CN112225809B

CN112225809B - PD-1 targeting monoclonal antibody and application thereof

Info

Publication number: CN112225809B
Application number: CN201910916750.6A
Authority: CN
Inventors: 林基祯; 方树彬; 金荣; 林金香; 李修凤; 翁焕娇
Original assignee: Fuzhou Cremab Pharmaceutical Inc
Current assignee: Xiamen Haiwan Biotechnology Co.,Ltd.
Priority date: 2019-06-30
Filing date: 2019-09-26
Publication date: 2023-09-05
Anticipated expiration: 2039-09-26
Also published as: CN112225809A

Abstract

The present invention provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to PD-1 with high affinity. Nucleic acid molecules encoding the antibodies of the invention, expression vectors, host cells and methods for expressing the antibodies of the invention, and pharmaceutical compositions comprising the antibodies of the invention are also provided. Another aspect of the invention relates to methods of modulating immune responses using anti-PD-1 antibodies, providing their use for enhancing T cell function and thereby up-regulating cell-mediated immune responses, and methods of treating various diseases, including infection and tumor immunity.

Description

PD-1 targeting monoclonal antibody and application thereof

Technical Field

The invention relates to the field of biopharmaceuticals, in particular to a monoclonal antibody directed against human PD-1 and application thereof in disease treatment.

Background

Programmed death receptor 1 (PD-1) is an immunosuppressive receptor expressed on T cells, B cells, and bone marrow cells. PD-1 (encoded by the gene Pdcd 1)Code) and CTLA-4 belong to the CD28 family of receptors, which have 23% amino acid sequence homology with CTLA-4 (Okazaki, T).&Honjo, t.trends immunol.27,195-201 (2006)). PD-1 protein is a 55kDa type I transmembrane protein comprising an extracellular IgV region, a transmembrane region and an intracellular region comprising an immunoreceptor tyrosine-inhibiting motif (ITIM) proximal to the membrane and a tyrosine-based switching motif (ITSM) distal to the membrane (Thomas, M.L. (1995) J Exp Med 181:1953-6; vivier, E and Daeron, M (1997) Immunol Today 18:286-91). Although similar in structure to CTLA-4, PD-1 lacks the MYPPPY motif necessary for binding B7-1 and B7-2. Two ligands for PD-1 have been identified, PD-L1 and PD-L2, which have been shown to down-regulate T cell activation upon binding to PD-1. PD-L1 and PD-L2 are both B7 homologs that bind to PD-1 but do not bind to other CD28 family members. PD-L1 is expressed on B cells, T cells, macrophages and Dendritic Cells (DCs), but is also expressed in peripheral cells (e.g., microvascular endothelial cells) and non-lymphoid organs (e.g., heart, lung, etc.). PD-L2 is only present in activated macrophages and DCs. In addition, PD-L1 and PD-L2 are also often expressed in a variety of tumor cells, and biopsy has been found by immunohistochemical evaluation to be PD-1 (on tumor infiltrating lymphocytes) and/or PD-L1 (on tumor cells) in many primary tumors in humans. Such tissues include lung cancer, liver cancer, ovarian cancer, cervical cancer, skin cancer, colon cancer, glioma, bladder cancer, breast cancer, kidney cancer, esophageal cancer, gastric cancer, oral squamous cell carcinoma, urothelial cell carcinoma and pancreatic cancer, and head and neck tumors. Recent studies have shown that blocking the interaction between PD-1 and its ligand blocks negative regulatory signals in T cells, restoring tumor-specific CD8 ⁺ The killing activity of T cells suggests that tumor cells can escape immune surveillance using the PD-1/PD-L1 pathway, blocking this pathway helps the immune system clear tumor cells. Molecular and Biochemical Aspects of the PD-1Checkpoint Pathway,Vassiliki A.Boussiotis,NEJM n engl j med 375;18 PD-1 and related studies are reviewed in detail in nejm.org November 3,2016.

A very large number of related patents for PD-1/PD-L1 antibodies have been published, for example PCT International application PCT/JP2006/309606, which is believed to be related to the OPdivo of Bai-Shi-Mei-Guibao, discloses isolated monoclonal antibodies that bind specifically to PD-1 with high affinity. PCT International application PCT/US2008/007463 discloses an antibody directed against the human programmed death receptor PD-1, which is believed to be associated with the Merck company Keystuda. Other patents related to PD-1/PD-L1 antibodies may be referenced in PCT/US2009/067104, PCT/CN2014/091090, PCT/CN2016/102238, PCT/CN2013/083467, CN201310258289.2, and the like, all of which are incorporated herein by reference.

At present, research hotspots in the technical field of global PD-1/PD-L1 are concentrated in four major fields: (1) combined immunotherapy, (2) combined small molecule targeted drug therapy, (3) detection of efficacy prediction biomarkers, and (4) application in treating various high-frequency tumors. The most literature is concerned with small molecule targeted drugs and other immune checkpoint treatment schemes, and indications are mainly focused on high-grade tumors of European and American populations such as non-small cell lung cancer, bladder cancer, head and neck cancer, prostate cancer, pancreatic cancer, malignant melanoma and the like. In addition to their use in the treatment of tumors, anti-PD-1 antibodies can also be used in chronic viral infections. Recently, studies have shown that PD-1 is highly expressed in T cells from HIV-infected individuals.

Since 2014, 9 th month, PD-1/PD-L1 antibodies have been officially approved by the us FDA for use in malignant melanoma, non-small cell lung cancer, liver cancer, stomach cancer, kidney cancer, bladder cancer, head and neck tumors, hodgkin's lymphoma, cervical cancer, merkel cell carcinoma, and solid tumors of all microsatellite highly unstable (MSI-H). In addition, the traditional Chinese medicine composition has preliminary and encouraging curative effects in clinical tests of various other solid tumors such as colorectal cancer, nasopharyngeal cancer, ovarian cancer, prostate cancer, endometrial cancer, glioma, neuroendocrine tumor, malignant mesothelioma, non-Hodgkin lymphoma and the like.

PD-1/PD-L1 antibody drugs that have been approved for marketing

There are 9 drugs approved for PD-1/PD-L1 on the market, wherein the 6 PD-1 antibodies are OPdivo of Bai-Shi-Guibao, keystuda of moxadong, libtayo developed by combining Sai Fei (Sanofi) and Regeneron (Regenon), terep Li Shan antibody developed by Jun-Shi-Gao, sidi Li Shan antibody developed by Xinda and Carilizumab developed by Jiangsu Hengsu, and the 3 PD-L1 antibodies are Tecentriq of Roche, imfinzi of Alstican and Bavencio of merck. The indications for these several drug approvals are shown in the table above.

In China, the 6 PD-1 antibodies except Libtayo are approved and marketed, and the average treatment cost of tumor patients in China when using PD-1 antibody medicaments is lower than that of European and American countries due to the intense competition between medicaments. For example, the imported drug Opdivo has a annual cost of about 48 ten thousand yuan for treating lung cancer indications in China, while the jungdi organism has been approved by the first household in China for treating advanced melanoma as terlipressin Li Shan antibody, which reduces the treatment cost to about 18 ten thousand yuan.

Even so, the mobile lot, hundreds of thousands of medication costs are still a significant burden to the domestic patient population whose nationwide residents can manage revenue 28228 yuan (2018 national statistics). Although various PD-1 antibodies are currently marketed or under investigation, it is still clinically desirable to provide a PD-1 antibody that has higher affinity and specific binding to human PD-1, with better therapeutic efficacy and lower cost.

Summary of The Invention

The present invention provides isolated monoclonal antibodies, particularly human monoclonal antibodies, that specifically bind to PD-1 with high affinity. Nucleic acid molecules encoding the antibodies of the invention, expression vectors, host cells and methods for expressing the antibodies of the invention, and pharmaceutical compositions comprising the antibodies of the invention are also provided.

Another aspect of the invention relates to methods of modulating immune responses using anti-PD-1 antibodies, providing their use for enhancing T cell function and thereby up-regulating cell-mediated immune responses, and methods of treating various diseases, including infections (e.g., acute and chronic) and tumor immunity.

In one aspect, the invention provides an isolated monoclonal antibody, or antigen binding portion thereof, comprising:

(a) A heavy chain variable region CDR1 comprising a sequence selected from SEQ ID NOs: 1. SEQ ID NO: 7. or SEQ ID NO:13, a consensus amino acid sequence as set forth in seq id no;

(b) A heavy chain variable region CDR2 comprising a sequence selected from SEQ ID NOs: 2. SEQ ID NO: 8. or SEQ ID NO:14, a consensus amino acid sequence as set forth in seq id no;

(c) A heavy chain variable region CDR3 comprising a sequence selected from SEQ ID NOs: 3. SEQ ID NO: 9. or SEQ ID NO:15, and a corresponding amino acid sequence as shown in seq id no;

(d) A light chain variable region CDR1 comprising a sequence selected from SEQ ID NOs: 4. SEQ ID NO: 10. or SEQ ID NO:16, and a corresponding amino acid sequence as set forth in seq id no;

(e) A light chain variable region CDR2 comprising a sequence selected from SEQ ID NOs: 5. SEQ ID NO: 11. or SEQ ID NO:17, and a corresponding amino acid sequence as set forth in seq id no; and

(f) A light chain variable region CDR3 comprising a sequence selected from SEQ ID NOs: 6. SEQ ID NO: 12. or SEQ ID NO:18, and a corresponding amino acid sequence as set forth in seq id no;

Wherein the antibody or antigen binding portion thereof specifically binds to PD-1.

In another embodiment, the invention provides an isolated monoclonal antibody, or antigen binding portion thereof, having a CDR sequence homology of at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% for the heavy chain variable region and the light chain variable region.

In another embodiment, the invention provides an isolated monoclonal antibody, or antigen binding portion thereof, comprising:

(a) The amino acid sequences of the heavy chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences of SEQ ID NOs: 1. SEQ ID NO:2 and SEQ ID NO:3, and the amino acid sequences of the light chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences shown in SEQ ID NO: 4. SEQ ID NO:5 and SEQ ID NO:6, the amino acid sequences shown in the formula I are identical; or (b)

(b) The amino acid sequences of the heavy chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences of SEQ ID NOs: 7. SEQ ID NO:8 and SEQ ID NO:9, and the amino acid sequences of the light chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences shown in SEQ ID NO: 10. SEQ ID NO:11 and SEQ ID NO:12, the amino acid sequences shown in 12 are identical; or (b)

(c) The amino acid sequences of the heavy chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences of SEQ ID NOs: 13. SEQ ID NO:14 and SEQ ID NO:15, and the amino acid sequences of the light chain variable regions CDR1, CDR2 and CDR3 are identical to the amino acid sequences shown in SEQ ID NO: 16. SEQ ID NO:17 and SEQ ID NO:18, and the amino acid sequences shown in the formula I are identical;

In yet another embodiment, the invention provides an isolated monoclonal antibody, or antigen-binding portion thereof, comprising heavy and light chain variable region sequences:

(a) A heavy chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 19. SEQ ID NO:23 or SEQ ID NO:27, and a corresponding amino acid sequence as set forth in seq id no;

(b) A light chain variable region comprising a sequence selected from the group consisting of SEQ ID NOs: 21. SEQ ID NO:25 or SEQ ID NO:29, and a corresponding amino acid sequence as set forth in seq id no;

In another embodiment, the invention provides an isolated monoclonal antibody, or antigen-binding portion thereof, having a heavy chain variable region that hybridizes to a heavy chain variable region selected from the group consisting of SEQ ID NOs: 19. SEQ ID NO:23 or SEQ ID NO:27 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology; the light chain variable region thereof hybridizes to a sequence selected from the group consisting of SEQ ID NOs: 21. SEQ ID NO:25 or SEQ ID NO:29 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology.

(a) A heavy chain variable region having an amino acid sequence identical to SEQ ID NO:19, and the amino acid sequences shown in the formula I are identical; and a light chain variable region having an amino acid sequence identical to SEQ ID NO:21, and the amino acid sequences shown in the formula (I) are identical; or (b)

(b) A heavy chain variable region having an amino acid sequence identical to SEQ ID NO:23, and the amino acid sequences shown in the figure are identical; and a light chain variable region having an amino acid sequence identical to SEQ ID NO:25, and the amino acid sequences shown in the formula (I) are identical; or (b)

(c) A heavy chain variable region having an amino acid sequence identical to SEQ ID NO:27, and the amino acid sequences shown in the formula (I) are identical; and a light chain variable region having an amino acid sequence identical to SEQ ID NO:29, and the amino acid sequences shown in the formula (I) are identical;

In another embodiment, the antibody is a full length antibody comprising a human or murine constant region. In yet another aspect, the human constant region is selected from the group consisting of IgGl, igG2, igG3, igG4. In yet another specific aspect, the human constant region is IgG4. In yet another aspect, the murine constant region is selected from the group consisting of IgGl, igG2A, igG2B, igG 3. In yet another specific aspect, the antibody has reduced or minimal effector function. In yet another specific aspect, the minimal effector function is produced by deglycosylation (glycation).

In another embodiment, the antibody or antibody fragment of the invention is a chimeric antibody or chimeric antibody fragment.

In another embodiment, the antibody or antibody fragment of the invention is a human antibody or human antibody fragment.

In another embodiment, the antibody or antibody fragment of the invention is a humanized antibody or humanized antibody fragment.

In another embodiment, the antibody fragment of the invention is a Fab, fab '-SH, fv, scFv, or F (ab') 2 antibody fragment.

In another embodiment, the antibody fragment of the invention is a diabody.

The invention also includes bispecific antibodies comprising any of the above antibodies or antibody fragments that bind to human PD-1.

In another embodiment, the invention provides an isolated monoclonal antibody comprising:

(a) A heavy chain having a sequence identical to SEQ ID NO: 34. SEQ ID NO:36 or SEQ ID NO:38, and the amino acid sequences shown in the figure are identical; and

(b) A light chain having a sequence identical to SEQ ID NO: 40. SEQ ID NO:42 or SEQ ID NO:44, and the amino acid sequences shown in seq id no;

In a particularly preferred embodiment of the invention, the invention provides an isolated monoclonal antibody comprising:

(a) A heavy chain having a sequence identical to SEQ ID NO:34, and the amino acid sequences shown in the figures are identical; and

(b) A light chain having a sequence identical to SEQ ID NO:40, and the amino acid sequences shown in the formula (I) are identical;

The invention provides isolated polynucleotides encoding the antibodies or antibody fragments. In some embodiments, the nucleotide sequence encoding the heavy chain of the antibody is shown as SEQ ID NO. 20, SEQ ID NO. 24, SEQ ID NO. 28, SEQ ID NO. 30, SEQ ID NO. 33, SEQ ID NO. 35, or SEQ ID NO. 37, and the nucleotide sequence encoding the light chain of the antibody is shown as SEQ ID NO. 21, SEQ ID NO. 25, SEQ ID NO. 29, SEQ ID NO. 39, SEQ ID NO. 41, or SEQ ID NO. 43.

The invention provides expression vectors comprising the isolated polynucleotides, and host cells comprising the expression vectors.

The invention provides pharmaceutical compositions comprising the antibodies or antibody fragments and a pharmaceutically acceptable carrier.

The invention provides methods of increasing the activity of an immune cell comprising contacting the immune cell with the antibody or antibody fragment.

The invention provides a method of treating a disease comprising administering to a subject in need of treatment a therapeutically effective amount of an antibody or antibody fragment of the invention. In yet another aspect, the invention provides a method of modulating an immune response in a subject comprising administering to the subject an antibody, or antigen-binding portion thereof, of the invention such that the immune response in the subject is modulated. Preferably, the antibodies of the invention enhance, stimulate or increase an immune response in a subject.

In some embodiments, wherein the disease is cancer or an infectious disease. In some embodiments, the method comprises co-administering to the subject an additional drug or therapy.

The invention provides the use of said antibody or antibody fragment in the manufacture of a medicament for the treatment of a disease, wherein said disease is cancer or an infectious disease. In one aspect, the invention provides a method of inhibiting tumor cell growth in a subject comprising administering to the subject a therapeutically effective amount of an anti-PD-1 antibody, or antigen-binding portion thereof. The antibodies of the invention are preferably used in this method, although other anti-PD-1 antibodies can be used instead of (or in combination with) the anti-PD-1 antibodies of the invention. For example, chimeric, humanized or fully human anti-PD-1 antibodies may be used in methods of inhibiting tumor growth.

In another aspect, the invention provides a method of treating an infectious disease in a subject comprising administering to the subject a therapeutically effective amount of an anti-PD-1 antibody or antigen-binding portion thereof. The antibodies of the invention are preferably used in this method, although other anti-PD-1 antibodies can be used instead of (or in combination with) the anti-PD-1 antibodies of the invention. For example, chimeric, humanized or fully human anti-PD-1 antibodies may be used in methods of treating infectious diseases.

In some embodiments, the antibody has higher affinity, better blocking effect and higher cell killing activity when being used for inhibiting the growth of tumor cells. The affinity of the monoclonal antibody is about 10 times higher than that of the existing therapeutic monoclonal antibody, and the in vitro blocking of the interaction of PD-L1/PD-1 is very effective. Compared with the marketed product Opdivo (Nivolumab) of American company (BMS), the blocking effect and the in vitro killing activity of the monoclonal antibody are improved, and the monoclonal antibody has more excellent effect on inhibiting the growth of tumor cells.

Drawings

Fig. 1: ELISA method serum titers of female Balb/c mice were determined. The horizontal axis represents dilution and the vertical axis represents OD values measured, UM1-1/UM1-2/UM1-3/UM1-4 representing different mice.

Fig. 2: flow cytometry was used to determine the blocking activity of murine PD-1 monoclonal antibodies. The horizontal axis represents antibody concentration, the vertical axis represents blocking rate, UM1-45/UM1-47/UM1-51/UM1-56/UM1-63/UM1-69 represents different murine PD-1 monoclonal antibodies.

Fig. 3: the humanized PD-1 monoclonal antibody is separated and purified by a ProteinA affinity method. The horizontal axis represents mobile phase volume, and the vertical axis represents ultraviolet absorbance. Fig. 3-2 is an enlarged view of a portion of fig. 3-1.

Fig. 4: SDS-PAGE detects the molecular weight of the antibodies. FIG. 4-1SDS-PAGE (reduction), FIG. 4-2SDS-PAGE (non-reduction)

Fig. 5: the purity of the antibody is detected by ultra-high performance liquid molecular exclusion chromatography UPLC-SEC. The horizontal axis represents time, and the vertical axis represents absorbance.

Fig. 6: octet Red96 assay affinity. The horizontal axis represents time, and the vertical axis represents the binding height.

Fig. 7: flow cytometry was used to determine humanized PD-1 monoclonal antibodies (hUM 1-30) blocking activity.

Fig. 8: SPC lung cancer model mice were tested for tumor-eliminating effects. The horizontal axis is days and the vertical axis is tumor volume.

Fig. 9: SPC lung cancer model murine survival curve. The horizontal axis represents days, and the vertical axis represents percent survival.

Fig. 10: each SPC lung cancer model mouse was given the effect of the positive control antibody Opdivo treatment. The horizontal axis is days and the vertical axis is tumor volume.

Fig. 11: each SPC lung cancer model mouse was given the therapeutic effect of humanized PD-1 monoclonal antibodies (hUM 1-30). The horizontal axis is days and the vertical axis is tumor volume.

Fig. 12: each SPC lung cancer model mouse was given the therapeutic effect of the negative control antibody huIgG. The horizontal axis is days and the vertical axis is tumor volume.

Detailed Description

In one aspect, the invention relates to isolated monoclonal antibodies, in particular human monoclonal antibodies, which specifically bind to PD-1. In certain embodiments, the antibodies of the invention exhibit one or more superior functional properties, such as high affinity binding to human PD-1, the ability to inhibit the binding of one or more PD-1 ligands (e.g., PD-L1 and/or PD-L2), the ability to stimulate an antigen-specific memory response, the ability to stimulate an antibody response, and/or the ability to inhibit tumor cell growth in vivo.

The invention provides, for example, isolated antibodies, methods of making such antibodies, and pharmaceutical compositions containing the antibody molecules of the invention.

In another aspect, the invention relates to methods of inhibiting tumor cell growth in a subject using an anti-PD-1 antibody. As demonstrated herein, anti-PD-1 antibodies are capable of inhibiting tumor cell growth in vivo. The invention also relates to methods of using the antibodies to modulate immune responses and treat diseases such as cancer or infectious diseases, or to stimulate a protective autoimmune response or to stimulate an antigen-specific immune response (e.g., by co-administration of anti-PD-1 and an antigen of interest).

To make the invention easier to understand, certain terms are first defined. Additional definitions will be set forth throughout the detailed description.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art, which are fully explained in the technical literature and general textbooks of the art, such as Molecular Cloning: a Laboratory Manual (molecular cloning: laboratory Manual), etc.

The terms "programmed death 1", "programmed cell death 1", "protein PD-1", protein,

"PD-1", "PD1", "PDCD1", "hPD-1" and "hPD-1" are used interchangeably and include variants, isoforms (isoport), species homologs of human PD-1 and analogs having at least one epitope in common with PD-1. The complete PD-1 sequence can be found according to GenBank accession number U64863.

An "antibody" refers to any form of antibody that exhibits a desired biological activity (e.g., inhibits ligand binding to its receptor or receptor signaling induced by inhibition of ligand). Thus, "antibody" is used in its broadest sense and specifically includes, but is not limited to, monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, and multispecific antibodies (e.g., bispecific antibodies).

"antibody fragment" and "antibody binding fragment" means antigen binding fragments of antibodies and antibody analogs, including but not limited to: fab, fab ', F (ab') 2, and Fv fragments; a diabody; linear antibodies (linear antibodies); single chain antibody molecules, e.g., scFv, monoclonal antibodies; a nanobody; domain antibodies (nanobodies); and multispecific antibodies formed from antibody fragments, and the like. Engineered antibody variants are reviewed in Holliger and Hudson (2005) nat biotechnol.23: 1126-1136.

"Fab fragment" consists of a light chain and a heavy chain CH1 and variable domains. The heavy chain of a Fab molecule cannot form disulfide bonds with another heavy chain molecule.

The "Fc" region contains two heavy chain fragments comprising the CH1 and CH2 domains of an antibody. The two heavy chain fragments are held together by two or more disulfide bonds and by the hydrophobic effect of the CH3 domain.

"Fab ' fragments" contain portions of one light chain and one heavy chain comprising the VH domain and CH1 domain and the region between the CH1 and CH2 domains, whereby an inter-chain disulfide bond can be formed between the two heavy chains of two Fab ' fragments to form a F (ab ') 2 molecule.

"F (ab') 2 fragments" contain two light chains and two heavy chains comprising portions of the constant region between the CH1 and CH2 domains, thereby forming interchain disulfide bonds between the two heavy chains. Thus, a F (ab ') 2 fragment consists of two Fab' fragments held together by disulfide bonds between the two heavy chains.

The "Fv region" comprises variable regions from both the heavy and light chains, but lacks constant regions.

"Single chain Fv antibody" (or "scFv antibody") refers to an antibody fragment comprising the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, fv polypeptides additionally comprise a polypeptide linker between the VH and VL domains that allows the scFv to form the desired structure for antigen binding.

A "diabody" is a small antibody fragment having two antigen binding sites. The fragments comprise a heavy chain variable domain (VH) (VH-VL or VL-VH) linked to a light chain variable domain (VL) in the same polypeptide chain. By using a linker that is so short that it is not possible to pair between two domains of the same strand, the domains are forced to pair with complementary domains of the other strand and form two antigen binding sites.

"chimeric antibody" is intended to mean an antibody in which the variable region sequences are derived from one species and the constant region sequences are derived from another species, such as an antibody in which the variable region sequences are derived from a mouse antibody and the constant region sequences are derived from a human antibody.

A "humanized" form of a non-human (e.g., murine) antibody is a chimeric antibody that contains minimal sequences derived from a non-human immunoglobulin. The majority of humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient antibody are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or non-human primate having the desired specificity, affinity and capacity. In some cases, fv Framework Region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. In addition, the humanized antibody may comprise residues not present in the recipient antibody or the donor antibody. These modifications were made to further improve antibody performance. In general, humanized antibodies will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody also optionally comprises at least a portion of an immunoglobulin (typically a human immunoglobulin) constant region (Fc).

An "isolated" antibody is an antibody that has been identified and isolated from its natural environmental components (e.g., an isolated antibody that specifically binds to PD-1 without substantially binding to an antigen other than PD-1), the contaminating components of which are substances that interfere with the diagnostic or therapeutic use of the antibody, and may include enzymes, hormones, and other proteinaceous or non-proteinaceous solutes. In some embodiments, the antibody is purified to greater than 95% purity, more preferably greater than 99% purity, as determined by the Lowry method. The isolated antibodies are typically prepared by at least one purification step.

An "isolated" nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminating nucleic acid molecule with which it is typically associated in the natural source of the antibody nucleic acid. The isolated nucleic acid molecule differs from its naturally occurring form or environment.

The term "monoclonal antibody" or "monoclonal antibody composition" as used herein refers to a preparation of antibody molecules of a single molecule composition. Monoclonal antibody compositions exhibit a single binding specificity and affinity for a particular epitope. The monoclonal antibodies used in the present invention may be prepared by the hybridoma method first described by Kohler et al (1975,Nature 256:495), or may be prepared by recombinant DNA methods. Monoclonal antibodies herein expressly include "chimeric" antibodies or humanised antibodies.

The term "immune cell" as used herein includes cells of hematopoietic origin and which play a role in the immune response. The immune cells include: lymphocytes, such as B cells and T cells; natural killer cells; myeloid cells, such as monocytes, macrophages, eosinophils, mast cells, basophils and granulocytes.

As used herein, a sequence "variant" refers to a sequence that differs from the sequence shown at one or more amino acid residues but retains the biological activity of the resulting molecule.

The term "about" as used herein means that the value is within an acceptable error range for the particular value being determined by one of ordinary skill in the art, which value depends in part on how the measurement or determination is made (i.e., the limits of the measurement system). For example, "about" or "substantially comprising" may mean a range of up to 20%. Furthermore, the term may mean at most one order of magnitude or at most 5 times the value, especially for biological systems or processes. Unless otherwise indicated, when a particular value is found in the present disclosure and claims, the meaning of "about" or "consisting essentially of" should be assumed to be within the acceptable error range for that particular value.

When referring to an animal, human, subject, cell, tissue, organ or biological fluid with "administration" and "treatment" it is meant that the exogenous drug, therapeutic, diagnostic agent or composition is contacted with the animal, human, subject, cell, tissue, organ or biological fluid. "administration" and "treatment" may refer to, for example, therapeutic methods, pharmacokinetic methods, diagnostic methods, research methods, and experimental methods. Treating the cell includes contacting the agent with the cell and contacting the agent with a fluid, wherein the fluid is in contact with the cell. "administration" and "treatment" also mean in vitro and ex vivo treatment of cells, e.g., by agents, diagnostic agents, binding compositions, or by other cells.

An "effective amount" includes an amount sufficient to ameliorate or prevent a symptom or condition of a medical disorder. An effective amount also means an amount sufficient to allow diagnosis or facilitate diagnosis. The effective amount for a particular subject can vary depending upon a variety of factors, such as the disease to be treated, the overall health of the patient, the route of administration, and the dosage and severity of the side effects. An effective amount may be the maximum dose or regimen that avoids significant side effects or toxic effects.

Various aspects of the invention will be described in further detail in the following subsections.

anti-PD-1 antibodies

Antibodies of the invention are characterized by specific functional features or characteristics of the antibodies. For example, the antibody specifically binds to PD-1. Preferably, the antibodies of the invention are administered with high affinity, e.g.at 1X 10 ^-9 KD of M or less binds to PD-1. Standard assays for assessing the binding capacity of antibodies to PD-1 are well known in the art and include, for example, ELISA, western blots and RIA. The binding kinetics (e.g., binding affinity) of the antibodies can also be assessed by standard assays known in the art, such as by Biacore or Octet analysis. Assays suitable for assessing any of the above features are described in detail in the examples.

In another embodiment, the invention provides an isolated monoclonal antibody, or antigen binding portion thereof, having a CDR sequence homology of at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% for the heavy chain variable region and the light chain variable region. In certain embodiments of the methods of engineering antibodies of the invention, mutations may be randomly or selectively introduced into all or a portion of the anti-PD-1 antibody coding sequence, and the resulting modified anti-PD-1 antibodies may be screened for binding activity and/or other functional properties as described herein. Methods of mutagenesis have been described in the art. Methods for creating and screening antibody mutations by saturation mutagenesis, synthetic ligation assembly or combinations thereof are described, for example, in PCT publication WO02/09278 to Short.

In another embodiment of the invention, hybridoma cells are obtained by fusing spleen cells of immunized mice with a mouse myeloma cell line (SP 2/0-Ag 14) under the action of a polyethylene glycol (PEG 1450, roche) fusion agent, and the PD-1 antibodies capable of binding to PD-1 positive expression cells are selected by a high throughput transfection and screening system. The selected positive clone is subjected to subcloning selection by more than 3 times of limiting dilution method, so that the positive clone is ensured to be a positive clone with single source. Of these, particularly preferred 3 positive clones UM1-51, UM1-56 and UM1-69 were sequenced and the expressed antibody CDR region sequences are shown in the following table:

In another embodiment, the invention provides an isolated monoclonal antibody, or antigen-binding portion thereof, having a heavy chain variable region that hybridizes to a heavy chain variable region selected from the group consisting of SEQ ID NOs: 19. SEQ ID NO:23 or SEQ ID NO:27 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology; the light chain variable region thereof hybridizes to a sequence selected from the group consisting of SEQ ID NOs: 21. SEQ ID NO:25 or SEQ ID NO:29 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology. Antibodies having high (i.e., 90% or more) homology of the heavy chain variable region (VH) and the light chain variable region (VL) with the VH and VL regions of the above sequences are obtained by conservative sequence modifications, including amino acid substitutions, additions, deletions, and the like. The term "conservative sequence modification" is intended to mean that an amino acid modification does not significantly affect or alter the binding characteristics of an antibody comprising the amino acid sequence. Modification can be by standard techniques known in the art, such as site-directed mutagenesis and PCR-mediated mutagenesis of nucleic acid molecules encoding the variable region sequences. Conservative amino acid substitutions refer to the replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues with similar side chains have been described in detail in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues outside of the CDR regions of the antibodies of the invention can be replaced with other amino acid residues from the same side chain family and the altered antibodies tested for retained function using the functional assays described herein. Preferred site-directed mutagenesis or PCR-mediated mutagenesis sites are located outside the heavy chain variable region CDR1-CDR3 and the light chain variable region CDR1-CDR 3.

In another embodiment, the antibody fragment of the invention is a diabody.

In a preferred embodiment, the invention provides an isolated monoclonal antibody, the Heavy Chain (HC) of which hybridizes to a sequence selected from the group consisting of SEQ ID NOs: 34. SEQ ID NO:36 or SEQ ID NO:38 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology; its Light Chain (LC) hybridizes with a light chain sequence selected from SEQ ID NOs: 40. SEQ ID NO:42 or SEQ ID NO:44 has at least 91%,92%,93%,94%,95%,96%,97%,98%,99% or 100% sequence homology. Antibodies having high (i.e., 90% or greater) homology to the heavy and light chains of the above sequences can be obtained by mutagenizing (e.g., site-directed mutagenesis or PCR-mediated mutagenesis) nucleic acid molecules encoding the heavy and light chain amino acids, and then testing the encoded altered antibodies for retained function using the functional assays described herein. Preferred site-directed mutagenesis or PCR-mediated mutagenesis sites are located outside the heavy chain variable region CDR1-CDR3 and the light chain variable region CDR1-CDR 3.

In a particularly preferred embodiment, the invention provides an isolated monoclonal antibody comprising:

Preferably, wherein the antibody or antigen binding portion thereof specifically binds to human PD-1 or cynomolgus PD-1, more preferably specifically binds to human PD-1. The anti-PD-1 antibodies of the invention preferably exhibit one or more of the following characteristics:

(a) At 1X 10 ^-9 KD of M or less binds to human PD-1;

(b) Inhibit the binding of PD-L1 and/or PD-L2 to PD-1;

(c) Stimulating an antigen-specific memory response;

(d) Stimulating an antibody response;

(e) Inhibit tumor cell growth in vivo.

Preferably, the antibodies are present in a 1X 10 ratio ^-10 KD of M or less binds to human PD-1, more preferably at 1X 10 ^-11 KD of M or less binds to human PD-1. In another preferred embodiment of the present invention, the antibodies (hUM 1-30) are present in an amount of 3.34X 10 ^- ¹² M binds to human PD-1 as compared to the BMS company marketed antibody Opdivo at 2.58×10 in a parallel assay ^-11 M binds to human PD-1. It was shown that the affinity of antibody hUM1-30 for PD-1 is preferably 1 order of magnitude higher than that of Opdivo. Antibodies hUM1-30 better eliminated tumors in SPC lung cancer model murine experiments than the commercial Opdivo.

Antibodies of the invention may exhibit any combination of the above features, such as two, three, four, or five of the above features.

Nucleic acid molecules encoding antibodies of the invention

Another aspect of the invention relates to nucleic acid molecules encoding the antibodies of the invention. The nucleic acids of the invention may be, for example, DNA or RNA, and may or may not contain intronic sequences. In a preferred embodiment, the nucleic acid is a cDNA molecule.

Standard molecular biology techniques can be used to obtain the nucleic acids of the invention. For antibodies expressed from hybridomas, cDNAs encoding the light and heavy chains of the antibodies produced by the hybridomas can be obtained by standard PCR amplification or cDNA cloning techniques. For antibodies obtained from an immunoglobulin gene library (e.g., using phage display technology), nucleic acids encoding the antibodies can be recovered from the library.

Preferred nucleic acid molecules of the invention are those which encode the amino acid sequences of the CDR regions, variable regions or full length antibodies of the anti-PD-1 antibodies shown in the invention. After obtaining the DNA fragments encoding the VH and VL segments of the anti-PD-1 antibodies of the invention, these DNA fragments are further manipulated by standard recombinant DNA techniques, such as converting the variable region genes into full-length antibody chain genes, fab fragment genes, or scFv genes. In these manipulations, a DNA fragment encoding a VL or VH is operably linked to another DNA fragment encoding another protein, such as an antibody constant region or flexible linker. The term "operably linked" as used herein is intended to mean that two DNA fragments are linked such that the amino acid sequences encoded by the two DNA fragments remain in the same reading frame.

The isolated DNA encoding the VH region may be converted to a full length heavy chain gene by operably linking the DNA encoding the VH to another DNA molecule encoding the heavy chain constant regions (CH 1, CH2, and CH 3). The sequences of human heavy chain constant region genes are known in the art (see, e.g., kabat, E.A. et al (1991), sequences of Proteins of Immunological Interest, fifth Edition, U.S. device of Health and Human Services, NIH Publication No. 91-3242), and DNA fragments comprising these regions can be obtained by standard PCR amplification. The heavy chain constant region may be an IgG1, igG2, igG3, igG4, igA, igE, igM or IgD constant region, but is most preferably an IgG4 constant region. To obtain the Fab fragment heavy chain gene, the DNA encoding the VH may be operably linked to another DNA molecule encoding only the heavy chain CH1 constant region.

The isolated DNA encoding the VL region can be converted to a full length light chain gene (as well as a Fab light chain gene) by operably linking the DNA encoding the VL to another DNA molecule encoding the light chain constant region CL. The sequences of human light chain constant region genes are known in the art (see, e.g., kabat, E.A. et al (1991), sequences of Proteins of Immunological Interest, fifth Edition, U.S. device of Health and Human Services, NIH Publication No. 91-3242), and DNA fragments comprising these regions can be obtained by standard PCR amplification. The light chain constant region may be a kappa or lambda constant region, but is most preferably a kappa constant region.

To create the scFv gene, a DNA fragment encoding VH and VL is operably linked to another fragment encoding a flexible linker, e.g., encoding the amino acid sequence (Gly 4-Ser) 3, such that the VH and VL sequences may be expressed as adjacent single chain proteins, wherein the VL and VH regions are linked by a flexible linker (see, e.g., bird et al (1988) Science 242:423-426; huston et al (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; mcCafferty et al (1990) Nature 348:552-554).

Expression vector and host cell

The choice of the appropriate vector will depend primarily on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector. For expression of the antibody or antibody fragment thereof, DNA encoding part or the full length light and heavy chains may be obtained by standard molecular biology techniques (e.g., PCR amplification or using cDNA clones of hybridomas expressing the antibody of interest), and the DNA may be inserted into an expression vector, thereby operably linking the genes to transcriptional and translational regulatory sequences.

Expression vectors and expression control sequences appropriate for the expression host cell used are selected. The antibody light chain gene and the antibody heavy chain gene may be inserted into different vectors, or more generally, both genes may be inserted into the same expression vector. The antibody gene is inserted into the expression vector by standard methods. The light and heavy chain variable regions of the antibodies described herein can be used to create full length antibody genes of any antibody isotype by inserting them into expression vectors encoding the heavy and light chain constant regions of the desired isotype such that the VH segment is operably linked to the CH segment in the vector and the VK segment is operably linked to the CL segment in the vector. Alternatively, the recombinant expression vector may encode a signal peptide that facilitates secretion of the antibody chain in the host cell. The antibody chain gene may be cloned into a vector such that the signal peptide is linked in frame with the amino terminus of the antibody chain gene. The signal peptide may be an immunoglobulin signal peptide or a heterologous signal peptide (i.e., a signal peptide from a non-immunoglobulin protein).

In addition to the antibody chain genes, the recombinant expression vectors of the invention also carry regulatory sequences, such as promoters and/or enhancers derived from Cytomegalovirus (CMV), simian virus 40 (SV 40), adenoviruses (e.g., adenovirus major late promoter (AdMLP)), and polyomaviruses, which regulate expression of the antibody chain genes in host cells. The term "regulatory sequence" is intended to include promoters, enhancers and other expression regulatory elements (e.g., polyadenylation signals) that regulate the transcription or translation of an antibody chain gene. Such regulatory sequences are described, for example, in Goeddel, gene Expression technology, methods in Enzymology 185,Academic Press,San Diego,CA (1990).

To express the light and heavy chains, expression vectors encoding the heavy and light chains are transfected into host cells by standard techniques. The term "transfection" in various forms is intended to encompass a variety of techniques commonly used to introduce exogenous DNA into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection, and the like. Although it is theoretically possible to express the antibodies of the invention in either prokaryotic or eukaryotic host cells, it is most preferred to express the antibodies in eukaryotic cells (most preferably in mammalian host cells). Preferred mammalian host cells for expression of the recombinant antibodies of the invention include chinese hamster ovary cells (CHO cells), NSO myeloma cells, COS cells, SP2 cells and the like, with CHO cells being preferred.

When a recombinant expression vector encoding an antibody gene is introduced into a mammalian host cell, the antibody is produced by culturing the host cell for a period of time sufficient for expression of the antibody in the host cell, or more preferably, the antibody is secreted into the medium in which the host cell is cultured. Antibodies can be recovered from the culture broth of the culture using standard protein purification methods.

Pharmaceutical composition

The invention provides a pharmaceutical composition comprising the anti-PD-1 antibody and a pharmaceutically acceptable carrier.

In one aspect, the invention provides a pharmaceutical composition comprising one or a set of anti-PD-1 monoclonal antibodies, or antigen-binding portions thereof, of the invention, formulated with a pharmaceutically acceptable carrier. Pharmaceutically acceptable carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like. Preferably, the carrier is suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion).

Pharmaceutical compositions must generally be sterile and stable under the conditions of manufacture and storage. The composition can be prepared into solution, microemulsion, liposome or freeze-dried powder injection and other dosage forms. Preferred routes of administration of the pharmaceutical compositions of the invention include intravenous, intramuscular, intradermal, intraperitoneal, subcutaneous, spinal/spinal or other parenteral routes of administration, for example by injection or infusion.

The antibodies of the invention are administered in a dosage range of about 0.0001-100mg/kg, more typically 0.01-5mg/kg of host body weight. For example, the dosage may be 0.3mg/kg body weight, 1mg/kg body weight, 3mg/kg body weight, 5mg/kg body weight or 10mg/kg body weight or in the range of 1-10 mg/kg. Exemplary treatment regimens require once weekly, once every two weeks, once every three weeks, once every four weeks, once monthly, once every 3 months, or once every 3-6 months. For anti-PD-1 antibodies of the invention, preferred dosage regimens include intravenous administration of 1mg/kg body weight or 3mg/kg body weight, using one of the following dosage regimens: (i) Six doses are reached every four weeks, and then every three months; (ii) a monday dose; (iii) 3mg/kg body weight was administered once followed by 1mg/kg body weight every three weeks.

The actual dosage level of the active ingredient in the pharmaceutical compositions of the present invention may be varied to obtain an amount of active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition and mode of administration, but is non-toxic to the patient. A "therapeutically effective amount" of an anti-PD-1 antibody of the invention preferably results in a decrease in severity of disease symptoms, an increase in the frequency and duration of disease-free symptoms, or prevention of damage or disability caused by the disease. For example, for the treatment of a tumor, a "therapeutically effective amount" preferably inhibits cell growth or tumor growth by at least about 20%, more preferably by at least about 40%, even more preferably by at least about 60%, and still more preferably by at least about 80% relative to an untreated subject. The ability of a compound to inhibit tumor growth can be evaluated in an animal model system that can predict efficacy in human tumors. One of ordinary skill in the art will be able to determine such amounts based on factors such as the size of the subject's body, the severity of the subject's symptoms, and the particular composition or route of administration selected.

Use and method of the invention

The invention provides a method of treating a disease comprising administering to a subject in need of treatment a therapeutically effective amount of an antibody or antibody fragment of the invention. In yet another aspect, the invention provides a method of modulating an immune response in a subject comprising administering to the subject an antibody, or antigen-binding portion thereof, of the invention such that the immune response in the subject is modulated. Preferably, the antibodies of the invention enhance, stimulate or increase an immune response in a subject. The term "subject" includes both human and non-human animals. Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dogs, cats, cows, horses, chickens, amphibians, and reptiles. Mammals such as non-human primates, sheep, dogs, cats, cows and horses are preferred. More preferred subjects include human patients in need of an enhanced immune response.

The antibodies, antibody compositions and methods of the invention have a number of in vitro and in vivo uses, including, for example, detection of PD-1 or enhancement of immune responses by blocking PD-1. In a preferred embodiment, the antibody of the invention is a human antibody. For example, these molecules may be administered to cells cultured in vitro or ex vivo, or to a human subject, e.g., in vivo, to enhance immunity in a variety of circumstances.

Thus, in one aspect, the invention provides a method of modulating an immune response in a subject comprising administering to the subject an antibody or antigen binding portion thereof of the invention such that the immune response in the subject is modulated. Preferably, the immune response is enhanced, stimulated or upregulated.

In one aspect, the invention relates to treating a subject with an anti-PD-1 antibody such that growth of tumor cells in the subject is inhibited. anti-PD-1 antibodies can be used alone to inhibit the growth of cancerous tumors. Alternatively, anti-PD-1 antibodies may be used in combination with the other immunogenic agents, standard cancer treatments, or other antibodies. In one embodiment, the combination of therapeutic antibodies may be administered sequentially. For example, the anti-CTLA-4 antibody and anti-PD-1 antibody can be administered sequentially, such as administration of anti-CTLA-4 followed by administration of anti-PD-1, or administration of anti-PD-1 followed by administration of anti-CTLA-4.

Non-limiting examples of preferred cancers that can be treated using the antibodies of the invention include melanoma (e.g., metastatic malignant melanoma), renal cancer (e.g., clear cell carcinoma), prostate cancer (e.g., hormone-refractory prostate cancer), breast cancer, colon cancer, and lung cancer (e.g., non-small cell lung cancer). In addition, examples of other cancers that may be treated using the methods of the invention include bone cancer, pancreatic cancer, skin cancer, head or neck cancer, cutaneous or intraocular malignant melanoma, uterine cancer, ovarian cancer, rectal cancer, anal region cancer, gastrointestinal, testicular cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulval cancer, hodgkin's disease, non-hodgkin's lymphoma, esophageal cancer, small intestine cancer, cancer of the endocrine system, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urinary tract cancer, penile cancer, chronic or acute leukemia (including acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia, chronic lymphoblastic leukemia), childhood solid tumors, lymphocytic lymphoma, bladder cancer, renal or testicular cancer, renal pelvis cancer, neoplasms/tumors of the Central Nervous System (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis (spinal axis) tumors, brain stem glioma, kaposi's sarcoma, kaposi's sarcoma, cancer of the human tumor, cancer of the human epidermis (including those induced by the T-cell, and cancer of the environment, including those of the like, the lung cancer. The invention is also useful for the treatment of metastatic cancers, particularly those that express PD-L1 (Iwai et al, int. Immunol. 17:133-144).

Preferably, to enhance clinical efficacy, the anti-PD-1 antibodies of the invention may also be used in combination with a tenidine product for the treatment of cancer. The existing teniposide drugs have targets such as RAF/MEK, ALK, c-Met, JAK and the like, and can be combined with the anti-PD-1 antibody for cancer treatment, and the teniposide drugs comprise Gefitinib (Gefitinib), osimatinib (Ornitinib), icotinib (Ecotinib), afafitinib (Afafitinib), erlotinib (Erlotinib), crizotinib (Crizotinib), alectinib (Alatinib salt), ceritinib (Ceritinib), trametinib (Qu Moti), cobimetatinib (Conimatinib), axitinib (Alatinib), lenvatinib (Levalatinib), cabozantinib (Cartinib), sunitinib (Shutinib), bosutinib (Alatinib), ranatinib (Latifanib), dasatinib (Alatinib), alatinib (Torotinib), or the like. Preferred drugs of the tenidine class are ibrutinib, erlotinib, axitinib, cabotinib and trametinib.

In some embodiments, the invention provides methods of treating an infectious disease in a subject comprising administering to the subject an anti-PD-1 antibody, or antigen-binding portion thereof, such that the infectious disease in the subject is treated. Antibody-mediated PD-1 blocking may be used alone or as an adjuvant in combination with a vaccine to stimulate an immune response against pathogens, toxins and autoantigens. Examples of pathogens for which such treatment may be particularly useful include pathogens for which no effective vaccine is currently available, or pathogens for which conventional vaccines are not entirely effective. These include, but are not limited to, HIV, hepatitis a, hepatitis b, hepatitis c, influenza (Influenza), herpes (herps), giardiasis (Giardia), malaria (mailaria), leishmaniasis (Leishmania), infections caused by staphylococcus aureus (Staphylococcus aureus), and infections caused by pseudomonas aeruginosa (Pseudomonas Aeruginosa), among others.

The invention is further illustrated by the following examples, which should not be construed as further limiting. The contents of all figures and all references, patents and published patent applications cited throughout this application are hereby expressly incorporated by reference.

Examples

1. Production of anti-PD-1 monoclonal antibodies (murine)

1.1 immunization of mice

Female Balb/c mice of 8 weeks old were immunized subcutaneously with a mixed emulsion of hPD-1 extracellular domain fusion protein (ex abcam, cat No. ab 221398) and Freund's complete adjuvant (CFA, sigma), 80-100 μg protein per mouse, and 3 weeks later boosted with protein and incomplete adjuvant (IFA, sigma) emulsion for 3 total immunizations. The antibody titer was determined by taking serum about 2 weeks after each immunization of the mice, and the serum titer was determined by ELISA method using a microplate reader SpectraMax i 3. When the serum titers reached high enough (FIG. 1), 100. Mu.g of hPD extracellular domain fusion protein was dissolved in PBS and the spleen was removed 3 days later for fusion by intraperitoneal injection for booster immunization.

1.2 preparation and selection of hybridomas

Hybridoma cells were generated by fusing spleen cells of immunized mice with a mouse myeloma cell line (SP 2/0-Ag 14) under the action of polyethylene glycol (PEG 1450, SIGMA) fusion agent, suspending the fused cells in a selection medium containing HAT (Sigma Aldrich), adding the selection medium to a 96-well culture plate, culturing for about 11 days, and identifying culture supernatants by a SpectraMax i3 method by ELISA. The selected positive clone is subjected to subcloning selection by more than 3 times of limiting dilution method, so that the positive clone is ensured to be a positive clone with single source.

1.3 purification of anti-PD-1 mab (murine)

1.2 after the subclones were cultured with conventional hybridoma cells, the culture supernatants were captured by HiTrap Protein G HP (available from GE Healthcare, cat No. 29048581), eluted with 0.1M glycine (pH 3.0), the eluted peaks were collected, and desalted with HiTrap Desating (available from GE Healthcare, cat No. 29048684) column with 1 XPBS (pH 7.4) as a displacement buffer. Preserving at-20 deg.c for use.

2. Characterization of anti-PD-1 monoclonal antibody (murine) (blocking Activity)

Human lung cancer SPC-A1-PDL1 cell strain with high expression of PD-L1, alexa Fluor 488Microscale Protein Labeling Kit (purchased from Thermo under the trade name A30006) labeled hPD/Fc of human IgG1 and anti-PD-1 monoclonal antibody (murine) purified according to 1.3 are fully mixed, incubated for 20-30 minutes at 4 ℃, washed and then detected on a FACSVerse machine, and the result is shown in FIG. 2. FIG. 2 shows the blocking activity of murine PD-1 antibodies by flow cytometry, wherein the horizontal axis represents the antibody concentration and the vertical axis represents the blocking rate, UM1-45/UM1-47/UM1-51/UM1-56/UM1-63/UM1-69 representing different murine PD-1 monoclonal antibodies prepared by the inventors, and as a result, UM1-51, UM1-56 and UM1-69 were found to have a better blocking effect (FIG. 2).

3. Sequencing of anti-PD-1 antibodies (murine)

cDNA library preparation and procedures in sections such as gene identification and DNA sequencing in accordance with the hybridoma preparation technique (Kohler and Milstein, 1975) in the guidelines for molecular cloning experiments (3 rd edition) [ Molecular Cloning, J. Sambrook, D.W. Lassel, huang Peitang, et al ]. Total RNA was extracted from UM1-51, UM1-56 and UM1-69 hybridoma cells, and cDNA was synthesized and sequenced.

Total RNA was first extracted and purified from hybridoma cells using an RNA purification Kit (RAeasy Mini Kit, qiagen 74104,QIAshredder,Qiagen 79654). The RNA was then reverse transcribed into the first strand cDNA strand using a kit (SMARter RACE cDNA Amplification Kit, clontech) and following the company reagent protocol. PCR amplification was performed using the 5' RACE technique, using the universal primer UPM (universal primer) provided by the kit as the upstream primer and the gene specific primer GSP (gene specific primer) designed based on the mouse IgG1 heavy chain variable region and light chain kappa chain gene sequences as the downstream primer, and SMART first chain cDNA as the template. The PCR products were then ligated into T vector (Zero Blunt TOPO PCR Cloning Kit, invitrogen K2875-J10), respectively. Clones were selected for sequencing and analysis to obtain the light chain and heavy chain variable region sequences of the antibodies, primers were designed based on the heavy chain variable region sequences and the mouse IgG1 sequences, the full-length heavy chain sequences were obtained by PCR, and the sequences were analyzed using the IGBLAST analysis tool (KABAT) to determine the light and heavy chain CDR regions as shown in the following table.

Correspondingly, the sequences of the heavy chain variable region of the UM1-51 antibody (UM 1-51-mVH) are:

the DNA sequence encoding UM1-51-mVH is:

gaggtgaagctggtggagtctgggggaggcttagtgaagcctggagggtccctgaaattgtcttgtgcagcctctggattcactttcagtagttatggaatgtcttgggttcgccagactccggagaagaggctggagtgggtcgcaaccattagtggtggtggtagtgacatctactatccagacagtgtcagggggcgattcaccatctccagagacaatgccaagaacaacctgtacctgcaaatgagcagtctgaggtctgaggacacggccttatattactgtgcaagacaaaagggtacgacctggtttgcttactggggccaagggactctggtcactgtctctgaa(Seq ID No：20)

the light chain variable region sequences of UM1-51 antibodies (UM 1-51-mVK) are:

the DNA sequence encoding UM1-51-mVK is:

gacattgtgctgacccaatctccagcttctttggctgtgtctctaggacagagggccaccatctcctgcagagccagcgaaagtgttgataattctggcattagttttatgaactggttacaacagaaaccaggacagccacccaaactcctcatcgattacaccagcaggctgcacagcggggtccctgccagatttagtgccagtgggtctgggacagacttcagcctcaacatccatcctatggaggaagatgatattgcaatgtatttctgtcagcagggcaacaccctgccccccaccttcggtggaggcacaaagttggaaataaaa(Seq ID No：22)

the heavy chain variable region sequences of UM1-56 antibodies (UM 1-56-mVH) are:

the DNA sequence encoding UM1-56-mVH is:

gaggtgaagctggtggagtctgggggaggcttagtgaagcctggagggtccctaaaactctcctgtgcagcctctggattcactttcagtacctatggcatgtcttgggttcgccagactccggagaagaggctggagtgggtcgcaaccattagtggtggtggtcgttacacctactatccagacagtgtgaaggggcgattcaccatctccagagacaatgccaagaacaacctgtacctgcaaatgagcagtctgaggtctgaggacacggccttgtattactgtgcaagacaaaagggtacgacctggtttgctcactggggccaagggactctggtcactgtctctgca(Seq ID No：24)

the light chain variable region sequences of UM1-56 antibodies (UM 1-56-mVK) are:

the DNA sequence encoding UM1-56-mVK is:

gacattgtgctgacccaatctccagcttctttggctgtgtctctagggcagagggtcaccatctcctgcagagccagcgaaagtgttgatgataatggcattagttttatgaactggttccaacagaaaccaggacagccacccaaactcctcatcgatgctgcatccaaccaaggatccggggtccctgccaggtttagtggcagtgggtctgggacagacttcagcctcaacatccatcctatggaggaggatgatactgcaatgtatttctgtcagcaaagtaaggaggttccgtggacgttcggtggaggcaccaagctggaaataaaa(Seq ID No：26)

the heavy chain variable region sequences of UM1-69 antibodies (UM 1-59-mVH) are:

the DNA sequence encoding UM1-69-mVH is:

gaggtgaagctggtggagtctggtggaggcttagtgaagcctggagggtccctgaaactctcatgtgcagcctctggattcgctttcagtagctatggcgtgtcttgggttcgccagactccggagaagaggctggagtgggtcgcaaccattagtggtggtggtcgtgacacctactattcagacagtgtgaaggggcgattcaccatctccagagacaatgccaagagcaacctgtacctgcaaatgagcagtctgaggtctgaggacacggccttatattattgtgcaagacaaaagggtacgacctggtttgctgactggggccaagggactctggtcactgtctctgca(Seq ID No：28)

the light chain variable region sequences of UM1-69 antibodies (UM 1-69-mVK) are:

the DNA sequence encoding UM1-69-mVK is:

gacattgtgctgacccaatctccagcttctttggctgtgtctctagggcagagggccaccatctcctgcagggccagcgagagcgccgacagctacggcaacagcttcatgcactggttacaacagaaaccaggacagccacccaaactcctcatcgatagggccagcaacctggagagcggggtccctgccaggtttagtgccagtgggtctgggacagacttcagcctcaacatccatcctatggaggaggatgatactgcaatgtatttctgtcagcagagcaacgaggaccccctgaccttcggtggaggcaccaagctggagataaaa(Seq ID No：30)

4. humanization of anti-PD-1 antibodies (murine)

In order to make antibodies better applicable to clinical patient treatment, it is desirable to humanize the antibody sequences so that they retain high affinity for the antigen and other beneficial biological properties (e.g., reduce their immunogenicity in humans). To achieve this, according to a preferred method, humanized antibodies are prepared by analyzing the parent sequence and various conceptual humanized products using a three-dimensional model of the parent and humanized sequences. Three-dimensional immunoglobulin models are generally available and familiar to those skilled in the art. Almost all murine antibodies can be humanized by CDR grafting to maintain antigen binding. For relevant technical literature reference can be made to Sims et al, 1987, j.immunol.,151:2296; chothia et al, 1987, j.mol.biol.,196:901; presta et al, 1993, j.immnol, 151:2623; carter et al, 1992, proc.Natl. Acad.Sci.USA,89:4285; lo Benny k.c. et al, load Antibody Engineering: methods and Protocols (antibody engineering: methods and protocols), volume 248, humana Press, new Jersey,2004.

Based on the foregoing, humanized engineering of UM1-56 antibodies is preferred. Firstly, the heavy chain constant region of the antibody is changed into a human IgG4 constant region sequence, and meanwhile, the light chain constant region of the antibody is changed into a human kappa chain constant region, so that a female parent antibody (Chimeric Ab) Chimeric with human and mice is obtained. After confirming the functional activity of the parent antibody, the heavy chain variable region and the light chain variable region sequences are subjected to humanized modification, and the key amino acids of the FR region are subjected to back mutation on the basis of CDR transplantation. A series of IgG mutants were constructed by performing a facultative synthesis of the amino acids between FRs that did not determine whether or not to affect antigen and antibody binding. After screening based on antibody affinity and expression levels, a total of 3 heavy chain variants (heavy chains UM1-56-H1, UM1-56-H2 and UM 1-56-H3) and 3 light chain variant sequences (light chains UM1-56K-2, UM1-56K-6 and UM 1-56K-8) were obtained. Cloning 1 female parent and 6 variant sequences into pcDNA3.1 expression vectors using conventional molecular cloning techniques using appropriate cleavage sites, respectively, the 5' end of the light chain or heavy chain sequence carrying the Kozak sequence and the human IL-2 signal peptide: MYRMQLLSCIALSLALVTNS (Seq ID No: 31) whose corresponding nucleotide sequence is: atgtacaggatgcaactcctgtcttgcattgcactaagtcttgcacttgtcacgaattcg (Seq ID No: 32). The light chain and heavy chain expression vectors are combined two by two, 9 light chain and heavy chain combinations are adopted, the light chain and heavy chain expression vectors of the 9 combinations are respectively and transiently transfected with an ExpiCHO-S (Invitrogen) cell to obtain 9 humanized antibodies, 4 humanized antibodies are preferably selected from the purified antibodies after ELISA screening, hUM1-30 (heavy chain sequence Seq ID No:34 and light chain sequence Seq ID No: 40) are further preferably selected from the humanized antibodies according to the method in the second embodiment by a flow cytometry method (FIG. 7). The DNA sequences and amino acid sequences of the 3 heavy chain variants and 3 light chain variants after optimization are as follows:

1. Heavy chain 1 (UM 1-56H-1)

(1) Heavy chain UM1-56H-1DNA sequence:

gaggtgcagttggtggagagcgggggggggctggtgcagcctggaggaagtttgaggttgagctgtgccgcaagcgggttcacatttagcacatatggaatgagctgggtgaggcaggcacccggaaagggattggagtgggtgagtacaatctccggcggaggaaggtacacatactaccccgatagtgtgaagggccggttcacaatctccagggacaacagcaagaacaccttgtacctgcagatgaacagcctgagggcagaagacaccgctgtgtactactgcgccaggcagaaggggacaacctggtttgctcactggggccagggaaccctggtgaccgtgagctccgctagcaccaagggcccatccgtcttccccctggcgccctgctccaggagcacctccgagagcacagccgccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacgaagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagagagttgagtccaaatatggtcccccatgcccaccatgcccagcacctgagttcctggggggaccatcagtcttcctgttccccccaaaacccaaggacactctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccaggaagaccccgaggtccagttcaactggtacgtggatggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagttcaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccgtcctccatcgagaaaaccatctccaaagccaaagggcagccccgagagccacaggtgtacaccctgcccccatcccaggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaggctaaccgtggacaagagcaggtggcaggaggggaatgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacacagaagagcctctccctgtctctgggtaaa(Seq ID No：33)

(2) Heavy chain UM1-56H-1 protein sequence:

EVQLVESGGGLVQPGGSLRLSCAASGFTFSTYGMSWVRQAPGKGLEWVSTISGGGRYTYYPDSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCARQKGTTWFAHWGQGTLVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLGK(Seq ID No：34)

2. heavy chain 2 (UM 1-56H-2)

(3) Heavy chain UM1-56H-2DNA sequence:

gaggtgaagttggtggagagcgggggggggctggtgcagcctggaggaagtttgaggttgagctgtgccgcaagcgggttcacatttagcacatatggaatgagctgggtgaggcaggcacccggaaagggattggagtgggtgagtacaatctccggcggaggaaggtacacatactaccccgatagtgtgaagggccggttcacaatctccagggacaacagcaagaacaccttgtacctgcagatgaacagcctgagggcagaagacaccgctgtgtactactgcgccaggcagaaggggacaacctggtttgctcactggggccagggaaccctggtgaccgtgagctccgctagcaccaagggcccatccgtcttccccctggcgccctgctccaggagcacctccgagagcacagccgccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacgaagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagagagttgagtccaaatatggtcccccatgcccaccatgcccagcacctgagttcctggggggaccatcagtcttcctgttccccccaaaacccaaggacactctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccaggaagaccccgaggtccagttcaactggtacgtggatggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagttcaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccgtcctccatcgagaaaaccatctccaaagccaaagggcagccccgagagccacaggtgtacaccctgcccccatcccaggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaggctaaccgtggacaagagcaggtggcaggaggggaatgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacacagaagagcctctccctgtctctgggtaaa(Seq ID No：35)

(4) Heavy chain UM1-56H-2 protein sequence:

EVKLVESGGGLVQPGGSLRLSCAASGFTFSTYGMSWVRQAPGKGLEWVSTISGGGRYTYYPDSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCARQKGTTWFAHWGQGTLVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLGK(Seq ID No：36)

3. heavy chain 3 (UM 1-56-H3)

(5) Heavy chain UM1-56-H3DNA sequence:

gaggtgcagttggtggagagcgggggggggctggtgcagcctggaggaagtttgaggttgagctgtgccgcaagcgggttcacatttagcacatatggaatgagctgggtgaggcaggcacccggaaagggattggagtgggtgagtacaatctctggcggaggaaggtacacatactacgccgatagtgtgaagggccggttcacaatctccagggacaacagcaagaacaccttgtacctgcagatgaacagcctgagggcagaagacaccgctgtgtactactgcgccaggcagaaggggacaacctggtttgctcactggggccagggaaccctggtgaccgtgagctccgctagcaccaagggcccatccgtcttccccctggcgccctgctccaggagcacctccgagagcacagccgccctgggctgcctggtcaaggactacttccccgaaccggtgacggtgtcgtggaactcaggcgccctgaccagcggcgtgcacaccttcccggctgtcctacagtcctcaggactctactccctcagcagcgtggtgaccgtgccctccagcagcttgggcacgaagacctacacctgcaacgtagatcacaagcccagcaacaccaaggtggacaagagagttgagtccaaatatggtcccccatgcccaccatgcccagcacctgagttcctggggggaccatcagtcttcctgttccccccaaaacccaaggacactctcatgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccaggaagaccccgaggtccagttcaactggtacgtggatggcgtggaggtgcataatgccaagacaaagccgcgggaggagcagttcaacagcacgtaccgtgtggtcagcgtcctcaccgtcctgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccgtcctccatcgagaaaaccatctccaaagccaaagggcagccccgagagccacaggtgtacaccctgcccccatcccaggaggagatgaccaagaaccaggtcagcctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaagaccacgcctcccgtgctggactccgacggctccttcttcctctacagcaggctaaccgtggacaagagcaggtggcaggaggggaatgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacacagaagagcctctccctgtctctgggtaaa(Seq ID No：37)

(6) Heavy chain UM1-56-H3 protein sequence:

EVQLVESGGGLVQPGGSLRLSCAASGFTFSTYGMSWVRQAPGKGLEWVSTISGGGRYTYYADSVKGRFTISRDNSKNTLYLQMNSLRAEDTAVYYCARQKGTTWFAHWGQGTLVTVSSASTKGPSVFPLAPCSRSTSESTAALGCLVKDYFPEPVTVSWNSGALTSGVHTFPAVLQSSGLYSLSSVVTVPSSSLGTKTYTCNVDHKPSNTKVDKRVESKYGPPCPPCPAPEFLGGPSVFLFPPKPKDTLMISRTPEVTCVVVDVSQEDPEVQFNWYVDGVEVHNAKTKPREEQFNSTYRVVSVLTVLHQDWLNGKEYKCKVSNKGLPSSIEKTISKAKGQPREPQVYTLPPSQEEMTKNQVSLTCLVKGFYPSDIAVEWESNGQPENNYKTTPPVLDSDGSFFLYSRLTVDKSRWQEGNVFSCSVMHEALHNHYTQKSLSLSLGK(Seq ID No：38)

4. light chain 1 (UM 1-56K-2)

(1) Light chain UM1-56K-2DNA sequence:

gacattcagatgacccagagcccctcctccctctccgcctccgtgggagacagagttaccatcacctgcagggcctccgaatccgtggacgacaacggaatctccttcatgaactggtttcagcagaaacccggcaaggcccccaagctgctcatctacgctgcaagcaaccagggctccggcgtcccctcccgtttttccggctccgggtccggcaccgacttcaccctgaccatctcctccctgcagcccgaggacttcgccacctactactgccagcagtccaaggaggtcccctggaccttcggccagggcaccaaggtggagatcaagcgtacggtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaagacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgt(Seq ID No：39)

(2) Light chain UM1-56K-2 protein sequence:

DIQMTQSPSSLSASVGDRVTITCRASESVDDNGISFMNWFQQKPGKAPKLLIYAASNQGSGVPSRFSGSGSGTDFTLTISSLQPEDFATYYCQQSKEVPWTFGQGTKVEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC(Seq ID No：40)

5. light chain 2 (UM 1-56K-6)

(3) Light chain UM1-56K-6DNA sequence:

gacattcagatgacccagagcccctcctccctctccgcctccgtgggagacagagttaccatcacctgcagggcctccgaatccgtggacgacaacggaatctccttcatgaactggtttcagcagaaacccggcaaggcccccaagctgctcatctacgctgcaagcaaccagggctccggcgtcccctcccgtttttccggctccgggtccggcaccgacttcaccctgaccatctcctccctgcagcccgaggacttcgccacctacttctgccagcagtccaaggaggtcccctggaccttcggccagggcaccaaggtggagatcaagcgtacggtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaagacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgt(Seq ID No：41)

(4) Light chain UM1-56K-6 protein sequence:

DIQMTQSPSSLSASVGDRVTITCRASESVDDNGISFMNWFQQKPGKAPKLLIYAASNQGSGVPSRFSGSGSGTDFTLTISSLQPEDFATYFCQQSKEVPWTFGQGTKVEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC(Seq ID No：42)

6. light chain 3 (UM 1-56K-8)

(5) Light chain UM1-56K-8DNA sequence

gacattcagatgacccagagcccctcctccctctccgcctccgtgggagacagagttaccatcacctgcagggcctccgaatccgtggacgacaacggaatctccttcatgaactggtttcagcagaaacccggcaaggcccccaagctgctcatcaacgctgcaagcaaccagggctccggcgtcccctcccgtttttccggctccgggtccggcaccgacttcaccctgaccatctcctccctgcagcccgaggacttcgccacctacttctgccagcagtccaaggaggtcccctggaccttcggccagggcaccaaggtggagatcaagcgtacggtggctgcaccatctgtcttcatcttcccgccatctgatgagcagttgaaatctggaactgcctctgttgtgtgcctgctgaataacttctatcccagagaggccaaagtacagtggaaggtggataacgccctccaatcgggtaactcccaggagagtgtcacagagcaagacagcaaggacagcacctacagcctcagcagcaccctgacgctgagcaaagcagactacgagaaacacaaagtctacgcctgcgaagtcacccatcagggcctgagctcgcccgtcacaaagagcttcaacaggggagagtgt(Seq ID No：43)

(6) Light chain UM1-56K-8 protein sequence:

DIQMTQSPSSLSASVGDRVTITCRASESVDDNGISFMNWFQQKPGKAPKLLINAASNQGSGVPSRFSGSGSGTDFTLTISSLQPEDFATYFCQQSKEVPWTFGQGTKVEIKRTVAAPSVFIFPPSDEQLKSGTASVVCLLNNFYPREAKVQWKVDNALQSGNSQESVTEQDSKDSTYSLSSTLTLSKADYEKHKVYACEVTHQGLSSPVTKSFNRGEC(Seq ID No：44)

5. characteristics and functions of humanized antibodies

5.1 expression and purification of humanized antibodies

Example IV pcDNA3.1 plasmids containing the DNA sequences of the antibody light chain (Seq ID No: 39) and heavy chain (Seq ID No: 33) were prepared, transformed into E.coli DH 5. Alpha. And, after sequencing, the glycerol bacteria were maintained at-80 degrees. Streaking a glycerol bacterial plate, culturing overnight, picking single colonies, inoculating to 3mL of LB medium containing 100 mug/mL of ampicillin, culturing overnight, inoculating again to 150mL of LB liquid medium (adding 100 mug/mL of ampicillin), and culturing overnight at 37 ℃; the heavy and light chain plasmids of the antibody are respectively extracted by using a large extraction kit of the plasmid without endotoxin of the radix angelicae pubescentis (the detailed operation process is shown in the specification), and the plasmid concentration is measured and then stored at-20 ℃ for transfection.

ExpiCHO-S cells were seeded with 30mL ExpiCHO expression medium (0.5% anti-labeling Agent) at 37 ℃,135rpm,8% CO ₂ Culturing under conditions to obtain a cell density of 4-6X10 ⁶ At 5X10 per mL ⁵ Individual cells/mL inoculation density passaging; after 2 to 3 serial passages, a fraction of the passaged cells may be counted by trypan blue staining for transfection. Transient transfection kit with ExpiFectamine CHO Transfection Kit; take 1.5X10 ⁸ The individual cells were centrifuged, the supernatant was discarded, and 25.5mL of fresh ExpiCHO expression medium resuspended cells were added; 20 μg of antibody plasmid (light chain plasmid 10 μg, heavy chain plasmid 10 μg) was dissolved in 1mL of precooled OptiPRO SFM serum-free medium and gently mixed; taking 80 mu L of transfection reagent, adding 920 mu L of precooled OptiPRO SFM serum-free culture medium, and gently mixing; mixing the transfection reagent solution with the plasmid solution, standing at room temperature for 1-5min, and adding into the ExpiCHO-S cell culture solution; using Standard culture mode, 18-22h after transfection, 150. Mu.L of Enhancer and 6mL of Feed were added; harvesting the cells when the cell viability is reduced to 75%; the cell culture supernatant obtained after centrifugation was filtered through a 0.22 μm filter and applied to an AKTAavant, followed by passing the cell culture supernatant through a ProA cartridge (GE Hitrap ProteinA HP ml). Separation conditions: after loading, the column was washed with PBS buffer, eluted with 0.1M glycine (pH 3.5) and regenerated with 0.1M glycine (pH 2.0) (FIG. 3).

Purified protein hUM1-30 (about 2 ml) was drawn into an ultrafiltration centrifuge tube with a molecular weight cut-off of 30kD, added with about 15ml PBS buffer, centrifuged 5min x 2 times at 4000 Xg and 10min x 3 times at 4000 Xg. The collected proteins were aspirated with a 2ml syringe, filtered at 0.22 μm, and stored at-80C. According to the DNA sequencing and the protein N-terminal sequencing results, the obtained light chain amino acid sequence of the antibody hUM1-30 is purified, such as Seq ID No:40, as shown in Seq ID No: shown at 34.

5.2 SDS-PAGE detection of molecular weight of antibodies

1. Preparing 6% or 12% separating gel and 5% concentrating gel;

2. sample treatment: taking 6ul of samples, respectively adding 1.5ul of 5-reduction loading buffer and 1.5ul of 5-non-reduction loading buffer, and carrying out metal bath boiling at 95 ℃ for 3min;

3. loading: 5ul of the treated sample was added to each well. The gel was run at 60V, and the gel was run at 120V until the sample was separated. Coomassie brilliant blue staining for 40min. Decolorizing with decolorizing solution until the band is clear, and photographing and storing with gel imager.

FIG. 4-1 shows that the band under the reducing condition of hUM1-30 is about 50KD for the heavy chain and about 25KD for the light chain, and no other miscellaneous bands exist. FIG. 4-2 shows that the molecular weight of the main band is about 150kD under non-reducing conditions.

5.3 Purity of UPLC-SEC detection antibody

A100 mM sodium phosphate buffer solution was prepared to adjust the pH to 6.80, equilibrated chromatography column (Waters, BEH SEC 200.6X150 mM) to a pressure fluctuation of <10psi, and then the flow was adjusted to 0.4mL/min. Samples were filtered through 0.22um filters and applied to corresponding sample tray locations, at least 20uL per sample. After baseline stabilization, 100mM sodium phosphate of the corresponding instrument was selected, the sample volume was 2uL, the time was 7min, and the operation was clicked. After the sample injection is finished, the chromatographic column is flushed at a low flow rate (less than 0.2 mL/min) for at least 10 column volumes, and the chromatographic column is stored in a 20% methanol solution.

hUM1-30 antibody purification as shown in FIG. 5, the main peak was 96.70%.

5.4 Octet assay affinity

Preparing the antibody to be detected into 6 concentrations of 50nM sesquidilution, and simultaneously setting a Buffer blank hole and a 50nM antigen (Human PD1/PDCD1 Protein Biotinylated, sinobiological, cat.No. 10377-H03H-B) blank hole; immobilizing 5ug/ml antigen on the SA sensor, the immobilization height being about 0.6nm; according to a set program; (Baseline: 120s;Loading:60s;Baseline:120s;Association:300s;Dissoc iation:1800s) the affinity of the antibodies to be tested was determined on an Octet Red96 instrument (Fortebio). Affinity data were calculated using the Octet Red96 suite software fit (fig. 6).

Antibodies to	KD(M)	Kon(1/Ms)	Kdis(1/s)	Full R ²
					Opdivo	2.58E-11	1.56E+06	4.02E-05	0.9965
hUM1-30	3.34E-12	1.63E+06	5.43E-06	0.9974

hUM1-30 has an affinity of 3.34E-12M, an affinity of 2.58E-11M for Opdivo, a dissociation coefficient of 5.43E-06 (1/s) for hUM1-30, and a dissociation coefficient of 4.02E-05 (1/s). hUM1-30 was shown to have a lower dissociation rate, with an affinity 1 order of magnitude higher than Opdivo.

5.5 flow assay to determine blocking Activity

Human lung cancer cell strain SPC-A1-PDL1 expressing PD-L1 is cultivated by adherence to proper cell density, the culture medium is sucked and removed, PBS is used for washing twice, 0.2-0.5ml of 0.25% pancreatin-EDTA is added for digestion for 1-2min in a cell culture box, the non-digestion time is too long, the digestion is stopped by RPMI-1640 (10% FBS), and 1-5 x 10 times 5 cells are counted per tube. Centrifuge 2000rpm centrifugation, 3 min, pipetting off the upper medium, adding appropriate amount of 1 x pbs to resuspend cells, centrifugation at 2000rpm again, 3 min, and repeating 2 times. Adding a mixture of the antibodies to be tested and fluorescent-labeled PD1 (Dimeric) at different concentrations; setting up a homotype control and a positive control, adding 100ng of hPD-1/hFc-FITC and different concentrations of to-be-detected anti-PD-1 antibodies (0 ng, 50ng, 100ng, 200ng, 400ng, 800ng, 1600ng and 3200 ng) into each tube, uniformly mixing, and placing the same in one tube at 4 degrees for 20-30 Min. The cells were washed 1 to 3 times with 1 x pbs, adjusted in concentration with an appropriate amount of 1 x pbs, and checked on the machine (results are shown in fig. 7). The data shows that with increasing antibody concentration, PD-1 binding to PD-L1 is blocked more and that addition of hUM-30 to 1.6ug can block PD-1 binding to PDL 1.

5.6 detection of tumor-eliminating Effect in Lung cancer model mice

Human lung cancer cell strain SPC-A1-PDL1 with high expression of PD-L1 is cultured in RPMI1640 medium containing 10% FBS for about 2-3 days to obtain proper cell number, and healthy adult PBMC is extracted by density gradient centrifugation, washed and counted for later use. SPC-A1-PDL1 cells were digested and mixed with PBMC in appropriate proportions using 4-5 week old female immunodeficiency NCG mice (purchased from Nanj university-Nanj biomedical research institute, IVC rack fed by independent water and air supply systems) and inoculated on the mice at an inoculation density of 3x10≡7cells/ml, with each mouse inoculated 1 under the right flank. The tumor is formed 3-5 days after inoculation, the tumor body can reach 100-250mm3 7-9 days, the weight and the tumor body volume of the mice are measured when the mice are put into groups, the mice with the tumor body smaller than 80mm3 or larger than 250mm3 or other abnormal state mice are removed, and then the mice meeting the requirements are distributed into different experimental groups according to a random distribution method.

After the group, according to the group, the experimental antibody (hUM 1-30), the positive control antibody (Opdivo) and the negative control antibody (human IgG4, denoted hIgG 4) were administered, the antibody concentration was 1mg/ml, the intraperitoneal injection was performed, the initial dose was increased, the initial dose of PD1 antibody was 250 ug/only, and then 200 ug/only/times was administered 1 time every 3 days until 6 times, i.e., q3dx6 times; tumor volume was measured before each dose, 2-3 times per week, typically before dose.

After 6 antibody treatments, as shown in fig. 8, the tumor volume increase was significantly inhibited in the hUM1-30 groups compared to the Opdivo, hig 4 groups. From 2 to 6 administrations, hUM1-30 had significantly better ability to inhibit tumor proliferation than Opdivo. From the survival curves, as shown in fig. 9, the hUM1-30 groups had better survival. In particular, as shown in fig. 10, 11 and 12, the tumor bodies of the hUM groups 1-30 mice are obviously inhibited and even disappear quickly. Whereas Opdivo was significantly inhibited in only 1 mouse tumor, 1 mouse tumor proliferated rather faster after administration, even faster than negative control hIgG4 group, and developed a hyperprogression. Both the hUM1-30 antibody and the Opdivo antibody extended the survival of the model mice (fig. 9), but the extension time was different, hUM-30 was superior to Opdivo.

In comparison, hUM1-30 eliminated tumors better than the commercial Opdivo in SPC lung cancer model mice.

/>

Sequence listing

<110> Fuzhou Innovative pharmaceutical science and technology Co., ltd

<120> a PD-1 targeting monoclonal antibody and use thereof

<150> 201910582195.8

<151> 2019-06-30

<160> 44

<170> SIPOSequenceListing 1.0

<210> 1

<211> 5

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Ser Tyr Gly Met Ser

1 5

<210> 2

<211> 20

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Thr Ile Ser Gly Gly Gly Ser Asp Ile Tyr Tyr Pro Asp Ser Val Arg

1 5 10 15

Gly Arg Phe Thr

20

<210> 3

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Gln Lys Gly Thr Thr Trp Phe Ala Tyr

1 5

<210> 4

<211> 15

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Arg Ala Ser Glu Ser Val Asp Asn Ser Gly Ile Ser Phe Met Asn

1 5 10 15

<210> 5

<211> 7

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 5

Tyr Thr Ser Arg Leu His Ser

1 5

<210> 6

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 6

Gln Gln Gly Asn Thr Leu Pro Pro Thr

1 5

<210> 7

<211> 5

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 7

Thr Tyr Gly Met Ser

1 5

<210> 8

<211> 20

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 8

Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Pro Asp Ser Val Lys

1 5 10 15

Gly Arg Phe Thr

20

<210> 9

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 9

Gln Lys Gly Thr Thr Trp Phe Ala His

1 5

<210> 10

<211> 15

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 10

Arg Ala Ser Glu Ser Val Asp Asp Asn Gly Ile Ser Phe Met Asn

1 5 10 15

<210> 11

<211> 7

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 11

Ala Ala Ser Asn Gln Gly Ser

1 5

<210> 12

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 12

Gln Gln Ser Lys Glu Val Pro Trp Thr

1 5

<210> 13

<211> 5

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 13

Ser Tyr Gly Val Ser

1 5

<210> 14

<211> 20

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 14

Thr Ile Ser Gly Gly Gly Arg Asp Thr Tyr Tyr Ser Asp Ser Val Lys

1 5 10 15

Gly Arg Phe Thr

20

<210> 15

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 15

Gln Lys Gly Thr Thr Trp Phe Ala Asp

1 5

<210> 16

<211> 15

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 16

Arg Ala Ser Glu Ser Ala Asp Ser Tyr Gly Asn Ser Phe Met His

1 5 10 15

<210> 17

<211> 7

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 17

Arg Ala Ser Asn Leu Glu Ser

1 5

<210> 18

<211> 9

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 18

Gln Gln Ser Asn Glu Asp Pro Leu Thr

1 5

<210> 19

<211> 118

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 19

Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Gly Gly Gly Ser Asp Ile Tyr Tyr Pro Asp Ser Val

50 55 60

Arg Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala Tyr Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Glu

115

<210> 20

<211> 354

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 20

gaggtgaagc tggtggagtc tgggggaggc ttagtgaagc ctggagggtc cctgaaattg 60

tcttgtgcag cctctggatt cactttcagt agttatggaa tgtcttgggt tcgccagact 120

ccggagaaga ggctggagtg ggtcgcaacc attagtggtg gtggtagtga catctactat 180

ccagacagtg tcagggggcg attcaccatc tccagagaca atgccaagaa caacctgtac 240

ctgcaaatga gcagtctgag gtctgaggac acggccttat attactgtgc aagacaaaag 300

ggtacgacct ggtttgctta ctggggccaa gggactctgg tcactgtctc tgaa 354

<210> 21

<211> 111

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 21

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asn Ser

20 25 30

Gly Ile Ser Phe Met Asn Trp Leu Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Asp Tyr Thr Ser Arg Leu His Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Glu Asp Asp Ile Ala Met Tyr Phe Cys Gln Gln Gly Asn

85 90 95

Thr Leu Pro Pro Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 22

<211> 333

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 22

gacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctaggaca gagggccacc 60

atctcctgca gagccagcga aagtgttgat aattctggca ttagttttat gaactggtta 120

caacagaaac caggacagcc acccaaactc ctcatcgatt acaccagcag gctgcacagc 180

ggggtccctg ccagatttag tgccagtggg tctgggacag acttcagcct caacatccat 240

cctatggagg aagatgatat tgcaatgtat ttctgtcagc agggcaacac cctgcccccc 300

accttcggtg gaggcacaaa gttggaaata aaa 333

<210> 23

<211> 118

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 23

Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Asn Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala His Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ala

115

<210> 24

<211> 354

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 24

gaggtgaagc tggtggagtc tgggggaggc ttagtgaagc ctggagggtc cctaaaactc 60

tcctgtgcag cctctggatt cactttcagt acctatggca tgtcttgggt tcgccagact 120

ccggagaaga ggctggagtg ggtcgcaacc attagtggtg gtggtcgtta cacctactat 180

ccagacagtg tgaaggggcg attcaccatc tccagagaca atgccaagaa caacctgtac 240

ctgcaaatga gcagtctgag gtctgaggac acggccttgt attactgtgc aagacaaaag 300

ggtacgacct ggtttgctca ctggggccaa gggactctgg tcactgtctc tgca 354

<210> 25

<211> 111

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 25

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Val Thr Ile Ser Cys Arg Ala Ser Glu Ser Val Asp Asp Asn

20 25 30

Gly Ile Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Asp Ala Ala Ser Asn Gln Gly Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Glu Asp Asp Thr Ala Met Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 26

<211> 333

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 26

gacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggtcacc 60

atctcctgca gagccagcga aagtgttgat gataatggca ttagttttat gaactggttc 120

caacagaaac caggacagcc acccaaactc ctcatcgatg ctgcatccaa ccaaggatcc 180

ggggtccctg ccaggtttag tggcagtggg tctgggacag acttcagcct caacatccat 240

cctatggagg aggatgatac tgcaatgtat ttctgtcagc aaagtaagga ggttccgtgg 300

acgttcggtg gaggcaccaa gctggaaata aaa 333

<210> 27

<211> 118

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 27

Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Lys Pro Gly Gly

1 5 10 15

Ser Leu Lys Leu Ser Cys Ala Ala Ser Gly Phe Ala Phe Ser Ser Tyr

20 25 30

Gly Val Ser Trp Val Arg Gln Thr Pro Glu Lys Arg Leu Glu Trp Val

35 40 45

Ala Thr Ile Ser Gly Gly Gly Arg Asp Thr Tyr Tyr Ser Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Ser Asn Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ser Glu Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala Asp Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ala

115

<210> 28

<211> 354

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 28

gaggtgaagc tggtggagtc tggtggaggc ttagtgaagc ctggagggtc cctgaaactc 60

tcatgtgcag cctctggatt cgctttcagt agctatggcg tgtcttgggt tcgccagact 120

ccggagaaga ggctggagtg ggtcgcaacc attagtggtg gtggtcgtga cacctactat 180

tcagacagtg tgaaggggcg attcaccatc tccagagaca atgccaagag caacctgtac 240

ctgcaaatga gcagtctgag gtctgaggac acggccttat attattgtgc aagacaaaag 300

ggtacgacct ggtttgctga ctggggccaa gggactctgg tcactgtctc tgca 354

<210> 29

<211> 111

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 29

Asp Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala Val Ser Leu Gly

1 5 10 15

Gln Arg Ala Thr Ile Ser Cys Arg Ala Ser Glu Ser Ala Asp Ser Tyr

20 25 30

Gly Asn Ser Phe Met His Trp Leu Gln Gln Lys Pro Gly Gln Pro Pro

35 40 45

Lys Leu Leu Ile Asp Arg Ala Ser Asn Leu Glu Ser Gly Val Pro Ala

50 55 60

Arg Phe Ser Ala Ser Gly Ser Gly Thr Asp Phe Ser Leu Asn Ile His

65 70 75 80

Pro Met Glu Glu Asp Asp Thr Ala Met Tyr Phe Cys Gln Gln Ser Asn

85 90 95

Glu Asp Pro Leu Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys

100 105 110

<210> 30

<211> 333

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 30

gacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 60

atctcctgca gggccagcga gagcgccgac agctacggca acagcttcat gcactggtta 120

caacagaaac caggacagcc acccaaactc ctcatcgata gggccagcaa cctggagagc 180

ggggtccctg ccaggtttag tgccagtggg tctgggacag acttcagcct caacatccat 240

cctatggagg aggatgatac tgcaatgtat ttctgtcagc agagcaacga ggaccccctg 300

accttcggtg gaggcaccaa gctggagata aaa 333

<210> 31

<211> 20

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 31

Met Tyr Arg Met Gln Leu Leu Ser Cys Ile Ala Leu Ser Leu Ala Leu

1 5 10 15

Val Thr Asn Ser

20

<210> 32

<211> 60

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 32

atgtacagga tgcaactcct gtcttgcatt gcactaagtc ttgcacttgt cacgaattcg 60

<210> 33

<211> 1335

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 33

gaggtgcagt tggtggagag cggggggggg ctggtgcagc ctggaggaag tttgaggttg 60

agctgtgccg caagcgggtt cacatttagc acatatggaa tgagctgggt gaggcaggca 120

cccggaaagg gattggagtg ggtgagtaca atctccggcg gaggaaggta cacatactac 180

cccgatagtg tgaagggccg gttcacaatc tccagggaca acagcaagaa caccttgtac 240

ctgcagatga acagcctgag ggcagaagac accgctgtgt actactgcgc caggcagaag 300

gggacaacct ggtttgctca ctggggccag ggaaccctgg tgaccgtgag ctccgctagc 360

accaagggcc catccgtctt ccccctggcg ccctgctcca ggagcacctc cgagagcaca 420

gccgccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 480

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 540

tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcacgaa gacctacacc 600

tgcaacgtag atcacaagcc cagcaacacc aaggtggaca agagagttga gtccaaatat 660

ggtcccccat gcccaccatg cccagcacct gagttcctgg ggggaccatc agtcttcctg 720

ttccccccaa aacccaagga cactctcatg atctcccgga cccctgaggt cacgtgcgtg 780

gtggtggacg tgagccagga agaccccgag gtccagttca actggtacgt ggatggcgtg 840

gaggtgcata atgccaagac aaagccgcgg gaggagcagt tcaacagcac gtaccgtgtg 900

gtcagcgtcc tcaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960

gtctccaaca aaggcctccc gtcctccatc gagaaaacca tctccaaagc caaagggcag 1020

ccccgagagc cacaggtgta caccctgccc ccatcccagg aggagatgac caagaaccag 1080

gtcagcctga cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag 1140

agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 1200

tccttcttcc tctacagcag gctaaccgtg gacaagagca ggtggcagga ggggaatgtc 1260

ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc 1320

ctgtctctgg gtaaa 1335

<210> 34

<211> 445

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 34

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala His Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro

115 120 125

Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly

130 135 140

Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn

145 150 155 160

Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln

165 170 175

Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser

180 185 190

Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser

195 200 205

Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys

210 215 220

Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu

225 230 235 240

Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu

245 250 255

Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln

260 265 270

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

275 280 285

Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu

290 295 300

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

305 310 315 320

Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys

325 330 335

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

340 345 350

Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

355 360 365

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

370 375 380

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

385 390 395 400

Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln

405 410 415

Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

420 425 430

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys

435 440 445

<210> 35

<211> 1335

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 35

gaggtgaagt tggtggagag cggggggggg ctggtgcagc ctggaggaag tttgaggttg 60

agctgtgccg caagcgggtt cacatttagc acatatggaa tgagctgggt gaggcaggca 120

cccggaaagg gattggagtg ggtgagtaca atctccggcg gaggaaggta cacatactac 180

cccgatagtg tgaagggccg gttcacaatc tccagggaca acagcaagaa caccttgtac 240

ctgcagatga acagcctgag ggcagaagac accgctgtgt actactgcgc caggcagaag 300

gggacaacct ggtttgctca ctggggccag ggaaccctgg tgaccgtgag ctccgctagc 360

accaagggcc catccgtctt ccccctggcg ccctgctcca ggagcacctc cgagagcaca 420

gccgccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 480

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 540

tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcacgaa gacctacacc 600

tgcaacgtag atcacaagcc cagcaacacc aaggtggaca agagagttga gtccaaatat 660

ggtcccccat gcccaccatg cccagcacct gagttcctgg ggggaccatc agtcttcctg 720

ttccccccaa aacccaagga cactctcatg atctcccgga cccctgaggt cacgtgcgtg 780

gtggtggacg tgagccagga agaccccgag gtccagttca actggtacgt ggatggcgtg 840

gaggtgcata atgccaagac aaagccgcgg gaggagcagt tcaacagcac gtaccgtgtg 900

gtcagcgtcc tcaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960

gtctccaaca aaggcctccc gtcctccatc gagaaaacca tctccaaagc caaagggcag 1020

ccccgagagc cacaggtgta caccctgccc ccatcccagg aggagatgac caagaaccag 1080

gtcagcctga cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag 1140

agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 1200

tccttcttcc tctacagcag gctaaccgtg gacaagagca ggtggcagga ggggaatgtc 1260

ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc 1320

ctgtctctgg gtaaa 1335

<210> 36

<211> 445

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 36

Glu Val Lys Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Pro Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala His Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro

115 120 125

Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly

130 135 140

Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn

145 150 155 160

Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln

165 170 175

Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser

180 185 190

Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser

195 200 205

Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys

210 215 220

Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu

225 230 235 240

Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu

245 250 255

Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln

260 265 270

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

275 280 285

Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu

290 295 300

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

305 310 315 320

Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys

325 330 335

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

340 345 350

Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

355 360 365

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

370 375 380

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

385 390 395 400

Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln

405 410 415

Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

420 425 430

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys

435 440 445

<210> 37

<211> 1335

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 37

gaggtgcagt tggtggagag cggggggggg ctggtgcagc ctggaggaag tttgaggttg 60

agctgtgccg caagcgggtt cacatttagc acatatggaa tgagctgggt gaggcaggca 120

cccggaaagg gattggagtg ggtgagtaca atctctggcg gaggaaggta cacatactac 180

gccgatagtg tgaagggccg gttcacaatc tccagggaca acagcaagaa caccttgtac 240

ctgcagatga acagcctgag ggcagaagac accgctgtgt actactgcgc caggcagaag 300

gggacaacct ggtttgctca ctggggccag ggaaccctgg tgaccgtgag ctccgctagc 360

accaagggcc catccgtctt ccccctggcg ccctgctcca ggagcacctc cgagagcaca 420

gccgccctgg gctgcctggt caaggactac ttccccgaac cggtgacggt gtcgtggaac 480

tcaggcgccc tgaccagcgg cgtgcacacc ttcccggctg tcctacagtc ctcaggactc 540

tactccctca gcagcgtggt gaccgtgccc tccagcagct tgggcacgaa gacctacacc 600

tgcaacgtag atcacaagcc cagcaacacc aaggtggaca agagagttga gtccaaatat 660

ggtcccccat gcccaccatg cccagcacct gagttcctgg ggggaccatc agtcttcctg 720

ttccccccaa aacccaagga cactctcatg atctcccgga cccctgaggt cacgtgcgtg 780

gtggtggacg tgagccagga agaccccgag gtccagttca actggtacgt ggatggcgtg 840

gaggtgcata atgccaagac aaagccgcgg gaggagcagt tcaacagcac gtaccgtgtg 900

gtcagcgtcc tcaccgtcct gcaccaggac tggctgaacg gcaaggagta caagtgcaag 960

gtctccaaca aaggcctccc gtcctccatc gagaaaacca tctccaaagc caaagggcag 1020

ccccgagagc cacaggtgta caccctgccc ccatcccagg aggagatgac caagaaccag 1080

gtcagcctga cctgcctggt caaaggcttc taccccagcg acatcgccgt ggagtgggag 1140

agcaatgggc agccggagaa caactacaag accacgcctc ccgtgctgga ctccgacggc 1200

tccttcttcc tctacagcag gctaaccgtg gacaagagca ggtggcagga ggggaatgtc 1260

ttctcatgct ccgtgatgca tgaggctctg cacaaccact acacacagaa gagcctctcc 1320

ctgtctctgg gtaaa 1335

<210> 38

<211> 445

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 38

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Thr Tyr

20 25 30

Gly Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Thr Ile Ser Gly Gly Gly Arg Tyr Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Gln Lys Gly Thr Thr Trp Phe Ala His Trp Gly Gln Gly Thr

100 105 110

Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro

115 120 125

Leu Ala Pro Cys Ser Arg Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly

130 135 140

Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn

145 150 155 160

Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln

165 170 175

Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser

180 185 190

Ser Leu Gly Thr Lys Thr Tyr Thr Cys Asn Val Asp His Lys Pro Ser

195 200 205

Asn Thr Lys Val Asp Lys Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys

210 215 220

Pro Pro Cys Pro Ala Pro Glu Phe Leu Gly Gly Pro Ser Val Phe Leu

225 230 235 240

Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu

245 250 255

Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln

260 265 270

Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys

275 280 285

Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu

290 295 300

Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys

305 310 315 320

Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys

325 330 335

Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser

340 345 350

Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys

355 360 365

Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln

370 375 380

Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly

385 390 395 400

Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln

405 410 415

Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn

420 425 430

His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys

435 440 445

<210> 39

<211> 654

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 39

gacattcaga tgacccagag cccctcctcc ctctccgcct ccgtgggaga cagagttacc 60

atcacctgca gggcctccga atccgtggac gacaacggaa tctccttcat gaactggttt 120

cagcagaaac ccggcaaggc ccccaagctg ctcatctacg ctgcaagcaa ccagggctcc 180

ggcgtcccct cccgtttttc cggctccggg tccggcaccg acttcaccct gaccatctcc 240

tccctgcagc ccgaggactt cgccacctac tactgccagc agtccaagga ggtcccctgg 300

accttcggcc agggcaccaa ggtggagatc aagcgtacgg tggctgcacc atctgtcttc 360

atcttcccgc catctgatga gcagttgaaa tctggaactg cctctgttgt gtgcctgctg 420

aataacttct atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg 480

ggtaactccc aggagagtgt cacagagcaa gacagcaagg acagcaccta cagcctcagc 540

agcaccctga cgctgagcaa agcagactac gagaaacaca aagtctacgc ctgcgaagtc 600

acccatcagg gcctgagctc gcccgtcaca aagagcttca acaggggaga gtgt 654

<210> 40

<211> 218

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 40

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Ser Val Asp Asp Asn

20 25 30

Gly Ile Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ala Ser Asn Gln Gly Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln

115 120 125

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr

130 135 140

Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser

145 150 155 160

Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr

165 170 175

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys

180 185 190

His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro

195 200 205

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

210 215

<210> 41

<211> 654

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 41

gacattcaga tgacccagag cccctcctcc ctctccgcct ccgtgggaga cagagttacc 60

atcacctgca gggcctccga atccgtggac gacaacggaa tctccttcat gaactggttt 120

cagcagaaac ccggcaaggc ccccaagctg ctcatctacg ctgcaagcaa ccagggctcc 180

ggcgtcccct cccgtttttc cggctccggg tccggcaccg acttcaccct gaccatctcc 240

tccctgcagc ccgaggactt cgccacctac ttctgccagc agtccaagga ggtcccctgg 300

accttcggcc agggcaccaa ggtggagatc aagcgtacgg tggctgcacc atctgtcttc 360

atcttcccgc catctgatga gcagttgaaa tctggaactg cctctgttgt gtgcctgctg 420

aataacttct atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg 480

ggtaactccc aggagagtgt cacagagcaa gacagcaagg acagcaccta cagcctcagc 540

agcaccctga cgctgagcaa agcagactac gagaaacaca aagtctacgc ctgcgaagtc 600

acccatcagg gcctgagctc gcccgtcaca aagagcttca acaggggaga gtgt 654

<210> 42

<211> 218

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 42

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Ser Val Asp Asp Asn

20 25 30

Gly Ile Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro

35 40 45

Lys Leu Leu Ile Tyr Ala Ala Ser Asn Gln Gly Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln

115 120 125

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr

130 135 140

Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser

145 150 155 160

Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr

165 170 175

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys

180 185 190

His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro

195 200 205

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

210 215

<210> 43

<211> 654

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 43

gacattcaga tgacccagag cccctcctcc ctctccgcct ccgtgggaga cagagttacc 60

atcacctgca gggcctccga atccgtggac gacaacggaa tctccttcat gaactggttt 120

cagcagaaac ccggcaaggc ccccaagctg ctcatcaacg ctgcaagcaa ccagggctcc 180

ggcgtcccct cccgtttttc cggctccggg tccggcaccg acttcaccct gaccatctcc 240

tccctgcagc ccgaggactt cgccacctac ttctgccagc agtccaagga ggtcccctgg 300

accttcggcc agggcaccaa ggtggagatc aagcgtacgg tggctgcacc atctgtcttc 360

atcttcccgc catctgatga gcagttgaaa tctggaactg cctctgttgt gtgcctgctg 420

aataacttct atcccagaga ggccaaagta cagtggaagg tggataacgc cctccaatcg 480

ggtaactccc aggagagtgt cacagagcaa gacagcaagg acagcaccta cagcctcagc 540

agcaccctga cgctgagcaa agcagactac gagaaacaca aagtctacgc ctgcgaagtc 600

acccatcagg gcctgagctc gcccgtcaca aagagcttca acaggggaga gtgt 654

<210> 44

<211> 218

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 44

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Glu Ser Val Asp Asp Asn

20 25 30

Gly Ile Ser Phe Met Asn Trp Phe Gln Gln Lys Pro Gly Lys Ala Pro

35 40 45

Lys Leu Leu Ile Asn Ala Ala Ser Asn Gln Gly Ser Gly Val Pro Ser

50 55 60

Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser

65 70 75 80

Ser Leu Gln Pro Glu Asp Phe Ala Thr Tyr Phe Cys Gln Gln Ser Lys

85 90 95

Glu Val Pro Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Arg

100 105 110

Thr Val Ala Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln

115 120 125

Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe Tyr

130 135 140

Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser

145 150 155 160

Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser Lys Asp Ser Thr

165 170 175

Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys

180 185 190

His Lys Val Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro

195 200 205

Val Thr Lys Ser Phe Asn Arg Gly Glu Cys

210 215

Claims

1. An isolated monoclonal antibody, or antigen binding portion thereof, comprising:

(a) A heavy chain variable region CDR1, which hybridizes to SEQ ID NO:7, the amino acid sequences shown in the formula I are identical;

(b) A heavy chain variable region CDR2, which hybridizes to SEQ ID NO:8, the amino acid sequences shown in the formula I are identical;

(c) A heavy chain variable region CDR3, which hybridizes to SEQ ID NO:9, the amino acid sequences shown in the formula I are identical;

(d) A light chain variable region CDR1, which hybridizes to SEQ ID NO:10, and the amino acid sequences shown in the figure are identical;

(e) A light chain variable region CDR2, which hybridizes to SEQ ID NO:11, and the amino acid sequences shown in the formula I are identical;

(f) A light chain variable region CDR3, which hybridizes to SEQ ID NO:12, the amino acid sequences shown in 12 are identical;

2. The monoclonal antibody or antigen-binding portion thereof according to claim 1, comprising heavy and light chain variable region sequences:

(a) A heavy chain variable region having a sequence identical to SEQ ID NO:23, and a corresponding amino acid sequence as set forth in seq id no;

(b) A light chain variable region having a sequence identical to SEQ ID NO:25, and a corresponding amino acid sequence as set forth in seq id no;

3. The monoclonal antibody or antigen-binding portion thereof according to claim 1, which is a full-length antibody comprising human or murine constant regions.

4. A monoclonal antibody or antigen-binding portion thereof according to claim 3, wherein: the human constant region is selected from the group consisting of IgGl, igG2, igG3 or IgG4.

5. The monoclonal antibody or antigen-binding portion thereof according to claim 4, wherein: the human constant region is IgG4.

6. A monoclonal antibody or antigen-binding portion thereof according to claim 3, wherein: the murine constant region is selected from the group consisting of IgGl, igG2A, igG B or IgG 3.

7. A monoclonal antibody or antigen-binding portion thereof according to claim 3, wherein: the antibody or antibody fragment is a chimeric antibody or chimeric antibody fragment.

8. The monoclonal antibody or antigen-binding portion thereof according to claim 7, wherein: the antibody or antibody fragment is a human antibody or human antibody fragment.

9. The monoclonal antibody or antigen-binding portion thereof according to claim 8, wherein: the antibody or antibody fragment is a humanized antibody or humanized antibody fragment.

10. A monoclonal antibody or antigen-binding portion thereof according to claim 3, wherein: the antibody fragment is a Fab, fab '-SH, fv, scFv or F (ab') 2 antibody fragment.

11. A monoclonal antibody or antigen-binding portion thereof according to claim 3, wherein: the antibody fragment is a diabody.

12. An isolated monoclonal antibody comprising:

13. An isolated polynucleotide encoding the monoclonal antibody or antigen binding portion of any one of claims 1-12.

14. The polynucleotide according to claim 13, wherein: the nucleotide sequence for encoding the antibody heavy chain is shown as SEQ ID NO. 33, and the nucleotide sequence for encoding the antibody light chain is shown as SEQ ID NO. 39.

15. An expression vector comprising the polynucleotide of claim 13.

16. A host cell comprising the expression vector of claim 15.

17. A pharmaceutical composition comprising the monoclonal antibody or antigen-binding portion of any one of claims 1-12 and a pharmaceutically acceptable carrier.

18. Use of a monoclonal antibody or antigen binding portion according to any one of claims 1-12 in the manufacture of a medicament for the treatment of cancer diseases.

19. Use according to claim 18, characterized in that: anti-PD-1 antibodies are used alone to inhibit the growth of cancerous tumors, or in combination with immunogenic agents, standard cancer treatment drugs.

20. Use according to claim 18, characterized in that: such cancers include melanoma, renal cancer, prostate cancer, breast cancer, colon cancer, lung cancer, bone cancer, pancreatic cancer, skin cancer, head or neck cancer, ovarian cancer, rectal cancer, anal region cancer, gastric cancer, testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, hodgkin's disease, non-hodgkin's lymphoma, esophageal cancer, small intestine cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urinary tract cancer, penile cancer, chronic or acute leukemia, childhood solid tumors, bladder cancer, primary CNS lymphoma, spinal axis (spinal axis) tumors, brain stem glioma, pituitary adenoma, environmentally induced cancers, and combinations thereof.

21. Use according to claim 19, characterized in that: the anti-PD-1 antibody is used for treating cancers in combination with a teninib product, wherein the teninib drug comprises Gefitinib (Gefitinib), osimatinib (Oritinib), icotinib (Icotinib), afantinib (Afatinib), erlotinib (Erlotinib), crititinib (Izotinib), alectinib (Alatinib salt), ceritinib (Ceritinib), trametenib (Qu Moti), cobimetib (Cobiminib), axitinib (Alitinib), lenvatinib (Levalatinib), cabozantinib (Cartinib), sunitinib (Sunitinib), bosutatinib (Bosutinib), nilotinib (Palatinib), apinib (Alatinib), potinib (Alatinib), alatinib (Toxitinib), toxitinib (Torotinib), or Torotinib (Torotinib).