CN112226518A

CN112226518A - Molecular marker C69483 for rapidly identifying genetic sex of red swamp crayfish and application thereof

Info

Publication number: CN112226518A
Application number: CN202011070346.0A
Authority: CN
Inventors: 吕建建; 金玲; 刘萍; 李健; 高保全; 孟宪亮
Original assignee: Yellow Sea Fisheries Research Institute Chinese Academy of Fishery Sciences
Current assignee: Yellow Sea Fisheries Research Institute Chinese Academy of Fishery Sciences
Priority date: 2020-09-30
Filing date: 2020-09-30
Publication date: 2021-01-15
Anticipated expiration: 2040-09-30
Also published as: CN112226518B

Abstract

The invention provides a molecular marker C69483 for rapidly identifying the genetic sex of red swamp crayfish and application thereof. The nucleotide sequence of the molecular marker C69483 is shown as SEQ ID No.1, and the nucleotide sequence of the primer pair for detecting the molecular marker C69483 is the forward sequence C69483F: TCACTACCAGGCCACTTCAATTTG, reverse sequence C69483R: CTGGATTTATGTGAACAGGGAAGG are provided. The molecular marker C69483 provided by the invention is not affected by the tissue specificity and environment of the red crayfish, and is simple to use; the molecular marker can be used for rapidly and efficiently identifying the genetic sex of the red swamp crayfish, can promote the establishment of the breeding technology of the all-female or high-female fry of the red swamp crayfish, and has wide application prospect.

Description

Molecular marker C69483 for rapidly identifying genetic sex of red swamp crayfish and application thereof

Technical Field

The invention belongs to the technical field of DNA molecular markers, and particularly relates to a molecular marker C69483 for rapidly identifying the genetic sex of red swamp crayfish and application thereof.

Background

Red swamp crayfish (Cherax aquaticarinatus) belongs to the family Arthropoda, Crustacea, Depodophiala and Procambaridae, and is one of the most famous and expensive freshwater economic shrimp species in the world. The red swamp crayfish has the advantages of large individual, poor feeding, fast growth, less diseases, strong adaptability and the like. The red swamp crayfish is popular in Europe and America and the like because of high edible part ratio, delicious meat taste and high nutritional value, and has wide market prospect. In the breeding process, the male shrimps fight violently due to the fact that mating right is robbed, so that the death rate is high, and if efficient parthenocarpy breeding can be achieved, breeding benefits are obviously improved. However, there is no efficient sex control technology for the red crayfish.

The molecular marker is a genetic marker based on nucleotide sequence variation of genetic materials among individuals, and is a direct reflection of DNA level genetic polymorphism. The molecular marker has remarkable advantages: most molecular markers are co-dominant, and selection of recessive characters is very convenient; the genome variation is extremely abundant, and the number of molecular markers is almost unlimited; the DNA of different tissues at different stages of biological development can be used for marking analysis; the molecular marker is simple and rapid to detect. At present, no research or report about the sex molecular marker of the red swamp crayfish exists, so that the development of the molecular marker related to the sex identification of the red swamp crayfish can realize the parthenocarpy breeding of the red swamp crayfish, improve the economic benefit of farmers and have important significance for the breeding and the breeding of the red swamp crayfish.

Disclosure of Invention

The invention provides a molecular marker C69483 for rapidly identifying the genetic sex of red swamp crayfish and application thereof. The W specific section is screened by a comparative omics and bioinformatics analysis method, and a new molecular marker C69483 for identifying the genetic sex of the red swamp crayfish is obtained by screening, the molecular marker has high identification efficiency and accuracy, can be used for cultivating all-female or high-female-ratio red swamp crayfish fries, and is beneficial to the breeding development of the red swamp crayfish.

In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:

the invention provides a molecular marker C69483 for rapidly identifying the genetic sex of red swamp crayfish, and the nucleotide sequence of the molecular marker C69483 is shown as SEQ ID No. 1.

The invention also provides a primer pair for detecting the molecular marker C69483, wherein the nucleotide sequence of the primer pair is as follows:

C69483F：TCACTACCAGGCCACTTCAATTTG，

C69483R：CTGGATTTATGTGAACAGGGAAGG。

the invention also provides application of the molecular marker C69483 in identification of genetic sex of the red swamp crayfish.

Further: the molecular marker C69483 is used for identifying the genetic sex of the red swamp crayfish and comprises the following steps: the molecular marker C69483 is used for identifying the genetic sex of the red swamp crayfish and comprises the following steps: extracting the genomic DNA of the muscle tissue of the red crayfish, taking the genomic DNA as a template, and carrying out PCR amplification reaction by using the primer pair C69483F and C69483R; and (3) carrying out electrophoresis on the PCR amplification product, wherein the red swamp crayfish is female if the electrophoresis result shows that the red swamp crayfish has a strip, and the red swamp crayfish is male if the electrophoresis result does not show the strip.

Further: the reaction condition of the PCR amplification is 94 ℃ and 30 s; repeating 30 cycles at 98 deg.C, 10s, 56 deg.C, 30s, 72 deg.C, 1 min; 72 ℃ for 2 min.

The invention also provides application of the molecular marker C69483 in breeding of all-female or high-female-ratio crayfish fries.

Compared with the prior art, the invention has the following advantages and beneficial effects:

the molecular marker C69483 for rapidly identifying the genetic sex of the red swamp crayfish provided by the invention is not influenced by the tissue specificity and the environment of the red swamp crayfish, is simple, convenient and rapid in sex identification, low in requirement on samples, high in accuracy of identification results, capable of being used for identifying the genetic sex of the red swamp crayfish, and capable of promoting the establishment of a breeding technology of all-female or high-female-ratio red swamp crayfish fries, so that the method has a wide application prospect.

Drawings

FIG. 1: a mixed DNA amplification map of the red swamp crayfish; wherein, M: a standard molecular weight; a and B: mixing the male shrimps; c and D: mixing female shrimps;

FIG. 2: a female-specific signature of a crayfish; wherein, M: a standard molecular weight; 1-12: male shrimps; 13-24: female shrimps.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to specific examples. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1

1. DNA extraction

Muscle tissues of the crayfish are dissected, DNA extraction kit of TransGen Biotech is used for extracting genomic DNA of the crayfish, and the extracted DNA is subjected to agarose gel electrophoresis and a nucleic acid quantifier for quality detection. And selecting DNA with better quality and integrity for later use.

2. DNA mixing pool construction

The individual DNA is mixed in equal quantity, 2 male and female DNA mixing pools are prepared, the concentration is 292.8 ng/mu l-363.3 ng/mu l, each mixing pool comprises 15 individuals, and the DNA is used for subsequent experiments.

3. Primer design

The red chelonian is ZW/ZZ sex determination type, candidate W specific sections are screened by comparative omics and bioinformatics analysis methods, and then sex markers are screened and verified from the W specific sections. Primer Premier 5.0 software is used to design primers for the W candidate Contig, a labeled DNA sequence (shown as SEQ ID No. 1) is screened, and a detection Primer of the sequence is designed. The design criteria for the primers were:

1) the length of the PCR product covers the marker sequence as much as possible,

2) the annealing temperature of the primer is 50-60 ℃,

3) the formation of stable dimer and hairpin structures between the primers itself and the primers is avoided as much as possible.

The primer information used in this example is shown in Table 1:

table 1: primer information

4. Mixed template PCR amplification and electrophoresis

PCR amplification was performed using AG enzyme from Escire using mixed DNA as a template, and the reaction program was set as follows: 30s at 94 ℃; 30 cycles of 98 ℃, 10s, 56 ℃, 30s, 72 ℃, 1 min; 72 ℃ for 2 min. The PCR system was as follows:

the mixed template PCR products were subjected to 1% agarose gel electrophoresis, and the electrophoresis results showed that the desired band was not amplified in 2 male mixed DNA pools, but was amplified in 2 female mixed pools (FIG. 1).

5. PCR amplification and electrophoresis of male and female individuals

After the 24 individual tissue DNAs of the individual procambarus clarkia were extracted and used as templates for PCR, and PCR primers, PCR system and PCR amplification reaction program were the same as those described above, the obtained individual template PCR products were subjected to 1% agarose gel electrophoresis, and the results of the electrophoresis were shown (FIG. 2): the band of interest was not amplified in all male individuals tested, while the band of interest was amplified in all female individuals tested.

Research results show that the molecular marker C69483 obtained by the invention can accurately distinguish the genetic sex of the red swamp crayfish, and the application steps are as follows: extracting the genomic DNA of the muscle tissue of the red swamp crayfish, and carrying out PCR amplification reaction by using the extracted genomic DNA as a template and using the amplification primers C69483F and C69483R of molecular markers; and (3) carrying out agarose gel electrophoresis on the PCR amplification product, wherein if a band is displayed by the electrophoresis result, the PCR amplification product is female, and if no band is displayed by the electrophoresis result, the PCR amplification product is male. The molecular marker C69483 can also be used for cultivating all-female or high-female-ratio crayfish fries, and is beneficial to the breeding development of the crayfish.

The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.

Sequence listing

<110> research institute for aquatic products in yellow sea of China institute for aquatic science

<120> molecular marker C69483 for rapidly identifying genetic sex of red swamp crayfish and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 451

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

attatcacta ccaggccact tcaatttgac ttacattcta tgaattattt gagtttgtct 60

tatactccaa tactaaattt ttttcccaat cattctgtaa ggtagtaact gaacatcata 120

ctgtggtcag tatcccaaaa aatagacttg gttcatatca gtttttagct cgctgtgttc 180

catggttgac tttctcatac aagttatagt actgtctgct aaggatgatg cacttctgtg 240

gcttatcccc ctgtttgtca ggtatgtcgg atatggtgat atatcagaca ctatactgat 300

gaacgatggt gacgataata gtggtgacta aactgcagat ccggagcatg tacagagtac 360

cttccctgtt cacataaatc cagtcaagca cctaaattta tgggaaagtt tgaagtctcg 420

agctgttttc cttaaacttt ggttagtcga a 451

Claims

1. A molecular marker C69483 for rapidly identifying the genetic sex of the red swamp crayfish is characterized in that the nucleotide sequence of the molecular marker C69483 is shown as SEQ ID No. 1.

2. Primer pair for the detection of the molecular marker C69483 according to claim 1, wherein the nucleotide sequence of said primer pair is:

C69483F：TCACTACCAGGCCACTTCAATTTG，

C69483R：CTGGATTTATGTGAACAGGGAAGG。

3. the use of the molecular marker C69483 according to claim 1 for the identification of the genetic sex of red crayfish.

4. The use according to claim 3, wherein the molecular marker C69483 identifies the genetic sex of red crayfish by: extracting the genomic DNA of the muscle tissue of the red crayfish, taking the genomic DNA as a template, and carrying out PCR amplification reaction by using the primer pair C69483F and C69483R; and (3) carrying out electrophoresis on the PCR amplification product, wherein the red swamp crayfish is female if the electrophoresis result shows that the red swamp crayfish has a strip, and the red swamp crayfish is male if the electrophoresis result does not show the strip.

5. The use according to claim 4, wherein the PCR amplification is carried out at 94 ℃, 30 s; repeating 30 cycles at 98 deg.C, 10s, 56 deg.C, 30s, 72 deg.C, 1 min; 72 ℃ for 2 min.

6. The use of the molecular marker C69483 according to claim 1 for breeding of whole female or high female ratio crayfish larvae.