-MC4R1 can be phosphorylated by a G protein coupled receptor kinase in competition with the MC4R1 receptor carboxyl terminal sequence when an agonist acts on the MC4R1 receptor, TAT-MC4R1 can be combined with beta-arrestin 2 after phosphorylation, and the interaction between the MC4R1 receptor and the beta-arrestin 2 is replaced, so that the polypeptide TAT-MC4R1 has resistance to obesity and complications such as diabetes induced by obesity. The polypeptide TAT-MC4R1 has application potential in the processes of losing weight and preventing obesity complications such as diabetes and the like.

Description

Polypeptide with obesity inhibiting effect and application thereof

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a polypeptide with an obesity inhibiting effect and application thereof.

Background

With the improvement of living standard of people and unhealthy life style, obesity becomes a more and more concern. Diseases such as diabetes, hypertension, atherosclerosis, etc. due to obesity seriously threaten human health. Various molecular mechanisms have been discovered to be involved in regulating body weight, and various weight loss treatment regimens have been discovered based on this discovery, however, these drugs either lack target specificity or can affect various signaling pathways downstream of the target protein, causing various side effects, and cannot be used for a long period of time. Therefore, safe and efficient weight-losing methods are urgently needed at present.

G protein-coupled receptors (GPCRs) are the target of action for approximately 30% of the drugs on the market and are also important targets for new drug development. In general, when a GPCR is bound to a ligand, it will mediate a signal and regulate gene transcription by interacting with GTP-binding protein (abbreviated as G protein), which in turn involves phosphorylation of grks (GPCR kinases) and binding of β -arrestin protein, which in turn inhibits the interaction of G protein and GPCR.

Studies have shown that melanocortin 4 receptors (MC 4R), which are important GPCRs involved in weight regulation, induce the release of melanocortin peptides, alpha and beta-melanocytes after eating, and thus activate neurons expressed in MC4R, thereby reducing food intake. Targeted knock-out of the MC4R gene in rodents results in weight gain. The MC4R gene mutation was detected in some obese children and adults and resulted in a G.alpha._s-a decrease in mediated cAMP aggregation. The former developed anti-obesity drugs based on the genetic discovery, and although the first generation MC4R activator can reduce weight, it causes an increase in blood pressure, limiting its application. Second generation MC4R agonists also have limited their widespread use due to off-target effects on melanocortin 1 receptors.

It was found through studies that certain MC4R mutants are closely related to obesity, since these mutants result in loss of MC4R function, and similar efficacy to MC4R gene knock-out. Of course, certain gain-of-function MC4R mutants were also found to be closely associated with low BMI and reduced chances of developing obesity, type ii diabetes, and coronary artery disease, among others.

The binding of beta-arrestin 2 can release MC4R from G protein, thereby promoting desensitization and endocytosis of MC 4R. While selective interference with the interaction of beta-arrestin 2 and MC4R prevents the aggregation of beta-arrestin 2 to MC4R, possibly preventing desensitization and endocytosis of MC4R, eliminating the effect. Therefore, the research and development of the interference polypeptide for blocking the interaction of the beta-arrestin 2 and the MC4R have good weight-reducing effect.

Disclosure of Invention

The first purpose of the invention is to provide a polypeptide with obesity inhibiting effect, which can enter cells to target and bind beta-arrestin 2, thereby blocking the interaction of beta-arrestin 2 and MC 4R.

To achieve the above object, the present invention provides a polypeptide having an obesity inhibitory effect, which is named TAT-MC4R1 and is represented by SEQ ID NO: 1.

Wherein, SEQ ID NO: 1 consists of 29 amino acid residues, and the 1 st to 11 th amino acid residues in the sequence 1 form a region with the function of penetrating cell membranes, and the region can be replaced by other sequences with the same function; the amino acid residues 12-39 in the sequence 1 form a region which can replace the combination of MC4R1 receptor and beta-arrestin 2 protein.

It is a second object of the invention to provide nucleic acid molecules encoding said polypeptides.

To achieve the above object, the nucleic acid molecule encoding the polypeptide provided by the present invention is SEQ ID NO: 2.

Wherein, SEQ ID NO: 2 is 120bp in length, and the coded amino acid sequence is SEQ ID NO: 1.

The third purpose of the invention is to provide an expression cassette, a recombinant vector or a recombinant bacterium containing the nucleic acid molecule for encoding the polypeptide.

The fourth purpose of the invention is to provide the application of the polypeptide and/or the nucleic acid molecule in preparing products for losing weight and preventing obesity complications.

The obesity complications comprise diabetes, hypertension and atherosclerosis.

The invention also provides a product with the effects of losing weight and preventing obesity complications, and the active ingredient of the product is the polypeptide and/or the nucleic acid molecule.

The administration mode of the product comprises oral administration, intraperitoneal injection, intravenous injection or intrathecal injection and the like.

The polypeptide TAT-MC4R1 provided by the invention is derived from the carboxyl terminal of an obtained functional MC4R1 receptor mutant, the polypeptide TAT-MC4R1 can be phosphorylated by a G protein coupled receptor kinase (GRK) in competition with the carboxyl terminal of an MC4R1 receptor when melanocortin acts on the MC4R1 receptor, and the polypeptide TAT-MC4R1 can be combined with beta-arrestin 2 after phosphorylation to replace the interaction between the MC4R1 receptor and the beta-arrestin 2. The polypeptide TAT-MC4R1 has health care application potential in prevention and treatment of obesity and complications thereof such as diabetes and the like.

Drawings

FIG. 1 shows the interaction between the peptide sequence of MC4R1 and beta-arrestin 2.

FIG. 2 shows the effect of TAT-MC4R1 peptide on the food intake of mice.

FIG. 3 shows the effect of TAT-MC4R1 peptide on mouse body weight.

Detailed Description

The present invention is further described in detail below with reference to specific examples, which are given only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. In the quantitative experiments in the present example, if no special description is given, three repetitions are set, and the results are averaged.

The experimental procedures in the following examples are, unless otherwise specified, conventional molecular biological procedures.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the following examples HEK293 cells were from ATCC (American type culture Collection), Kunming laboratory mice, weighing 20-25g, all healthy male mice, and from the laboratory animal center of Xuzhou university of medicine.

EXAMPLE 1 obtaining of the polypeptide TAT-MC4R1

(1) Mammalian cell two-hybrid

HEK293 cells were co-transfected with the MC4R1 polypeptide fragment and the pBIND recombinants (upstream primer 5'CTCAGTCTAGACGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCGTCTGTT 3' (SEQ ID NO.3) and downstream primer 5'CATCGGGTACCATATCTGCTAGACAAGTCACAAAGGCCTCCCAGGGGATAGCAACAGACGATCTCTTTGAAGG 3' (SEQ ID NO.4)), with the β -arrestin 2 and pACT recombinants (upstream primer 5'CTCAGTCTAGAATGGGAGAAAAACCCGGGAC 3' (SEQ ID NO.5) and downstream primer 5'CATCGGGTACCCTAGCAAAACTGGTCATCACAGTCA 3' (SEQ ID NO.6)) and reporter vector pG5luc, 1 μ M NDP- α MSH treated cells were added, and after culturing continued for 48h, luciferase activity was detected by the dual luciferase reporter assay kit (Beyotime 009) using GloMax-Multi detection system (Promega).

From the results in fig. 1, it can be seen that the MC4R1 polypeptide fragment is capable of interacting with β -arrestin 2, and the interaction depends on the presence of agonist.

(2) TAT-MC4R1 polypeptide with transmembrane activity

The MC4R1 receptor carboxy-terminal polypeptide sequence was obtained by PCR, with its upstream primer: CCATCTCGAGATGTACGGTCGTAAAAAACGTCGTCAGCGTCGTCGTCGGAGTCAAGAACTGAGGAAAACCTTCAAAGAGATCGTCTGTT (SEQ ID NO.7), downstream primer: 5'CGTCGGATCCATATCTGCTAGACAAGTCACAAAGGCCTCCCAGGGGATAGCAACAGACGATCTCTTTGAAGG 3' (SEQ ID NO.8), inserting a TAT coding sequence into an upstream primer, adding XhoI and BamHI cutting sites into the upstream primer and the downstream primer respectively, constructing an Escherichia coli expression vector pWaldo-TAT-MC4R1 by an enzyme cutting connection method, and transforming BL21(DE3) to obtain a recombinant.

Inoculating the recombinant strain into 500ml LB culture medium, culturing overnight at 37 deg.C, transferring 50ml culture into 1L LB culture medium, and culturing at 37 deg.C to OD₆₀₀About 0.5-0.6, adding IPTG with the final concentration of 0.2mM, continuously culturing for about 20h at 20 ℃, and centrifuging for 15min at 5000g to collect cells.

The cells were suspended in 100ml lysis buffer (20mM Tris-HCl, pH 7.5; 300mM NaCl and 5% glycerol), 50. mu.g/ml lysozyme, 200U DnaseI and 1-piece protease inhibitor (cocktail) were added, the cells were disrupted at 1200bar high pressure, 10,000rpm, centrifuged at 4 ℃ for 30min to remove cell debris; the supernatant was bound to an equilibrated Ni-NTA column (equilibration buffer: 20mM Tris-HCl, pH 7.5; 300mM NaCl and 5% glycerol) and the sample containing the protein of interest was allowed to pass through the column spontaneously; 100ml of washing buffer (20mM Tris-HCl, pH7.5, 300mM NaCl, 5% glycerol and 30mM imidazole) was washed, then eluted with an elution buffer (20mM Tris-HCl, pH7.5, 300mM NaCl, 5% glycerol and 300mM imidazole), and a protein sample was collected and purified by AKTA pure M system molecular sieve column (buffer: 20mM Tris-HCl, pH7.5, 300mM NaCl, 5% glycerol), which enabled the fusion product of TAT-MC4R1 polypeptide and GFP to be obtained in a higher purity.

To further obtain TAT-MC4R1 polypeptide, 200. mu.l of TEV (tobacco mosaic virus) protease at a concentration of 3mg/ml was added to the collected protein sample and cleaved overnight at 4 ℃. The sample was passed through the Ni column again, and the GFP-containing protein which had not been cleaved completely and the cleaved GFP were removed. The TAT-MC4R1 polypeptide sample collected finally passes through a concentration tube with the molecular weight cut-off of 1,000 and is concentrated to about 5 mg/ml. SDS-PAGE detects the purity of the sample to be more than 95%, can be used for functional study. The amino acid sequence of the purified polypeptide TAT-MC4R1 is shown as SEQ ID NO.1, and the nucleotide sequence coded by the polypeptide TAT-MC4R1 is shown as SEQ ID NO. 2.

EXAMPLE 2 Studies of the use of the polypeptide TAT-MC4R1

Mice were intraperitoneally injected with 10mg/kg of TAT-MC4R1 polypeptide every day, control groups were administered with the same amount of control polypeptide for 15 days, and the feeding condition and body weight change of the mice were examined.

As can be seen from FIGS. 2 and 3, TAT-MC4R1 can significantly reduce the food intake of mice and promote the weight reduction of mice. And no obvious abnormality was found in the health of the mice after administration of the polypeptide compared to the control group.

Sequence listing

<110> Xuzhou university of medicine

<120> polypeptide with obesity inhibiting effect and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 39

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 1

Tyr Gly Arg Lys Lys Arg Arg Gln Arg Arg Arg Arg Ser Gln Glu Leu

1 5 10 15

Arg Lys Thr Phe Lys Glu Ile Val Cys Cys Tyr Pro Leu Gly Gly Leu

20 25 30

Cys Asp Leu Ser Ser Arg Tyr

35

<210> 2

<211> 120

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tacggtcgta aaaaacgtcg tcagcgtcgt cgtcggagtc aagaactgag gaaaaccttc 60

aaagagatcg tctgttgcta tcccctggga ggcctttgtg acttgtctag cagatattaa 120

<210> 3

<211> 54

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ctcagtctag acggagtcaa gaactgagga aaaccttcaa agagatcgtc tgtt 54

<210> 4

<211> 73

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

catcgggtac catatctgct agacaagtca caaaggcctc ccaggggata gcaacagacg 60

atctctttga agg 73

<210> 5

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ctcagtctag aatgggagaa aaacccggga c 31

<210> 6

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

catcgggtac cctagcaaaa ctggtcatca cagtca 36

<210> 7

<211> 89

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ccatctcgag atgtacggtc gtaaaaaacg tcgtcagcgt cgtcgtcgga gtcaagaact 60

gaggaaaacc ttcaaagaga tcgtctgtt 89

<210> 8

<211> 72

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgtcggatcc atatctgcta gacaagtcac aaaggcctcc caggggatag caacagacga 60

tctctttgaa gg 72

Claims

1. A polypeptide having an obesity inhibitory effect, wherein the polypeptide is TAT-MC4R1 and SEQ ID NO: 1.

2. A nucleic acid molecule encoding the polypeptide of claim 1, which is SEQ ID NO: 2.

3. An expression cassette, recombinant vector or recombinant bacterium comprising the nucleic acid molecule of claim 2.

4. Use of the polypeptide of claim 1 and/or the nucleic acid molecule of claim 2 for the preparation of a weight loss product.

5. A product having an anti-obesity effect, wherein the active ingredient is the polypeptide of claim 1 and/or the nucleic acid molecule of claim 2.

6. The product with weight-reducing effect according to claim 5, wherein the product is administered orally, intraperitoneally, intravenously or intrathecally.