CN112226522A - Primer, probe, kit and detection method for detecting group B streptococcus - Google Patents

Primer, probe, kit and detection method for detecting group B streptococcus Download PDF

Info

Publication number
CN112226522A
CN112226522A CN201910636659.9A CN201910636659A CN112226522A CN 112226522 A CN112226522 A CN 112226522A CN 201910636659 A CN201910636659 A CN 201910636659A CN 112226522 A CN112226522 A CN 112226522A
Authority
CN
China
Prior art keywords
probe
group
kit
streptococcus
primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201910636659.9A
Other languages
Chinese (zh)
Inventor
郭光华
蔺皓
邹国宝
宋高尚
魏颖颖
吴茜
刘欣欣
沈江卫
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhongsheng Fangzheng Bio Tech Co ltd
Original Assignee
Zhongsheng Fangzheng Bio Tech Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhongsheng Fangzheng Bio Tech Co ltd filed Critical Zhongsheng Fangzheng Bio Tech Co ltd
Priority to CN201910636659.9A priority Critical patent/CN112226522A/en
Publication of CN112226522A publication Critical patent/CN112226522A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to the technical field of detection of pathogenic microorganisms, in particular to a primer, a probe, a kit and a detection method for detecting group B streptococcus. The kit comprises a primer pair and a Taqman fluorescent probe which are specific to the conserved region of the SIP gene of the group B streptococcus, can quickly and accurately detect the infection sample of the group B streptococcus through real-time fluorescent quantitative PCR, and has the advantages of high accuracy, high sensitivity, strong repeatability and convenient and quick use.

Description

Primer, probe, kit and detection method for detecting group B streptococcus
Technical Field
The invention relates to the technical field of detection of pathogenic microorganisms, in particular to a primer, a probe, a kit and a detection method for detecting group B streptococcus.
Background
Group B Streptococcus (GBS) has been known under the scientific name streptococcus agalactiae (s.agalactiae) and was first discovered in 1938 to cause bovine mastitis, and the polysaccharide substances in the cell wall belong to group B in the structural classification of antigens, so Group B Streptococcus (GBS) is currently used instead of the original name streptococcus agalactiae.
Group B streptococci are gram-positive streptococci, mostly haemolytic to B. Streptococcal cell walls have substance C (cell wall C polysaccharide substance) with group specificity and substance S (CPS) with type specificity. Streptococci are divided into 18 groups, with GBS being only one group, depending on the substance C. GBS has so far been isolated to identify 10 serotypes, by substance S: type I (including type Ia and Ib); type II; type III; type IV; form V, form VI, form VII, form VIII and form IX, wherein form IX is a new serous form discovered in recent years.
In 1938 Fry first reported that 3 cases of infection with group B streptococci caused death of postpartum endocarditis, confirming that group B streptococci are the causative bacteria of humans. Decades of research have shown that group B streptococci can cause neonatal sepsis, pneumonia, meningitis, and even death. If the pregnant woman is infected with the streptococcus in the genital tract B, the pregnant woman can be induced to have abortion, premature birth and the like, the growth and development of the fetus can be limited, and even the fetus can die in the uterus in serious cases. Neonates living after infection may also have serious neurological sequelae including hydrocephalus, intellectual disability, microcephaly, deafness, etc.
The pregnant GBS infection is closely related to the occurrence of diseases such as premature birth, premature rupture of fetal membranes, puerperal infection and neonatal septicemia.
In the last two decades, GBS infection in countries such as the United states, the United kingdom, Finland and the like is the first infection of newborn infants, the incidence rates are respectively as high as 61%, 28% and 30%, and the fatality rate is 20% -50%. Asandon et al reported 25.71% of neonatal pneumonia caused by GBS. According to the time of infection, the disease is divided into early-onset disease, late-onset disease and recurrent disease. The mortality rate of newborn infants caused by early onset disease is 11.1%, and that of late onset disease is 27.8%.
Prenatal screening for GBS is particularly important based on the severity of symptoms, diseases associated with the GBS infection in pregnant women and neonates. While delivery transmission is the major route for neonatal GBS infection. Therefore, the prevention by antibiotics can effectively reduce the induction of early invasive infection of the newborn caused by vertical transmission of GBS. The Centers for Disease Control and Prevention (CDC) in the united states set guidelines for the Prevention and treatment of perinatal GBS, so that the incidence of GBS infection in pregnant women during perinatal is already greatly reduced.
At present, the prevention scheme for GBS at home and abroad mainly adopts antibiotic prevention. However, in recent years, global GBS resistance has increased year by year.
Between 1998 and 2001, the united states and canada regions, GBS resistance to erythromycin has risen from 7% to 25%, reaching 37% in 2003. In China, the drug resistance rates of GBS strains separated in Guangzhou region 1999 to erythromycin and lincomycin reach 45% and 26% respectively, which are inseparable from the abuse of domestic antibiotics.
During the treatment of GBS, the preventive method of antibiotic injection for all pregnant women apparently results in unnecessary use of antibiotics, since the germ-carrying rate of pregnant women is about 10% -30%. Therefore, GBS screening before the pregnant woman is parturient is particularly necessary.
In 1996, the United states disease control center (CDC) and other organizations developed a guide for screening and preventing perinatal group B streptococcal infection, and the guide was modified in 2002 and 2010 to greatly reduce the incidence and harm of perinatal group B streptococcal infection, and the incidence rate is reduced from 1.7/1000 neonates in the early 90 s to 0.34-0.37/1000 neonates in recent years.
For a long time, the current situation of GBS infection in China is not sufficiently valued, however, in China recently, some death cases caused by GBS infection are reported, GBS detection is carried out on 234 cases of pneumonia-infected and death newborn lung tissue paraffin specimens in Beijing child hospitals, such as Dangjiang red, the detection rate is 65%, and the result shows that GBS is the first pathogenic bacterium in the death cases of newborn pneumonia.
Moreover, due to the abuse of domestic antibiotics, the national screening of GBS in perinatal period is almost blank, and the national policy of continuous emergence is now strictly monitoring the clinical application and management of antibiotics, and the GBS is seriously damaged, which makes the screening of GBS important and necessary.
The GBS prevention guide published in the United states CDC2010 can be used for reference in the domestic work of preventing the GBS infection in the perinatal period, and the GBS screening of the vagina and the rectum is carried out on pregnant women in 35-37 weeks of pregnancy, so that the prevention efficiency can be improved, the resources are saved, and meanwhile, the unnecessary use of antibiotics can be greatly reduced. In recent years, global GBS resistance has increased year by year. In the process of GBS treatment, as the bacteria carrying rate of pregnant women is about 10-30%, the prevention method for injecting antibiotics to all pregnant women obviously causes unnecessary use of antibiotics, so that GBS screening before the pregnant women are born is particularly necessary.
The detection rate of GBS depends on several factors, and most scholars recommend a combination of cervical, vaginal and perianal sampling to increase the positive rate. Considering that the GBS positive rate is higher for screening closer to midnatal, the american association of obstetrics and gynecology (ACOG), the American Association of Pediatrics (AAP) recommend that all pregnant women who are 35-37 weeks pregnant be tested. The detection method mainly comprises bacterial culture, antigen measurement, molecular biology detection and the like.
Currently, the GBS detection methods mainly include isolation culture, immunological diagnosis and molecular biological diagnosis of bacteria, and the three methods have the following characteristics:
1) the isolation culture of pathogens is the gold standard of current GBS detection, but the isolation culture method has higher technical requirements, higher cost, long time consumption and less application in clinical detection.
2) The immunological diagnosis also has hysteresis, cannot accurately reflect whether the current disease is infected or carries pathogens, and is difficult to meet the requirement of early diagnosis.
3) Pathogen nucleic acid detection: the method has the advantages of rapidness, accuracy, short detection window, high sensitivity and the like, can make early diagnosis on GBS, and provides powerful technical support for rapid analysis and control of epidemic situations. Among them, the real-time quantitative PCR detection platform has become the simplest and most reliable nucleic acid detection method.
However, a fluorescent quantitative PCR kit product capable of accurately and sensitively detecting group B streptococcus is still lacking at present.
Disclosure of Invention
In view of the above, the technical problem to be solved by the present invention is to provide a primer, a probe, a kit and a detection method for detecting group B streptococcus, wherein the target gene segment targeted by the primer and the probe is small, high in specificity and high in sensitivity.
The primer and the probe for detecting the group B streptococcus provided by the invention consist of a primer with a nucleotide sequence shown by SEQ ID NO. 1-2 and a probe with a nucleotide sequence shown by SEQ ID NO. 3.
The invention selects a B group streptococcus surface immunogenic protein (sip) gene conserved region and a beta-globin gene (HBB, internal standard) conserved region, designs specific primers and probes, utilizes a real-time fluorescent quantitative PCR technology to prepare a B group streptococcus real-time fluorescent quantitative PCR detection kit, and introduces a use method thereof.
In the invention, a primer pair of a nucleotide sequence shown in SEQ ID NO. 1-2 and a probe of a nucleotide sequence shown in SEQ ID NO. 3 are designed aiming at a conserved region of a Group B Streptococcus (GBS) SIP gene, and the length of a GBS specific target gene fragment is 121 bp; the sequence is as follows: CTCTCAATACAATTTCGGAAGGTATGACACCAGAAGCAGCAACAACGATTGTTTCGCCAATGAAGACATATTCTTCTGCGCCAGCTTTGAAATCAAAAGAAGTATTAGCACAAGAGCAAGC (SEQ ID No. 7).
The primer and the probe have good accuracy, sensitivity and repeatability, and can accurately and quickly detect the Group B Streptococcus (GBS) in human vaginal secretion and urinary tract secretion.
In the invention, the 5 'end of the probe is marked with a fluorescence reporter group, and the 3' end of the probe is marked with a fluorescence quenching group.
Specifically, the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 3 is marked with a fluorescence reporter group FAM, and the 3' end is marked with a fluorescence quenching group BHQ 1.
The invention also provides application of the primer and the probe in preparation of a kit for detecting group B streptococcus.
The invention also provides a kit for detecting the group B streptococcus, which comprises the primer and the probe.
The kit provided by the invention also comprises a primer and a probe for detecting the reference gene HBB;
the nucleotide sequence of the primer for detecting the reference gene HBB is shown as SEQ ID NO. 4-5; the nucleotide sequence of the probe for detecting the reference gene HBB is shown in SEQ ID NO. 6. The sequence of the HBB specific target gene fragment is as follows: TCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATG (SEQ ID NO: 8). In the kit provided by the invention, the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 6 is marked with a fluorescence reporter group ROX, and the 3' end is marked with a fluorescence quenching group BHQ 2.
The kit provided by the invention also comprises a fluorescent quantitative PCR detection reagent and/or a sample extraction reagent;
the fluorescent quantitative PCR detection reagent comprises qPCR Master Mix enzyme mixed liquor and qPCR Master Mix reaction buffer solution; the qPCR Master Mix enzyme mixed solution comprises Taq enzyme and UNG enzyme, wherein the Taq enzyme is Antart Taq DNA polymerase, and the UNG enzyme is uracil-N-glycosylase;
the sample extraction reagent comprises NaOH, TritonX-100 and TE buffer solution.
In the sample extraction reagent, the final concentration of NaOH is 0.01-0.5%, and more preferably 0.1%; the final concentration of TritonX-100 is 0.01-0.5%, and more preferably 0.1%.
The kit provided by the invention also comprises a positive control and/or a negative control;
the negative control substance is sterilized water;
the positive control substance is a plasmid solution containing a group B streptococcus target gene and an HBB gene fragment.
Wherein, the concentration of the plasmid solution containing GBS/HBB target gene fragments is 10000 copies/mu L, and the corresponding Ct values are all about 23.
The kit of the invention should be stored at-20 ℃ and repeated freeze thawing should be reduced as much as possible.
The invention also provides a detection method of the group B streptococcus, the kit provided by the invention is used for carrying out real-time fluorescence quantitative PCR detection on the DNA of a sample to be detected, and the S-shaped amplification curve generated is positive.
Specifically, the detection method of group B streptococcus provided by the invention comprises the following steps:
(1) nucleic acid extraction: adding 1mL of physiological saline into a vaginal secretion and urinary tract secretion sample collecting tube, fully oscillating and washing a cotton swab, then squeezing and discarding the cotton swab by the wall, taking 500 mu L of liquid to transfer into a 1.5mL centrifuge tube, centrifuging for 5 minutes at 13000rpm, discarding supernatant, adding 1mL of physiological saline into precipitate, scattering the precipitate, centrifuging for 5 minutes at 13000rpm, discarding supernatant, adding 50 mu L of sample extraction reagent which is uniformly oscillated into the precipitate, oscillating and scattering the precipitate on a vortex oscillator (if necessary, gently scattering the precipitate by using a gun head), carrying out dry bath or water bath at 100 ℃ for 10 minutes, centrifuging for 5 minutes at 13000rpm, and using supernatant for PCR reaction (without touching the precipitate at the bottom of the tube during suction).
(2) Real-time quantitative fluorescent PCR: the GBS real-time fluorescent quantitative PCR detection kit is used for carrying out PCR amplification reaction, and the extracted DNA of a sample to be detected, a positive control and a negative control are respectively used as templates and are mixed with reaction mixed liquid of the kit to carry out real-time fluorescent quantitative PCR reaction and detect a fluorescent signal.
In the method of the invention, the real-time fluorescent quantitative PCR system comprises:
Figure BDA0002130460190000051
the real-time fluorescent quantitative PCR program comprises:
2 minutes at 50 ℃;
pre-denaturation at 95 ℃ for 5 min;
95 ℃ for 15 seconds → 60 ℃ for 35 seconds, 45 cycles.
Wherein the final concentration of the primer is 100-1000 nM, and more preferably 500 nM; the concentration of the fluorescent probe is 10-500nM, more preferably 200 nM.
The judgment of the result specifically includes:
the following requirements are met: positive control, the FAM channel has obvious amplification, a typical S-type amplification curve and a Ct value less than 30; negative control, in which the Ct value of the FAM channel and the ROX channel is 45 (or is shown as undet) or no typical S-type amplification curve, and subsequent judgment is carried out, otherwise, problem search is carried out;
the Ct value of an amplification curve of the DNA of the sample to be detected is less than 38, and the amplification curve has a typical S-shaped amplification curve and is a positive result;
the Ct value of the amplification curve of the DNA of the sample to be detected is equal to 45 (or shown as Undet) or no typical S-shaped amplification curve, and the result is negative;
fourthly, if the Ct value of the amplification curve 38 of the DNA sample to be detected is not more than 45 and is a gray area, if the retest result is still the Ct value less than 45 and has a typical S-shaped amplification curve, the result is judged to be a positive result; if the Ct value is not displayed or no typical S-type amplification curve is found, the result is determined to be negative.
The primers and the probes can be used for detecting the group B streptococcus in samples from various sources. Detection of a biological sample can determine whether the sample is infected with group B streptococci, while detection of a non-biological sample can determine whether the sample is infected with group B streptococci. Thus, the kit of the present invention may be used for the detection of a sample for non-diagnostic purposes. In the present invention, the sample to be tested is from vagina, medical equipment, medicine, food or cosmetics. In some embodiments, the sample to be tested is vaginal secretion or urinary tract secretion.
The beneficial effects of the invention at least comprise:
(1) the invention designs 4 primers and 2 Taqman probes aiming at the conserved region of GBS/HBB, combines with the conserved region of a target gene, has high specificity, and has no cross reaction with pseudomonas aeruginosa strain CMCC10104, staphylococcus aureus strain CMCC26001, lactobacillus casei strain CMCC34103, escherichia coli strain CMCC44103, proteus strain CMCC49102, salmonella typhi strain CMCC50096, shigella flexneri strain CMCC51573, candida albicans strain CMCC98001, Mycoplasma Hominis (MH), herpes simplex virus 1/2 type (HSV-1/2), Human Papilloma Virus (HPV), Human Cytomegalovirus (HCMV), Mycoplasma Pneumoniae (MP) and Mycoplasma Genitalium (MG);
(2) target gene fragments are shorter and are all between 80 and 150bp, if the target gene fragments are too short, the decontamination effect of UNG enzyme can be influenced, and if the target gene fragments are too long, the reaction efficiency is reduced, so that the method can effectively avoid pollution, can ensure the high efficiency and sensitivity of the reaction, and can detect GBS DNA with 5 copies;
(4) the human beta-globin gene specific primer probe is added into the reaction tube, so that the whole process of sample sampling, sample extraction and PCR detection can be effectively monitored, and the defect that whether the sample sampling is successful or not can not be effectively monitored by adding an external standard in the extraction process is overcome.
The kit is very suitable for clinical use and popularization, and has important significance for the auxiliary diagnosis of the clinical group B streptococcus infection in China.
Drawings
FIG. 1 shows the fluorescence detection results of the specificity experiment of example 4, where the template corresponding to each detection curve is 1: pseudomonas aeruginosa strain CMCC10104, 2: staphylococcus aureus strain CMCC26001, 3: lactobacillus casei strain CMCC34103, 4: escherichia coli strain CMCC44103, 5: proteus strain CMCC49102, 6: salmonella typhi strain CMCC50096, 7: shigella flexneri strain CMCC51573, 8: candida albicans strain CMCC98001, 9: mycoplasma Hominis (MH), 10: herpes simplex virus 1/2 type (HSV-1/2), 11: human Papilloma Virus (HPV), 12: human Cytomegalovirus (HCMV), 13: mycoplasma Pneumoniae (MP), 14: mycoplasma Genitalium (MG), 15: group B streptococci;
FIG. 2 shows the fluorescence detection results of GBS (FAM channel) in the sensitivity experiment of example 5, wherein the templates corresponding to the detection curves 1-6 are GBS target gene plasmid solutions diluted by human genome in a gradient manner, and the corresponding concentrations are 1.0 × 105、1.0×104、1.0×103、1.0×102、1.0×101、1.0×100Copy/. mu.L;
FIG. 3 shows the fluorescence detection result of the enterprise precision reference (R1) in the repeatability test of example 6.
Detailed Description
The invention provides a primer, a probe, a kit and a detection method for detecting group B streptococcus, and a person skilled in the art can realize the detection by appropriately improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.
The test materials adopted by the invention are all common commercial products and can be purchased in the market.
The invention is further illustrated by the following examples:
example 1: design of primer probe pair for rapid GBS detection
Downloading a group B streptococcus sip gene sequence and an HBB gene sequence in NCBI, performing sequence comparison by utilizing Vector NTI software, DNAstar, NCBI and the like, selecting a most conservative region, performing blast comparison on the region, and designing a primer pair and a probe, wherein the sequences are as follows:
TABLE 1 primer and Probe sequences
Figure BDA0002130460190000081
Example 2: establishment of real-time fluorescent quantitative PCR kit for rapid GBS detection
A real-time fluorescent quantitative PCR kit for rapidly detecting GBS comprises primers and probes (SEQ ID NO.1-6), a fluorescent quantitative PCR detection reagent, a sample extraction reagent positive reference substance, a negative reference substance, an instruction book and a kit body, wherein the primers and the probes are shown in Table 1.
Wherein the final concentration of the primer GBS-F, GBS-R, HBB-F, HBB-R is 500 nM.
Wherein the concentration of the probe GBS-P, HBB-R is 200 nM.
Wherein the fluorescent group of the GBS-P probe is FAM, the quenching group is BHQ1, the fluorescent group of the HBB-P probe is ROX, and the quenching group is BHQ 1.
Wherein the fluorescent quantitative PCR detection reagent comprises qPCR Master Mix enzyme mixed liquor and qPCR Master Mix reaction buffer solution; the qPCR Master Mix enzyme mixed solution comprises Taq enzyme and UNG enzyme, wherein the Taq enzyme is Antart Taq DNA polymerase, and the UNG enzyme is uracil-N-glycosylase;
wherein the sample extraction reagent is TE buffer solution containing 0.1 percent of NaOH and 0.1 percent of TritonX-100.
Wherein the positive control is a plasmid solution containing GBS/HBB target gene fragments, the concentration is 10000 copies/mu L, and the corresponding Ct values are all about 23.
Wherein the GBS specific target gene fragment sequence is as follows:
CTCTCAATACAATTTCGGAAGGTATGACACCAGAAGCAGCAACAACGATTGTTTCGCCAATGAAGACATATTCTTCTGCGCCAGCTTTGAAATCAAAAGAAGTATTAGCACAAGAGCAAGC(SEQ ID No.7)。
wherein the sequence of the HBB specific target gene fragment is as follows:
TCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATG(SEQ ID No.8)。
wherein the negative control is sterilized water.
Example 3: rapid detection method of GBS nucleic acid detection kit
The kit of the embodiment 2 is used for rapidly detecting GBS in human vaginal secretion and urinary tract secretion, and comprises the following specific steps:
(1) nucleic acid extraction: adding 1mL of physiological saline into a vaginal secretion and urinary tract secretion sample collecting tube, fully oscillating and washing a cotton swab, then squeezing and discarding the cotton swab by the wall, taking 500 mu L of liquid to transfer into a 1.5mL centrifuge tube, centrifuging for 5 minutes at 13000rpm, discarding supernatant, adding 1mL of physiological saline into precipitate, scattering the precipitate, centrifuging for 5 minutes at 13000rpm, discarding supernatant, adding 50 mu L of sample extraction reagent which is uniformly oscillated into the precipitate, oscillating and scattering the precipitate on a vortex oscillator (if necessary, gently scattering the precipitate by using a gun head), carrying out dry bath or water bath at 100 ℃ for 10 minutes, centrifuging for 5 minutes at 13000rpm, and using supernatant for PCR reaction (without touching the precipitate at the bottom of the tube during suction).
(2) Real-time quantitative fluorescent PCR: the GBS real-time fluorescent quantitative PCR detection kit is used for carrying out PCR amplification reaction, and the reaction system is as follows:
Figure BDA0002130460190000101
the real-time fluorescent quantitative PCR program comprises:
2 minutes at 50 ℃;
pre-denaturation at 95 ℃ for 5 min;
95 ℃ for 15 seconds → 60 ℃ for 35 seconds, 45 cycles.
FAM, ROX channel is used to collect the detection fluorescence signal.
(3) And (5) judging a result:
the following requirements are met: positive control, FAM channel and ROX channel have obvious amplification, have typical S-type amplification curve, and Ct value is less than 30; negative control, in which the Ct value of the FAM channel is 45 (or is shown as undet) or no typical S-type amplification curve, and subsequent judgment is carried out, otherwise, problem search is carried out;
the Ct value of an amplification curve of the DNA of the sample to be detected is less than 38, and the amplification curve has a typical S-shaped amplification curve and is a positive result;
the Ct value of the amplification curve of the DNA of the sample to be detected is equal to 45 (or shown as Undet) or no typical S-shaped amplification curve, and the result is negative;
fourthly, if the Ct value of the amplification curve 38 of the DNA sample to be detected is not more than 45 and is a gray area, if the retest result is still the Ct value less than 45 and has a typical S-shaped amplification curve, the result is judged to be a positive result; if the Ct value is not displayed or no typical S-type amplification curve is found, the result is determined to be negative.
Example 4: experiment of specificity
The results of PCR detection of Pseudomonas aeruginosa strain CMCC10104, Staphylococcus aureus strain CMCC26001, Lactobacillus casei strain CMCC34103, Escherichia coli strain CMCC44103, Proteus strain CMCC49102, Salmonella typhi strain CMCC50096, Shigella flexneri strain CMCC51573, Candida albicans strain CMCC98001, Mycoplasma Hominis (MH), herpes simplex virus 1/2 (HSV-1/2), Human Papilloma Virus (HPV), Human Cytomegalovirus (HCMV), Mycoplasma Pneumoniae (MP), Mycoplasma Genitalium (MG) and group B streptococci using the kit of example 2 and the method of example 3 are shown in FIG. 1, and the results show that only the plasmid solution containing GBS/HBB target gene fragment, i.e., the positive control, is positive and the other tubes are negative. The result shows that the detection kit has high specificity and can accurately and specifically detect the GBS.
Example 5: sensitivity test
Selecting TE solution containing human genome as matrix, and diluting in gradient of 1.0 × 100～1.0×105The GBS plasmid at the copy/μm concentration was used as a sample and detected by the kit of example 2, the method of example 3 of the present invention. The detection results are shown in FIG. 2, and the results show that the lowest detection limit concentration of the kit to GBS is 1.0 multiplied by 100Copy/. mu.L, i.e.the minimum detection limit is 5 copies.
Example 6: repeatability test
Taking a precision reference product R1 in the enterprise reference products, detecting by using the kit in the embodiment 2 and the method in the embodiment 3, continuously repeating the test for 10 times, wherein the detection results are shown in a figure 3 and a table 2, and the results show that the Ct value variation coefficients of 100-time dilution products of the positive control are all less than 5%.
TABLE 2
Figure BDA0002130460190000111
The results show that the kit has the characteristics of good accuracy, high sensitivity, strong repeatability and convenient use, and is suitable for clinical use.
Comparative example 1
TABLE 3 control primer and Probe sequences
Figure BDA0002130460190000121
Taking positive control (i.e. plasmid solution containing GBS target gene fragment), determining its concentration and calculating copy number, diluting according to 10-fold concentration gradient, selecting 1.0 × 100～1.0×106The concentration of copies/. mu.L was used as a sample, and detection was performed using control primers and probes shown in Table 4.
The results showed that the lowest detection limit concentration of the control primers and probes to GBS was 100 copies/. mu.L (equivalent to a concentration of 10000 bacteria/mL), i.e., the lowest detection limit was 500 copies.
The results show that the reaction efficiency of the control primer and the probe is low, and the sensitivity is insufficient.
Example 7: influence of gynecological medication on sample detection
Common gynecological drugs and cleaning products on the market are selected, including a chylomicron suppository, a nifuratel nystatin vaginal soft capsule, a meifukang carbomer gel, a cervicitis-cleaning carbomer gel, an ofloxacin gel, a metronidazole furanone suppository and a jieeryin lotion, and are tested to verify the influence of the suppository on the detection of the kit.
The result shows that 0.1mg/mL erosion suppository, 10mg/mL nifuratel nystatin soft capsule, 10mg/mL meifukang carbomer gel, 10mg/mL cervicitis cleaning carbomer gel, 10mg/mL ofloxacin gel, 10mg/mL metronidazole furanone suppository and 0.1% Jieeryin lotion have no interference on detection and can accurately detect whether GBS infection exists in the medicine.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> Zhongsheng Fangzheng Biotechnology Ltd
<120> primers, probes, kit and detection method for detecting group B streptococcus
<130> MP1916188
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ctctcaatac aatttcggaa gg 22
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcttgcyctt gtgctaatac 20
<210> 3
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
atgacaccag aagcagcaac aacgatt 27
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
tctgactcct gaggagaagt ctgcc 25
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
catgcccagt ttctattggt ctcctt 26
<210> 6
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
ccttgcccca cagggcagta acgg 24
<210> 7
<211> 121
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
ctctcaatac aatttcggaa ggtatgacac cagaagcagc aacaacgatt gtttcgccaa 60
tgaagacata ttcttctgcg ccagctttga aatcaaaaga agtattagca caagagcaag 120
c 121
<210> 8
<211> 138
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
tctgactcct gaggagaagt ctgccgttac tgccctgtgg ggcaaggtga acgtggatga 60
agttggtggt gaggccctgg gcaggttggt atcaaggtta caagacaggt ttaaggagac 120
caatagaaac tgggcatg 138

Claims (10)

1. The primer and the probe for detecting the group B streptococcus are characterized by consisting of a primer with a nucleotide sequence shown in SEQ ID NO. 1-2 and a probe with a nucleotide sequence shown in SEQ ID NO. 3.
2. The primer and probe according to claim 1,
3, the 5 'end of the probe of the nucleotide sequence shown in SEQ ID NO. 3 is marked with a fluorescence reporter group FAM, and the 3' end is marked with a fluorescence quenching group BHQ 1.
3. Use of the primers and probes of claim 1 or 2 for the preparation of a kit for the detection of group B streptococcus.
4. A kit for detecting group B streptococcus comprising the primer or probe according to claim 1 or 2.
5. The kit according to claim 3, further comprising a primer pair and a probe for detecting the reference gene HBB;
the nucleotide sequence of the primer pair for detecting the reference gene HBB is shown as SEQ ID NO. 4-5;
the nucleotide sequence of the probe for detecting the reference gene HBB is shown in SEQ ID NO. 6.
6. The kit according to claim 4, wherein the probe having the nucleotide sequence shown in SEQ ID NO. 6 has a fluorescence reporter ROX labeled at the 5 'end and a fluorescence quencher BHQ2 labeled at the 3' end.
7. The kit of claim 3, further comprising a fluorescent quantitative PCR detection reagent and/or a sample extraction reagent;
the fluorescent quantitative PCR detection reagent comprises qPCR Master Mix enzyme mixed liquor and qPCR Master Mix reaction buffer solution; the qPCR Master Mix enzyme mixed solution comprises Taq enzyme and UNG enzyme, wherein the Taq enzyme is Antart Taq DNA polymerase, and the UNG enzyme is uracil-N-glycosylase;
the sample extraction reagent comprises NaOH, TritonX-100 and TE buffer solution.
8. The kit of claim 3, further comprising a positive control and/or a negative control;
the negative control substance is sterilized water;
the positive control substance is a plasmid solution containing a group B streptococcus target gene and an HBB gene fragment.
A method for detecting group B streptococcus, characterized in that the kit of any one of claims 3-8 is used for carrying out real-time fluorescent quantitative PCR detection on the DNA of a sample to be detected, and the S-shaped amplification curve generated is positive.
10. The detection method as claimed in claim 9, wherein the real-time fluorescence quantitative PCR system comprises:
Figure FDA0002130460180000021
the real-time fluorescent quantitative PCR program comprises:
2 minutes at 50 ℃;
pre-denaturation at 95 ℃ for 5 min;
95 ℃ for 15 seconds → 60 ℃ for 35 seconds, 45 cycles.
CN201910636659.9A 2019-07-15 2019-07-15 Primer, probe, kit and detection method for detecting group B streptococcus Pending CN112226522A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910636659.9A CN112226522A (en) 2019-07-15 2019-07-15 Primer, probe, kit and detection method for detecting group B streptococcus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910636659.9A CN112226522A (en) 2019-07-15 2019-07-15 Primer, probe, kit and detection method for detecting group B streptococcus

Publications (1)

Publication Number Publication Date
CN112226522A true CN112226522A (en) 2021-01-15

Family

ID=74111138

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910636659.9A Pending CN112226522A (en) 2019-07-15 2019-07-15 Primer, probe, kit and detection method for detecting group B streptococcus

Country Status (1)

Country Link
CN (1) CN112226522A (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148506A (en) * 2015-04-27 2016-11-23 重庆贝羿生物科技有限公司 The antenatal detection kit of a kind of B race streptococcus quantitative fluorescent PCR and application thereof
CN106967839A (en) * 2017-05-27 2017-07-21 济凡生物科技（北京）有限公司 Primer, probe, kit and the method for B races streptococcus fluorescence quantitative PCR detection
CN107557443A (en) * 2017-10-27 2018-01-09 广州赛哲生物科技股份有限公司 Group B streptococcus fluorescence quantitative PCR detection kit
CN109825615A (en) * 2019-01-09 2019-05-31 中生方政生物技术股份有限公司 Primer, probe, kit and the detection method of chlamydia trachomatis, gonococcus and urea substance Multiple detection

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106148506A (en) * 2015-04-27 2016-11-23 重庆贝羿生物科技有限公司 The antenatal detection kit of a kind of B race streptococcus quantitative fluorescent PCR and application thereof
CN106967839A (en) * 2017-05-27 2017-07-21 济凡生物科技（北京）有限公司 Primer, probe, kit and the method for B races streptococcus fluorescence quantitative PCR detection
CN107557443A (en) * 2017-10-27 2018-01-09 广州赛哲生物科技股份有限公司 Group B streptococcus fluorescence quantitative PCR detection kit
CN109825615A (en) * 2019-01-09 2019-05-31 中生方政生物技术股份有限公司 Primer, probe, kit and the detection method of chlamydia trachomatis, gonococcus and urea substance Multiple detection

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
黄锦炉等: "无乳链球菌(Streptococcus agalactiae)三重PCR快速检测方法的建立与应用", 海洋与湖沼, pages 254 - 261 *

Similar Documents

Publication Publication Date Title
CN109487013B (en) Herpes simplex virus type I and type II detection marker, primer probe pair, kit and detection method
CN112301169B (en) Primer group, probe group and kit for synchronously detecting pathogens related to multiple genital tract infections
CN109825615A (en) Primer, probe, kit and the detection method of chlamydia trachomatis, gonococcus and urea substance Multiple detection
CN103409508A (en) Gonococcus/ureaplasma urealyticum/chlamydia trachomatis triple nucleic acid detection kit
Elbaradie et al. Maternal and neonatal screening for Group B streptococci by SCP B gene based PCR: a preliminary study
CN104513854B (en) A kind of pathogen nucleic acid and drug resistance gene detection kit and its application
CN109487014B (en) Herpes simplex virus II type detection marker, primer probe pair, kit and detection method
CN108866164A (en) The streptococcic detection method of B race and kit
CN111471781A (en) Triple detection primer group for gonococcus, chlamydia trachomatis and mycoplasma urealytium, product and application
CN102329866B (en) PCR (polymerase chain reaction) fluorescence quantitative rapid test kit and method for chlamydia trachomatis
CN114990240B (en) Multiple qPCR detection reagent for detecting gynecological disease exogenous pathogens
CN112410442A (en) Method and kit for detecting ureaplasma urealyticum
CN112226522A (en) Primer, probe, kit and detection method for detecting group B streptococcus
KR20060104057A (en) Multiple diagnostic kit for sexually transmitted disease and detection method for bacteria inducing sexually transmitted disease using the same
CN111304295B (en) Kit for simultaneously detecting nucleic acids of neisseria gonorrhoeae, chlamydia trachomatis and ureaplasma urealyticum and application thereof
CN112609012B (en) Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting group B streptococcus nucleic acid
CN103882134A (en) Primer pair for detecting gardnerella vaginalis, kit and application thereof
CN103882133A (en) Primer pair for detecting ureaplasma urealyticum, kit and application thereof
CN116949196A (en) Specific trichomonas vaginalis fluorescence PCR detection kit
Asbill et al. Detection of Neisseria gonorrhoeae and Chlamydia trachomatis colonization of the gravid cervix
CN112646900A (en) Group B streptococcus nucleic acid colloidal gold immunochromatographic assay detection primer and kit
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV
Nasution et al. Multiplex PCR for the detection of urogenital pathogens in mothers and newborns
CN113249508B (en) Specific primer and probe for detecting group B streptococcus and application
Sulaiman et al. Comparison of nested and ELISA based polymerase chain reaction assays for detecting Chlamydia trachomatis in pregnant women with preterm complications.

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination