CN112225798B

CN112225798B - Human immunodeficiency virus neutralizing antibodies and methods of use thereof

Info

Publication number: CN112225798B
Application number: CN202011116870.7A
Authority: CN
Inventors: 约翰内斯·谢德; 米歇尔·努森兹韦格; 帕梅拉·J·比约克曼; 罗恩·迪斯金
Original assignee: Rockefeller University; California Institute of Technology CalTech
Current assignee: Rockefeller University; California Institute of Technology CalTech
Priority date: 2011-05-17
Filing date: 2012-05-17
Publication date: 2023-07-18
Anticipated expiration: 2032-05-17
Also published as: ES2895523T3; AU2020201993A1; CA2836468C; US10889633B2; MX358099B; PT2710033T; CN106432484B; WO2012158948A1; EP3865507A1; AU2020201993B2; CN106432484A; US20210230254A1; US11634478B2; US20140328862A1; AU2022204340A1; IL295205A; JP2022115945A; AU2012255266B2; EA201391713A1; BR112013029550A2

Abstract

The present invention relates to human immunodeficiency virus neutralizing antibodies and methods of use thereof. In particular, the invention provides broad spectrum neutralizing antibodies against epitopes of human immunodeficiency virus or HIV. The invention further provides compositions comprising HIV antibodies for prophylaxis and methods for diagnosing and treating HIV infection.

Description

Human immunodeficiency virus neutralizing antibodies and methods of use thereof

The application is a divisional application of Chinese patent application with the application number of 201280035621.2 (201610569462.4), the application date of 2012, 5 and 17, and the invention name of 'human immunodeficiency virus neutralizing antibody and using method thereof'.

Cross Reference to Related Applications

The present application claims priority from U.S. patent application Ser. No.61/486,960 filed on 5/17/2011 in accordance with 35 U.S. patent application Ser. No. 119 (e). The disclosure of this provisional application is incorporated herein in its entirety.

Statement of federally sponsored research

Leading to the study of the present invention being supported in part by U.S. national institutes of health foundation No. p 01ai08677-01. Accordingly, the U.S. government has certain rights in this invention.

Sequence listing

The present application contains a sequence listing submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. The ASCII copy made at 21/2016 was named 1603418US 01-sequence Listing. Txt, 935961 bytes in size.

Technical Field

The present invention relates to antibodies directed against epitopes of human immunodeficiency virus ("HIV"). The invention also relates to the preparation and use of broad-spectrum neutralizing antibodies against gp120 envelope proteins of HIV for the prevention and treatment of HIV infection.

Background

HIV causes acquired immunodeficiency syndrome ("AIDS"). Immune responses to HIV infection in long-term non-progressors have shown that specific viral immunity can limit the infection and symptoms of the disease. Some HIV-infected individuals exhibit a broad spectrum of neutralizing IgG antibodies in their serum; while they are of potential importance for designing effective vaccines, little is known about the specificity and activity of these antibodies and no single feature corresponds to protective immunity. In animal models, passive transfer of neutralizing antibodies can help prevent viral attack. Neutralizing antibody responses can also develop in HIV-infected individuals, but the detailed composition of the serum response is not fully revealed.

Many immune abnormalities of AIDS have been revealed. These include, but are not limited to, B cell dysfunction, abnormal antibody responses, defective monocyte function, impaired cytokine production, natural killer and cytotoxic cell function inhibition, defective lymphocyte recognition and responsiveness to soluble antigens, and depletion of T4 helper/inducer lymphocyte populations.

Amino acid and RNA sequences encoding HIV env from a large number of HIV strains are known (Modrow, S.et al, J.virology 61 (2): 570 (1987)). HIV virions are covered with a membrane or coating derived from the outer membrane of the host cell. The membrane comprises a population of envelope glycoproteins (gp 160) anchored at their carboxy-terminal region to a membrane bilayer. Each glycoprotein comprises two fragments: n-terminal fragment and C-terminal fragment. The N-terminal fragment, which is referred to as gp 120 due to its relative molecular weight of about 120kD, protrudes into the aqueous environment surrounding the virion. The C-terminal fragment, designated gp 41, spans the membrane. The N-terminal gp 120 and the C-terminal gp 41 are covalently linked by peptide bonds that are particularly susceptible to proteolytic cleavage. See European patent application publication No.0 335 635 to McCune et al, and references cited therein, each of which is incorporated herein by reference in its entirety.

Several methods of constructing AIDS vaccines have been proposed, including, but not limited to, inactivated and attenuated viral vaccines, subunit vaccines from virally infected cells, recombinantly produced viral antigens, synthetic peptide-based vaccines, anti-idiotype vaccines, and viral vector-based vaccines. Another method for therapeutic and prophylactic treatment of HIV involves the production of potent, broad-spectrum neutralizing monoclonal antibodies. Several studies have reported cloning and production of monoclonal antibodies targeting the CD4 binding site and other parts of the virion spike and neutralizing HIV by various techniques. Generally, these techniques include self-fusion or phage display techniques. Typically, in the preparation of HIV neutralizing antibodies using phage display technology, random combinations of heavy and light chains are combined and a random pair is selected. Studies have reported a limited number of monoclonal antibodies, e.g., phage display antibody b12, which is broad spectrum potent and broad spectrum neutralizing (i.e., antibodies can neutralize multiple HIV in serum) HIV. Monoclonal antibody b12 is a reported broad-spectrum neutralizing antibody that prevents HIV infection in cynomolgus monkeys. Another broad spectrum neutralizing antibody includes 2G12, which atypically has a structure found in any other antibody with three combining sites.

VRC01 is a recently discovered broad spectrum neutralizing antibody that targets the CD4 binding site (CD 4 bs) on HIV spikes. VRC01 was isolated by purification of single B cells that bound to a core fragment of soluble, biotin-labeled, stabilized and re-surfaced HIV gp120 (X.Wu et al Science 329,856 (Aug 13,2010)). Although successful, the separation efficiency was low, producing only 3 closely related antibodies that bind HIV from 2500 ten thousand peripheral blood mononuclear cells of one individual. Like other anti-HIV antibodies obtained by single cell antigen capture methods, VRC01-3 shows very high levels of somatic mutation, which is essential for potency and breadth. Such high frequency mutations are potential obstacles to antibody cloning, as the mutated sequence may no longer be complementary to the primers used for cloning.

Some studies report that some patients produce broadly neutralized HIV antibodies. Studies have reported that antibodies can protect against initial HIV infection and can regulate viral load during infection in passive transfer experiments in non-human primates. See, e.g., mascola,2000; shibata,1999; veazey,2003; parren,2001; mascola,1999; trkola,2005; wei,2003; frost,2005; burton,2004; mascola,2007; karlsson Hedestam,2008; mcMichael,2006; zolla-Pazner,2004.

Disclosure of Invention

The present invention provides in one embodiment, HIV broad-spectrum neutralizing antibodies. In one embodiment, the invention provides an isolated HIV antibody comprising a heavy chain comprising a consensus amino acid sequence:

QXXLXQSQGGXKKKGGXSVKKKVScsXXASGXYXXXXXIXHXXXXXGXWVGXXXXGXXAXXFQGRLSLTRDRDXXXXTXFMDLXGLRXDDDDTAYFCARXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX (SEQ ID NO: (SEQ ID NO: 1), wherein X represents any amino acid or NO amino acid.

In another embodiment, the invention provides an isolated HIV antibody comprising a light chain comprising a consensus amino acid sequence:

EIXLTQSLSXSXGEXXTISCXXXQXXXXXXXLXWYQQRXGXXXPRLLIXXXXXXGVGRRSGXXGXXXXXXXXXXLXXLXSXXLXXXDAXYFCXXYEXXXXXXXXXXX (SEQ ID NO: (SEQ ID NO: 2), wherein X represents any amino acid or NO amino acid.

In another embodiment, the invention provides an isolated HIV antibody comprising a heavy chain comprising a highly conserved consensus sequence and a light chain comprising a highly conserved consensus sequence. The invention further provides methods of producing an isolated HIV antibody comprising a heavy chain and a light chain, wherein the heavy chain comprises a highly conserved consensus sequence and the light chain comprises a highly conserved consensus sequence.

In another embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, and a light chain sequence of seq id no. In a further embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, or a sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% identity thereto, and the antibody does not have the amino acid sequence of VRC 01.

In another embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, and wherein the antibody is in an IC of less than 1.0 μg/ml ₅₀ Neutralizing HIV virus ZM53M.PB12 at concentration, or IC at less than 1.0 μg/ml ₅₀ Neutralizing HIV virus R1166.c1 at concentrations, or IC at concentrations less than 30 μg/ml ₅₀ Concentration time neutralization DU172.17. In another embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, wherein the antibody is in an IC of less than 30 μg/ml ₅₀ At concentrations, the VRC01 resistant HIV virus was neutralized.

In another embodiment, the invention provides an isolated HIV antibody selected from the group consisting of 3BNC117, 3BNC60, 12A12, 12A21, NIH45-46, 8ANC131, 8ANC134, IB2530, INC9, and 8ANC196.

In another embodiment, the invention provides an isolated HIV antibody comprising heavy chain CDR1, CDR2, and CDR3 regions and light chain CDR1, CDR2, and CDR3 regions comprising the amino acid sequences of corresponding regions of an HIV antibody selected from the group consisting of 3BNC117, 3BNC60, 12a12, 12a21, NIH45-46, bANC131, 8ANC134, IB2530, INC9, and 8ANC196.

In another embodiment, the invention provides an isolated HIV antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-438.

In another embodiment, the invention provides an isolated HIV antibody comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 439-583.

In another embodiment, the invention provides an isolated HIV antibody comprising a heavy chain and a light chain comprising the amino acid sequences set forth in table a or table B.

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the amino acid sequence: insertion sequence of ASWDFDF (SEQ ID NO: 3).

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the amino acid sequence: an insertion sequence of TARDY (SEQ ID NO: 4).

In another embodiment, the invention provides an isolated HIV antibody comprising the insert sequence of SEQ ID NO:3 and SEQ ID NO:4.

in another embodiment, the invention provides a method for increasing HIV neutralization potency and breadth of an isolated HIV antibody comprising inserting at least one insertion sequence of SEQ ID NO:3 and SEQ ID NO:4.

according to another embodiment, the invention provides a composition comprising an isolated HIV antibody of the invention.

According to another embodiment, the invention provides a pharmaceutical composition comprising an antibody of the invention and a pharmaceutically acceptable carrier.

According to another embodiment, the invention provides a nucleic acid molecule encoding an isolated HIV antibody of the invention.

According to other embodiments, the invention provides vectors comprising nucleic acid molecules encoding the isolated HIV antibodies of the invention, as well as cells comprising the vectors.

According to another embodiment, the present invention provides a method for preventing or treating HIV infection or HIV-associated diseases, comprising the steps of: identifying a mammalian subject in need of such prevention or treatment, and administering to said subject at least one therapeutically effective amount of an HIV antibody of the present invention.

According to another embodiment, the method further comprises administering a second therapeutic agent. According to another embodiment, the second therapeutic agent is an antiviral agent.

Another embodiment of the invention provides a method of reducing viral replication or transmission of infection into other host cells or tissues comprising contacting mammalian cells with at least one antibody of the invention. According to another aspect, the invention provides a method for treating a mammalian subject infected with HIV, the method comprising administering to said subject a pharmaceutical composition comprising at least one antibody of the invention.

According to another embodiment, the present invention provides a method for preparing and administering an HIV antibody preparation, wherein the HIV antibody preparation is suitable for administration to a mammalian subject suffering from or at risk of infection by HIV in an amount or according to a schedule sufficient to induce a protective immune response against HIV or reduce the HIV virus in the mammalian subject. In another embodiment, the invention provides a method for detecting an HIV antibody comprising a heavy chain comprising a highly conserved consensus sequence and a light chain comprising a highly conserved consensus sequence in a biological sample.

In another embodiment, the invention provides an isolated antibody of the invention for use in the treatment of HIV.

In another embodiment, the invention provides a kit comprising a pharmaceutically acceptable dosage unit of a pharmaceutically effective amount of an isolated HIV antibody of the invention, and a pharmaceutically acceptable dosage unit of a pharmaceutically effective amount of an HIV agent selected from the group consisting of a non-nucleoside reverse transcriptase inhibitor, a protease inhibitor, an entry or fusion inhibitor, and an integrase inhibitor, wherein both pharmaceutically acceptable dosage units may optionally take the form of a single pharmaceutically acceptable dosage unit.

In another embodiment, the invention provides a kit for diagnosing, prognosing or monitoring HIV treatment in a subject comprising one or more detection reagents that specifically bind to anti-HIV neutralizing antibodies in a biological sample derived from the subject. In another aspect of the invention, the kit further provides reagents for performing PCR or mass spectrometry.

Drawings

FIGS. 1A-D show HIV antibody neutralizing activity IC ₅₀ . (A) a restraint panel. The top row represents the number of donors followed by clones or antibodies (table 4); viruses are shown on the left. Color representation IC ₅₀ Concentration: red is less than or equal to 0.1 mug/ml; orange 0.1-1 mug/ml; yellow 1-10 mug/ml; green is more than or equal to 10 mug/ml; white indicates that it was not neutralized at any of the concentrations tested. (B) an expansion panel. (C) The neutralization summary plots of VRC01, NIH45-46, 3BNC117 were compared. Line segment length and circle size and IC ₅₀ Inversely proportional. The color represents the viral clade: red a, blue B, green C, mauve D, black AE, gold AG. (D) The sequences of 3BNC60 (SEQ ID NO: 893), 1B2530 and 8ANC134 heavy chains are light grey covered with peptides found in the mass spectrum. Red dots represent differences between the various germline sequences.

FIGS. 2A-C show the binding properties of HIV antibodies. (A) 12A12, 12A21 and 12A-Germ Line (GL) reduced (reversed) antibodies bind to the representative SPR sensorgrams of YU2-gp140 and 2 CC-cores. (B) The figure shows the K of representative antibodies _A . (C) The figure shows the average fluorescence intensity of anti-CD 4i antibodies bound to bal.26 expressing 293T cells after incubation with the indicated antibodies. The table shows whether the antibodies induced CD4i site accessibility.

FIGS. 3A and B show the consensus sequence of HIV antibodies, as well as the amino acid sequences of HIV antibodies. (A) Alignment of germline genes, 10 selected antibodies and 8ANC195 (SEQ ID NOS: 1 and 890-902, respectively, numbered in order of occurrence) with respect to amino acid identity of the Framework (FR) and CDR regions. Residues are numbered according to the structure of 3BNC 60. (B) Similar to A, an alignment of the light chains (SEQ ID NOS: 2 and 903-916, numbered in order of occurrence) is shown. (C, D and E) crystalline structure of 3BNC60 Fab.

FIGS. 4A and B show the recovery of highly mutated immunoglobulin heavy chains with specific primers. (A) parallel comparison of New and old primer sets. Red box represents IgV _H Successful amplification of the gene. Fig. 4A discloses SEQ ID NOs: 917-979, numbered in order of appearance) (B) binds to HIV antibodies derived from the 2 CC-core of Pt 8. Clone family is represented as differently expanded sheetsShape. Two highly mutant clones that could not be amplified with the old primer set were shown to be striped sectors.

FIG. 5 shows the sequence of the Ig V heavy chain (A) (SEQ ID NOS: 980-984, respectively, numbered in order of occurrence) and light chain (B) (SEQ ID NOS: 985-989, respectively, numbered in order of occurrence) of a novel VRC01 clone member.

Figure 6 shows patient serum neutralization activity. (A) The table summarizes the neutralizing activity of purified serum IgG against a panel of Tier 2 viruses in the Tzm-bl assay. Dark red box indicates IC ₅₀ Values below 10. Mu.g/ml, orange being expressed as IC ₅₀ A value between 10 and 100. Mu.g/ml and a yellow color expressed as IC ₅₀ The value is higher than 100. Mu.g/ml. (B) The dot plot summarizes the ICs shown in a for 4 more broadly tested patients ₅₀ Values.

Figure 7 demonstrates detection of antibodies by mass spectrometry. The collision activated dissociation (collision activated dissociation) MS/MS spectra recorded the two charged peptides HSDYCDFDVWGSGSQVIVSSASTK (SEQ ID NO: 888) from 3BNC153HC (A) and DGLGEVAPAYLYGIDAWGQGTTVIVTSA STK (SEQ ID NO: 889) from 8ANC134 HC. The observed b-type fragment ions (containing the N-terminus) and y-type fragment ions (containing the C-terminus) are labeled in the spectrum, the loss of water from the fragment ions is expressed as a. The ions corresponding to the loss of water from the parent ion are labeled in the spectrum. The observed backbone cleavage is used in the sequence Represents ion of type b and is->Representing a type y ion.

Figures 8A and B demonstrate the affinity of HIV antibodies. (A) Antibodies binding to gp140 and 2 CC-nuclei as determined by Surface Plasmon Resonance (SPR). The SPR sensorgrams of antibody binding for selected 3 BNC-antibody clones are shown over time. (B) The histogram shows the binding affinity (K) of the selected IgG antibodies shown in A to gp140 and 2 CC-core antigen _A ). RU, reaction unit.

FIGS. 9A-C show somatic hypermutation analysis of selected HIV antibodies for (A) immunoglobulin heavy chain gene, (B) light chain kappa and (C) light chain lambda gene sequences. Sequence alignment was performed with their respective germline nucleotide sequences. Somatic mutations are shown as red letters, with the grey boxes referring to substitution mutations. Germline amino acid sequences with the indicated consensus residues are shown above the nucleotide alignment. Fig. 9A discloses SEQ ID NO: 991. 990 and 992-997; fig. 9A further discloses SEQ ID NO: 999. 998 and 1000-1003; fig. 9B discloses SEQ ID NO: 1005. 1004 and 1006-1009; fig. 9B further discloses SEQ ID NO: 1011. 1010 and 1012-1015; and fig. 9C discloses SEQ ID NO: 1017. 1016 and 1018-1019, all numbered in the order of occurrence, respectively.

FIGS. 10A-C show the antibody sequences from one expanded neutralization clone for each of (A) patient (Pt) 1, (B) Pt3, and (C) Pt 8. Peptides identified by mass spectrometry are represented in color. Peptides (represented by light grey) observed by one or more mass spectra uniquely define the asterisked variants. The remaining mass spectra observed peptides did not uniquely correspond to the multiple variants, indicated as dark grey. The underlined amino acids represent non-trypsin cleavage sites in the variants shown. Cleavage is presumed to occur by chymotrypsin cleavage or other mutations (not observed in cloned variants) that add lysine or arginine residues at these sites. Fig. 10A discloses SEQ ID NO:1020-1061; fig. 10B discloses SEQ ID NO:1062-1113; and fig. 10C discloses SEQ ID NO:1114-1138, all numbered in the order of occurrence, respectively.

Detailed Description

Detailed description of the invention

HIV neutralizing antibodies

In one embodiment of the invention, there is provided an anti-HIV broad-spectrum neutralizing antibody. In one embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the consensus amino acid sequence:

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the consensus amino acid sequence: EIXLTQSLSXSXGEXXTISCXXXQXXXXXXXLXWYQQRXGXXXPRLLIXXXXXXGVGRRSGXXGXXXXXXXXXXLXXLXSXXLXXXDAXYFCXXYEXXXXXXXXXXX (SEQ ID NO: (SEQ ID NO: 2), wherein X represents any amino acid or NO amino acid.

In another embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and SEQ ID NO:2, and a light chain sequence of seq id no. In a further embodiment, the invention provides an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and SEQ ID NO:2, or a sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% identity thereto, and the antibody does not have the amino acid sequence of VRC 01. Percent identity is determined as disclosed below.

In other embodiments, the invention provides isolated HIV antibodies comprising a heavy chain comprising a highly conserved heavy chain amino acid sequence and a light chain comprising a highly conserved light chain amino acid sequence. A highly conserved heavy chain amino acid sequence is defined herein as an amino acid sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98% or at least 99% identity to the sequence of SEQ ID NO. 1. A highly conserved light chain amino acid sequence is defined herein as an amino acid sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98% or at least 99% identity to the sequence of SEQ ID NO. 2. Percent identity is determined as disclosed below.

In another embodiment, the invention provides an isolated HIV antibody comprising a heavy chain comprising a highly conserved heavy chain amino acid sequence and a light chain comprising a highly conserved light chain amino acid sequence, and the antibody does not have the sequence of VRC 01.

In another embodiment, the invention provides an isolated HIV antibody comprising the heavy chain sequence of SEQ ID NO. 1 and the sequence of SEQ ID NO:2, light chain sequence ofOne or two, and wherein the antibody is in an IC of less than 1.0 μg/ml ₅₀ Neutralization of HIV virus ZM53M.PB12 at a concentration, or IC at less than 1.0 μg/ml ₅₀ Neutralization of HIV virus R1166.c1 at concentrations, or IC at less than 30 μg/ml ₅₀ DU172.17 was neutralized at concentration. In another embodiment, the invention provides an isolated HIV antibody comprising one or both of the heavy chain sequence of SEQ ID NO. 1 and the light chain sequence of SEQ ID NO. 2, wherein the antibody is in an IC of less than 30 μg/ml ₅₀ The HIV virus against VRC01 was neutralized at concentration. HIV virus against VRC01 is defined herein as IC at 50 μg/ml ₅₀ The value of the virus can resist the neutralized HIV virus of VRC 01. HIV viruses against VRC01 include, for example, HO86.8, DU172.17, 250-4, 278-50, and 620445.c1.

In another embodiment, the invention provides an isolated HIV antibody selected from the group consisting of 3BNC117, 3BNC60, 12A12, 12A21, NIH45-46, bANC131, 8ANC134, IB2530, INC9, and 8ANC196.

In another embodiment, the invention provides an isolated HIV antibody comprising heavy chain CDR1, CDR2, and CDR3 regions and light chain CDR1, CDR2, and CDR3 regions comprising amino acid sequences of corresponding regions of an HIV antibody selected from 3BNC117, 3BNC60, 12a12, 12a21, NIH45-46, bANC131, 8ANC134, IB2530, INC9, and 8ANC 196.

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 5-438.

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 439-583.

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the amino acid sequence: insertion sequence of ASWDFDF (SEQ ID NO: 3). In another embodiment, the invention provides an isolated HIV antibody, wherein the insert sequence of SEQ ID NO:3 corresponds to the FR3 region of the heavy chain starting from amino acid 74 of 3BNC117 and 3BNC60 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:3 replaces the corresponding region of the HIV antibodies of the present invention. For example, SEQ ID NO:3 may be inserted after the seventh amino acid of heavy chain FR 3.

In another embodiment, the invention provides an isolated HIV antibody comprising a polypeptide comprising the amino acid sequence: an insertion sequence of TARDY (SEQ ID NO: 4). In another embodiment, the invention provides an isolated HIV antibody, wherein the insert sequence of SEQ ID No:4 corresponds to the CDR3 region of the heavy chain starting from amino acid 103 of NIH45-46 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:4 replaces the corresponding region of the HIV antibodies of the present invention. For example, SEQ ID NO:4 may be inserted after the fourth amino acid of heavy chain CDR 3.

In another embodiment, the invention provides an isolated HIV antibody, wherein the insert sequence of SEQ ID No:3 corresponds to the FR3 region of the heavy chain starting from amino acid 74 of 3BNC117 and 3BNC60 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:3 and insert sequence SEQ ID No:4 corresponds to the CDR3 region of the heavy chain starting from amino acid 103 of NIH45-46 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:4 replaces the corresponding region of the HIV antibodies of the present invention. For example, SEQ ID NO:3 may be inserted after the seventh amino acid of FR3 of the heavy chain and SEQ ID NO:4 may be inserted after the fourth amino acid of CDR3 of the heavy chain.

In another embodiment, the invention provides a method for increasing HIV neutralization potency and breadth of an isolated HIV antibody comprising preparing an isolated HIV antibody, wherein the insert sequence of SEQ ID No:3 corresponds to the FR3 region of the heavy chain starting from amino acid 74 of 3BNC117 and 3BNC60 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:3, and/or the insertion sequence SEQ ID No:4 corresponds to the CDR3 region of the heavy chain starting from amino acid 103 of NIH45-46 as shown in fig. 5A, as determined by sequence alignment, the insertion sequence SEQ ID NO:4 replaces the corresponding region of the HIV antibodies of the present invention. For example, SEQ ID NO:3 may be inserted after the seventh amino acid of FR3 of the heavy chain and/or after the amino acid sequence of SEQ ID NO:4 may be inserted after the fourth amino acid of CDR3 of the heavy chain. The amino acid sequence of an antibody can be modified by one skilled in the art using recombinant methods for polypeptide or antibody production and/or synthetic chemistry techniques. In addition, one skilled in the art can identify improved HIV antibodies with greater HIV neutralization potency and breadth by using the HIV neutralization assay described below.

In another embodiment, the invention provides an improved isolated HIV antibody comprising the insert sequence of SEQ ID NO:3 and SEQ ID NO:4, wherein the improved isolated HIV antibody is identical to the non-inserted sequence of SEQ ID NO:3 and SEQ ID NO:4 has a greater HIV neutralizing efficacy and breadth than the isolated HIV antibody of fig. 4. Those skilled in the art are able to identify improved HIV antibodies with greater HIV neutralization potency and breadth by using the HIV neutralization assay described below.

The amino acid sequence of an antibody can be modified by one skilled in the art using recombinant methods for polypeptide or antibody production and/or synthetic chemistry techniques.

In another embodiment, the invention provides a method of making an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, and a light chain sequence of seq id no. In another embodiment, the invention provides a method of producing an isolated HIV antibody comprising the amino acid sequence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, or a sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% identity thereto, and the antibody does not have the amino acid sequence of VRC 01. Percent identity was determined as follows.

In another embodiment, the invention provides a method of detecting isolated HIV antibodies comprising obtaining an immunoglobulin-containing biological sample from a mammalian subject, isolating HIV antibodies from the sample, determining the amino acid sequence of the HIV antibodies, and identifying the presence or absence of the amino acid sequence of SEQ ID NO:1 and SEQ ID NO:2, and a light chain sequence of seq id no. In another embodiment, the invention provides a method of selecting an isolated HIV antibody comprising determining the presence or absence of SEQ ID NO:1 and the heavy chain consensus sequence of SEQ ID NO:2, or a sequence having at least 70%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99% identity thereto, and the antibody does not have the amino acid sequence of VRC 01. Percent identity was determined as described below. The biological sample may be blood, serum, saliva, urine, sputum, a cell swab sample or a tissue biopsy. The amino acid sequence may be determined by methods known in the art including, for example, PCR and mass spectrometry.

The term "antibody" (Ab) as used herein includes monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies and polyclonal antibodies), and antibody fragments. Thus, the term "antibody" as used in any context in this specification is meant to include, but is not limited to, any specific binding member, immunoglobulin type and/or isotype (e.g., igG1, igG2, igG3, igG4, igM, igA, igD, igE, and IgM); and biologically relevant fragments or specific binding members thereof, including but not limited to Fab, F (ab') 2, fv, and scFv (single chain or related). Antibodies are known in the art to be glycoproteins or antigen binding portions thereof comprising at least two heavy (H) chains and two light (L) chains connected internally by disulfide bonds. The heavy chain consists of a heavy chain variable region (VH) and heavy chain constant regions (CH 1, CH2 and CH 3). The light chain is composed of a light chain variable region (VL) and a light chain constant region (CL). The variable regions of both the heavy and light chains include framework regions (FWR) and Complementarity Determining Regions (CDRs). The four FWR regions are relatively conserved, while the CDR regions (CDR 1, CDR2 and CDR 3) represent hypervariable regions and are arranged from NH2 terminus to COOH terminus as follows: FWR1, CDR1, FWR2, CDR2, FWR3, CDR3, FWR4. The variable regions of the heavy and light chains contain binding domains that interact with the antigen, while depending on the isotype, the constant regions may mediate binding of the immunoglobulin to host tissues or factors.

Meanwhile, "antibody" as defined herein also includes chimeric antibodies, humanized antibodies and recombinant antibodies, human antibodies produced in transgenic non-human animals, and antibodies selected from libraries produced using enrichment techniques available to those skilled in the art.

The term "variable" refers to the wide variation in sequence of certain fragments of the variable (V) region between antibodies. The V domain mediates antigen binding and defines the specificity of a particular antibody for its particular antigen. However, the variability is not evenly distributed over the variable region spanning 110 amino acids. In contrast, the V region consists of relatively constant fragments (stretch) of 15-30 amino acids called Framework Regions (FR) divided by short regions of extreme variability, called "hypervariable regions", each 9-12 amino acids long. The variable regions of the natural heavy and light chains each comprise four FR, mostly in a β -sheet configuration, joined by 3 hypervariable regions, which form the connecting portion of the β -sheet structure and in some cases the loops of the portion of the β -sheet structure. The hypervariable regions in each chain are tightly linked by FRs and together with hypervariable regions from other chains promote the formation of the antigen binding site of the antibody (see, e.g., kabat et al Sequences of Proteins of Immunological Interest,5th Ed.Public Health Service,National Institutes of Health,Bethesda,Md (1991)).

The term "hypervariable region" herein refers to the amino acid residues of an antibody that are responsible for antigen binding. Hypervariable regions typically comprise amino acid residues from "complementarity determining regions" ("CDRs").

The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., a population comprising individual antibodies, which are identical except for naturally occurring mutations that may be present in minor amounts. The term "polyclonal antibody" refers to a preparation comprising different antibodies against different determinants ("epitopes").

Monoclonal antibodies herein include "chimeric" antibodies in which a portion of the heavy and/or light chains are identical or homologous to corresponding sequences from a particular species or antibodies belonging to a particular antibody class or subclass, while the remainder of the chains are identical or homologous to corresponding sequences from another species or antibodies belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (see, e.g., U.S. Pat. No.4,816,567; morrison et al, proc. Natl. Acad. Sci. USA,81:6851-6855 (1984)). The present invention provides variable region antigen binding sequences from human antibodies. Thus, chimeric antibodies of primary interest herein include antibodies having one or more human antigen binding sequences (e.g., CDRs) and containing one or more sequences from a non-human antibody, such as FR or C region sequences. Furthermore, chimeric antibodies described herein are antibodies comprising human variable region antigen binding sequences of one antibody class or subclass and another sequence, such as FR or C region sequences, from another antibody class or subclass.

"humanized antibodies" are generally considered human antibodies having one or more amino acid residues introduced into them from a non-human source. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable region. Humanization may be performed by substituting the corresponding human antibody sequence by the introduction of hypervariable region sequences by the method set forth below by Winter and colleagues (see, e.g., jones et al, nature 321:522-525 (1986); reichmann et al, nature 332:323-327 (1988); verhoeyen et al, science 239:1534-1536 (1988)). Thus, such "humanized" antibodies are chimeric antibodies (see, e.g., U.S. Pat. No.4,816,567) in which substantially less than one complete human variable region is replaced by a corresponding sequence of non-human species origin.

An "antibody fragment" comprises a portion of an intact antibody, such as the antigen binding or variable region of an intact antibody. Examples of antibody fragments include, but are not limited to, fab ', F (ab') 2, and Fv fragments; a diabody; linear antibodies (see, e.g., U.S. Pat. No.5,641,870; zapata et al, protein Eng.8 (10): 1057-1062[1995 ]); a single chain antibody molecule; and multispecific antibodies formed from antibody fragments.

"Fv" is the smallest antibody fragment that contains the complete antigen recognition and antigen binding site. The fragment comprises a dimer of one heavy chain variable region domain and one light chain variable region domain in a tight non-covalent association. From the folding of these two domains, 6 hypervariable loops (3 loops formed from each of the H and L chains) are created, which provide amino acid residues for antigen binding and confer antigen binding specificity to the antibody. However, even a single variable region (or half of an Fv, which contains only 3 antigen-specific CDRs) has the ability to recognize and bind antigen, albeit with a lower affinity than the complete binding site.

A "single chain Fv" ("sFv" or "scFv") is an antibody fragment comprising VH and VL antibody domains linked into a single polypeptide chain. The sFv polypeptide may further comprise a polypeptide linker arm between the VH and VL domains, which allows the sFv to form the structure required for antigen binding. For reviews of sFv see, e.g., pluckaphun in The Pharmacology of Monoclonal Antibodies, vol.113, rosenburg and Moore eds, springer-Verlag, new York, pp.269-315 (1994); borrebaeck 1995, below.

The term "diabody" is a small antibody fragment prepared by constructing an sFv fragment having a short linker arm (about 5-10 residues) between the VH and VL domains such that inter-chain rather than intra-chain pairing of the V domains is obtained, forming a bivalent fragment, i.e. a fragment having two antigen-binding sites. Bispecific diabodies are heterodimers of two "crossed" sFv fragments in which the VH and VL domains of the two antibodies are present on different polypeptide chains. Diabodies are more fully described in, for example, EP404,097; WO 93/11161; hollinger et al, proc.Natl. Acad. Sci.USA,90:6444-6448 (1993).

Domain antibodies (dabs), which can be produced in fully human form, are the smallest known antigen-binding fragments of antibodies, ranging from about 11kDa to about 15kDa. dabs are the high (robust) variable regions of the heavy and light chains of immunoglobulins (VH and VL, respectively). It is highly expressed in microbial cell culture, exhibits good biophysical properties including, for example, but not limited to, solubility and temperature stability, and is well suited for screening and affinity maturation in vitro screening systems such as phage display. dabs are biologically active as monomers and, due to their small size and inherent stability, can form (formatted) larger molecules to produce drugs with extended serum half-life or other pharmacological activity. Examples of such techniques are disclosed, for example, in WO9425591 describing antibodies derived from camelid (Camelidae) heavy chain Ig, and US20030130496 describing the isolation of single domain fully human antibodies from phage libraries.

Fv and sFv are the only species with complete binding sites and lack constant regions. They are therefore suitable for reducing non-specific binding in vivo use. The sFv fusion proteins are constructed to produce fusion of effector proteins at either the amino-or carboxy-terminus of the sFv. See, e.g., antibody Engineering, ed. An antibody fragment may also be a "linear antibody", for example, as described in U.S. Pat. No.5,641,870. Such linear antibody fragments may be monospecific or bispecific.

In certain embodiments, the antibodies of the invention are bispecific or multispecific. Bispecific antibodies are antibodies that have binding specificities for at least two different epitopes. Exemplary bispecific antibodies can bind to two different epitopes of a single antigen. Other such antibodies may bind to a first antigen binding site having a binding site for a second antigen. Alternatively, the anti-HIV arm may be combined with an arm on a leukocyte-binding trigger molecule, such as a T cell receptor molecule (e.g., CD 3), or an Fc receptor for IgG (fcγr), such as fcγri (CD 64), fcγrii (CD 32), and fcγriii (CD 16), to concentrate and localize the cellular defense mechanisms to the infected cells. Bispecific antibodies can also be used to localize cytotoxic agents to infected cells. Bispecific antibodies can be prepared as full length antibodies or antibody fragments (e.g., F (ab') 2 bispecific antibodies). For example, WO 96/16673 describes bispecific anti-ErbB 2/anti-FcgammaRIII antibodies and U.S. Pat. No.5,837,234 discloses bispecific anti-ErbB 2/anti-FcgammaRI antibodies. For example, WO98/02463 discloses bispecific anti-ErbB2/Fc alpha antibodies; U.S. Pat. No.5,821,337 discloses bispecific anti-ErbB2/anti-CD3 antibodies. See, e.g., mouquet et al Polyreactivity Increases The Apparent Affinity Of Anti-HIV Antibodies By Heterolation. NATURE.467,591-5 (2010).

Methods for preparing bispecific antibodies are known in the art. Traditional methods of producing full length bispecific antibodies are based on co-expression of two immunoglobulin heavy chain-light chain pairs, wherein the two chains have different specificities (see, e.g., millstein et al, nature,305:537-539 (1983)). Similar methods are disclosed in, for example, WO93/08829, traunecker et al, EMBO J.,10:3655-3659 (1991) and Mouquet et al, polyreactivity Increases The Apparent Affinity Of Anti-HIV Antibodies By Heterolation.NATURE.467, 591-5 (2010).

Alternatively, an antibody variable region having the desired binding specificity (antibody-antigen binding site) is fused to an immunoglobulin constant domain sequence. Fusion to Ig heavy chain constant domains comprises at least part of the hinge, CH2 and CH3 regions. According to some embodiments, the first heavy chain constant region (CH 1) comprising the necessary site for light chain binding is present in at least one of the fusions. The DNA encoding the immunoglobulin heavy chain fusion and, if desired, the immunoglobulin light chain is inserted into a separate expression vector and co-transfected into a suitable host cell. While unequal ratios of the three polypeptide chains used in the construction may provide the optimal yield of the desired bispecific antibody, this approach may provide greater flexibility in adjusting the mutual ratios of the three polypeptide fragments in an embodiment. However, when expressing at least two polypeptide chains in the same ratio may result in high yields or when the ratio has no significant effect on the yield of the desired chain binding, the coding sequences for two or all three polypeptide chains may be inserted into a single expression vector.

Techniques for producing bispecific antibodies from antibody fragments have also been disclosed in the literature. For example, bispecific antibodies can be prepared using chemical ligation. For example, brennan et al Science,229:81 (1985) discloses a method in which intact antibodies are proteolytically cleaved to yield F (ab') 2 fragments. These fragments are reduced in the presence of the dithiol complexing agent sodium arsenite to stabilize the adjacent dithiol and prevent intermolecular disulfide bond formation. The resulting Fab' fragment is then converted to a Thionitrobenzoate (TNB) derivative. One of the Fab ' -TNB derivatives is then reconverted to Fab ' -thiol by reduction with mercaptoethylamine and mixed in equimolar amounts with the other Fab ' -TNB derivatives to form the bispecific antibody. The produced bispecific antibody can be used as a reagent for the selective immobilization of enzymes.

Other modifications of antibodies are also contemplated herein. For example, the antibody may be linked to one of a variety of non-proteinaceous polymers, such as polyethylene glycol, polypropylene glycol, polyalkylene oxide, or a copolymer of polyethylene glycol and polypropylene glycol. Antibodies can also be embedded in prepared microcapsules and used in colloidal drug delivery systems (e.g., liposomes, albumin microspheres, microemulsions, nanoparticles, and nanocapsules) or in large bead emulsions, such as by coacervation techniques or by interfacial polymerization (e.g., hydroxymethyl cellulose or gelatin microcapsules and poly (methyl methacrylate) microcapsules, respectively). Such techniques are disclosed, for example, in Remington's Pharmaceutical Sciences,16th edition,Oslo,A, ed., (1980).

Typically, the antibodies of the invention are recombinantly produced, and the vectors and methods used are well known in the art. Human antibodies can also be produced by in vitro activated B cells (see, e.g., U.S. Pat. nos. 5,567,610 and 5,229,275). Conventional methods used in molecular genetics and genetic engineering in accordance with the present invention are disclosed in current edition Molecular Cloning: A Laboratory Manual (Sambrook et al, 1989,Cold Spring Harbor Laboratory Press); gene Expression Technology (Methods in Enzymology, vol.185, d.goeddel, eds.); "Guide to Protein Purification" in Methods in Enzymology (m.p. deutshr, ed., (1990) Academic Press, inc.); PCR Protocols A Guide to Methods and Applications (Innis et al 1990.Academic Press,San Diego,CA); culture of Animal Cells: A Manual of Basic Technique,2nd Ed (R.I.Freshney.1987.Liss, inc.New York, NY) Gene Transfer and Expression Protocols, pp.109-128,ed.E.J.Murray,The Humana Press Inc, clifton, n.j. Reagents, cloning vectors and kits for genetic manipulation were purchased from commercial suppliers such as BioRad, stratagene, invitrogen, clontech and Sigma-Aldrich Co.

Human antibodies can also be produced in transgenic animals (e.g., mice) that are capable of producing fully composed human antibodies without endogenous immunoglobulin production. For example, it has been disclosed that homozygous deletion of the antibody heavy chain junction region (JH) gene in chimeric and germ-line mutated mice results in complete inhibition of endogenous antibody production. Human germline immunoglobulin genes are transferred into such germline mutated mice to produce human antibodies by antigen challenge. See, e.g., jakobovits et al, proc.Natl. Acad.Sci.USA,90:2551 (1993); jakobovits et al Nature,362:255-258 (1993); bruggemann et al, year in Immuno, 7:33 (1993); U.S. Pat. nos. 5,545,806, 5,569,825, 5,591,669 (all GenPharm); U.S. Pat. No.5,545,807 and WO 97/17852. Such animals may be genetically engineered to produce human antibodies comprising the polypeptides of the invention.

Various techniques for producing antibody fragments have been developed. Typically, these fragments are derived from intact antibodies by proteolytic digestion (see, e.g., morimoto et al, journal of Biochemical and Biophysical Methods24:107-117 (1992) and Brennan et al, science,229:81 (1985)). However, these fragments can now be produced directly by recombinant host cells. Fab, fv and ScFv antibody fragments can all be expressed in and secreted by e.coli, so that large numbers of such fragments can be readily produced. Fab '-SH fragments can be recovered directly from E.coli and chemically coupled to form F (ab') 2 fragments (see, e.g., carter et al, bio/Technology 10:163-167 (1992)). According to another method, the F (AB') 2 fragment may be isolated directly from the recombinant host cell culture. Fab and F (ab') 2 fragments with extended in vivo half-lives are disclosed in U.S. Pat. No.5,869,046, which contain salvage (salvage) receptor binding epitope residues. Other techniques for producing antibody fragments will be apparent to the skilled artisan.

Other techniques for screening antibody fragments from libraries using enrichment techniques are known in the art, including but not limited to: phage display; ribosome display (Hanes and Pluckaphun, 1997, proc. Nat. Acad. Sci.94:4937-4942); bacterial display (Georgiou et al 1997,Nature Biotechnology 15:29-34) and/or yeast display (Kieke et al 1997,Protein Engineering 10:1303-1310), which can be used to screen single chain antibodies instead of the techniques described previously. Single chain antibodies were screened from a pool of single chain antibodies generated directly using the filamentous phage technique. Phage display technology is known in the art (see, e.g., technology derived from Cambridge Antibody Technology (CAT)), which is disclosed in U.S. Pat. nos. 5,565,332;5,733,743;5,871,907;5,872,215;5,885,793;5,962,255;6,140,471;6,225,447;6,291650;6,492,160;6,521,404;6,544,731;6,555,313;6,582,915;6,593,081 and other U.S. patent family members, or applications dependent on priority application GB 9206318 filed on 5/24 1992, are also referred to Vaughn et al 1996,Nature Biotechnology 14:309-314. Single-chain antibodies can also be designed and constructed using known recombinant DNA techniques, such as DNA amplification methods (e.g., PCR) or by using the corresponding hybridoma cDNA as a template.

Variant antibodies are also included within the scope of the invention. Thus, variations of the sequences recited in the application are also included within the scope of the invention. Other variants of antibody sequences having improved affinity may be obtained by using methods known in the art and are also included within the scope of the present invention. For example, amino acid substitutions may be used to obtain antibodies with further improved affinity. Alternatively, codon optimization of the nucleotide sequence can be used to improve the translational efficiency of expression systems in antibody production.

Such variant antibody sequences have 70% or more (e.g., 80%, 85%, 90%, 95%, 97%, 98%, 99% or more) sequence identity to the sequences recited in the application. Such sequence identity is calculated over the full length of the reference sequence (i.e., the sequences recited in the application). The percent identity described herein is by using BLAST version 2.1.3 and using the default parameters [ Blosum 62 matrix ] given by NCBI (national center for Biotechnology information; http:// www.ncbi.nlm.nih.gov/; gap open penalty = 11 and gap extension penalty = 1). For example, the invention provides peptide sequences comprising at least about 5, 10, 15, 20, 30, 40, 50, 75, 100, 150 or more consecutive peptides of one or more sequences disclosed herein and all intermediate length peptides therebetween. The term "intermediate length" as used herein refers to any length intermediate the recited values, such as 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, etc.; 21. 22, 23, etc.; 30. 31, 32, etc.; 50. 51, 52, 53, etc.; 100. 101, 102, 103, etc.; 150. 151, 152, 153, etc.

The present invention provides antibodies, such as but not limited to VRC01 and PG9, which have broad spectrum neutralizing activity in serum, alone or in combination with other antibodies.

According to another embodiment, the present invention provides a method for preparing and administering an HIV antibody composition suitable for administering the antibody composition to a human or non-human primate patient suffering from or at risk of HIV infection in an amount and according to a regimen sufficient to induce a protective immune response against HIV or reduce the HIV virus in a human.

According to another embodiment, the invention provides a vaccine comprising at least one antibody of the invention and a pharmaceutically acceptable carrier. According to one embodiment, the vaccine is a vaccine comprising at least one antibody described herein and a pharmaceutically acceptable carrier. The vaccine may include a plurality of antibodies having the characteristics described herein in any combination and may further include antibodies known in the art to neutralize HIV.

It will be appreciated that the composition may be a single antibody as described herein or a combination of antibodies as described herein, which may be the same or different, for prophylactic or therapeutic treatment of the progression of HIV infection of the various subtypes following vaccination. Such combinations may be screened for the desired immunity. When the antibody is administered to an animal or human, it may be combined with one or more pharmaceutically acceptable carriers, excipients, or adjuvants known to those of ordinary skill in the art. The composition may also include a broad spectrum neutralizing antibody known in the art including, but not limited to, VRC01, PG9, and b12.

Furthermore, for determining the effective level of HIV treatment in patients, in particular, suitable animal models are available and have been widely used to assess the efficacy of various gene therapy protocols against HIV in vivo (Sarver et al, (1993 b), supra). These models include mice, monkeys, and cats. Even though these animals are naturally insensitive to HIV disease, chimeric mouse models (e.g., SCID, bg/nu/xid, NOD/SCID, SCID-hu, immunocompetent SCID-hu, bone marrow ablated BALB/c) with human Peripheral Blood Mononuclear Cells (PBMC), lymph nodes, fetal liver/thymus, or other tissue recombinations can be infected with lentiviral vectors or HIV and serve as models of HIV pathogenesis. Similarly, a Simian Immunodeficiency Virus (SIV)/simian model and a Feline Immunodeficiency Virus (FIV)/cat model may be used. In accordance with the present invention, the pharmaceutical composition may include other drugs and carriers when used in the therapeutic treatment of AIDS. These other drugs may be used in their traditional manner (i.e., as antiviral agents to treat HIV infection). Examples of HIV agents include, but are not limited to, non-nucleoside reverse transcriptase inhibitors, protease inhibitors, entry or fusion inhibitors, and integrase inhibitors.

According to another embodiment, the invention provides an antibody-based pharmaceutical composition comprising an effective amount of an isolated HIV antibody or affinity matured version, which provides a prophylactic or therapeutic treatment option for reducing infection by the HIV virus. The antibody-based pharmaceutical compositions of the invention may be formulated by any number of strategies known In the art (see, e.g., mcGoff and Scher,2000,Solution Formulation of Proteins/Peptides: in McNally, E.J., ed. Protein Formulation and delivery. New York, NY: marcel Dekker; pp.139-158; akers and Defilippis,2000,Peptides and Proteins as Parenteral Solutions.In:Pharmaceutical Formulation Development of Peptides and Proteins.Philadelphia,PA:Talyor and Francis;pp.145-177; akers et al, 2002, pharm. Biotechnol. 14:47-127). Pharmaceutically acceptable compositions suitable for patient administration comprise an effective amount of the antibody in a formulation that retains both biological activity and promotes maximum stability during storage over an acceptable temperature range. The pharmaceutical compositions may also include, depending on the desired formulation, pharmaceutically acceptable diluents, pharmaceutically acceptable carriers and/or pharmaceutically acceptable excipients or such carriers conventionally used in formulating pharmaceutical compositions for administration to animals or humans. The diluent selected should not affect the biological activity of the composition. Examples of such diluents are distilled water, phosphate buffered saline, ringer's solution, dextrose solution, and Hank's solution. The amount of excipient useful in the pharmaceutical compositions or formulations of the present invention is to uniformly disperse the antibody throughout the composition so that it can be a uniformly dispersed amount when delivered to a subject in need thereof. It can be used to dilute the antibody to a concentration that provides the desired beneficial palliative or therapeutic effect while minimizing any adverse side effects that may be caused by too high a concentration. It also has antiseptic effect. Therefore, for antibodies with high physiological activity, more excipients will be used. On the other hand, for any active ingredient exhibiting lower physiological activity, a smaller amount of excipient will be used.

The above-described antibodies and antibody compositions or vaccine compositions comprising at least one antibody described herein or a combination of antibodies described herein may be used for prophylactic and therapeutic treatment of HIV viral infections.

The invention also relates to isolated polypeptides comprising the amino acid sequences of the light and heavy chains listed in table A, B and figures 10A-C; the consensus sequences of the heavy and light chains of SEQ ID NOs 1 and 2; the insertion sequence SEQ ID NO:3 and 4.

In other related embodiments, the invention provides polypeptide variants encoding the amino acid sequences of the HIV antibodies listed in table A, B and fig. 10A-C; the consensus sequences of the heavy and light chains of SEQ ID NOs 1 and 2; the insertion sequence SEQ ID NO:3 and 4. These polypeptide variants have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or more sequence identity as compared to the polypeptide sequences of the invention, as determined by using the methods described herein (e.g., BLAST analysis using standard parameters). Those skilled in the art will recognize that these values may be appropriately adjusted to determine the corresponding identity of the encoded protein by taking into account factors such as amino acid similarity.

The term "polypeptide" is taken in its conventional sense, i.e. the sequence of amino acids. The polypeptide is not limited to one particular length of product. Peptides, oligopeptides and proteins are included within the definition of polypeptide, and these terms may be used interchangeably unless otherwise indicated. This term also includes post-expression modifications of the polypeptide, such as glycosylation, acetylation, phosphorylation, and the like, as well as other modifications known in the art, both naturally occurring and non-naturally occurring. The polypeptide may be a complete protein or a subsequence thereof. A particular polypeptide of interest in the context of the present invention is an amino acid subsequence containing CDRs, VH and VL, and capable of binding to an antigen or HIV-infected cell.

The term "variant" of a polypeptide as used herein is a polypeptide, which is generally different from the polypeptides specifically disclosed herein, having one or more substitutions, deletions, additions and/or insertions. Such variants may be naturally occurring or synthetically produced, e.g., by modification of one or more of the above-described polypeptide sequences of the present invention, and assessment of one or more biological activities of the polypeptides described herein, and/or using any number of techniques well known in the art.

For example, certain amino acids may be substituted for other amino acids in the protein structure without significant loss of binding to other polypeptides (e.g., antigens) or cells. Since the binding capacity and the nature of the protein determine the biological functional activity of the protein, certain amino acid sequence substitutions can be made in the protein sequence and, therefore, the underlying DNA coding sequence, thereby obtaining a protein with similar properties. Thus, it is contemplated that various changes may be made in the peptide sequences of the disclosed compositions or corresponding DNA sequences encoding the peptides without significant loss of their biological utility or activity.

In many cases, polypeptide variants contain one or more conservative substitutions. "conservative substitutions" refer to those in which an amino acid is replaced by another amino acid that has similar properties, such that one skilled in the art of peptide chemistry can expect the secondary structure and hydrophilic (hydropathic) properties of a polypeptide to be substantially unchanged.

Amino acid substitutions are generally based on the relative similarity of amino acid side chain substituents, such as their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary alternatives that take into account the various foregoing features are known to those skilled in the art and include: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

"homology" or "sequence identity" refers to the percentage of residues of a polynucleotide or polypeptide sequence variant that are identical to a non-variant sequence after sequence alignment and introduction of gaps (to obtain the greatest percent homology, if necessary). In particular embodiments, polynucleotide and polypeptide variants have at least about 70%, at least about 75%, at least about 80%, at least about 90%, at least about 95%, at least about 98%, or at least about 99% polynucleotide or polypeptide homology to a polynucleotide or polypeptide described herein.

Such variant polypeptide sequences have 70% or more (i.e., 80%, 85%, 90%, 95%, 97%, 98%, 99% or more) sequence identity to the sequences recited in the application. In other embodiments, the invention provides polypeptide fragments comprising various lengths of contiguous stretches (stretch) of the amino acid sequences disclosed herein. For example, the invention provides peptide sequences comprising at least about 5, 10, 15, 20, 30, 40, 50, 75, 100, 150 or more consecutive peptides of one or more sequences disclosed herein and all intermediate length peptides therebetween.

The invention also includes nucleic acid sequences encoding part or all of the heavy and light chains of the antibodies of the invention, and fragments thereof. Due to the redundancy of the genetic code, variants of these sequences encoding the same amino acid sequence will exist.

The invention also includes isolated nucleotide sequences encoding polypeptides of the heavy and light chains of the HIV antibodies listed in table A, B and fig. 10A-C; the consensus sequences of the heavy and light chains of SEQ ID NOs 1 and 2; the insertion sequence SEQ ID NO:3 and 4.

In other related embodiments, the invention provides polynucleotide variants encoding the peptide sequences of the heavy and light chains of the HIV antibodies listed in table A, B and fig. 10A-C; the consensus sequences of the heavy and light chains of SEQ ID NOs 1 and 2; the insertion sequence SEQ ID NO:3 and 4. These polynucleotide variants have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% or more sequence identity as compared to the polynucleotide sequences of the invention, as determined by using the methods described herein (e.g., BLAST analysis using standard parameters). Those skilled in the art will recognize that these values can be appropriately adjusted to determine the identity of the corresponding protein encoded by the 2 nucleotide sequence by taking into account factors such as codon degeneracy, amino acid similarity, reading frame positioning, and the like.

The terms "nucleic acid" and "polynucleotide" are used interchangeably herein to refer to single-or double-stranded RNA, DNA, or mixed polymers. Polynucleotides may include genomic sequences, extragenomic and plasmid sequences, and smaller engineered gene fragments that are expressed or engineered to express polypeptides.

The term "isolated nucleic acid" is a nucleic acid that is substantially isolated from other genomic DNA sequences that naturally accompany the native sequence, and proteins or complexes such as ribosomes and polymerases. The term includes nucleic acid sequences that are removed from their naturally occurring environment, and includes recombinant or cloned DNA isolates as well as chemically synthesized analogs or analogs that are biosynthesized by heterologous systems. Substantially pure nucleic acids include isolated forms of nucleic acids. Thus, it refers to an initially isolated nucleic acid and does not exclude genes or sequences that are later manually added to the isolated nucleic acid.

The term "variant" of a polynucleotide, as used herein, is a polynucleotide that generally differs from the polynucleotides specifically disclosed herein by one or more substitutions, deletions, additions and/or insertions. Such variants may be naturally occurring or synthetically produced, e.g., by modification of one or more polynucleotide sequences of the present invention and assessment of one or more biological activities of the encoded polypeptide and/or using any number of techniques well known in the art.

Modifications can be made in the polynucleotide structures of the invention and still result in a functional molecule encoding a variant or derivative polypeptide having the desired characteristics. When it is desired to alter the amino acid sequence of a polypeptide to create an equivalent or even improved variant or portion of a polypeptide of the invention, one skilled in the art will typically alter one or more codons of the coding DNA sequence.

In general, polynucleotide variants comprise one or more substitutions, additions, deletions, and/or insertions such that the immunogenic binding properties of the polypeptide encoded by the variant polynucleotide are not substantially reduced relative to the polypeptide encoded by a polynucleotide sequence specifically set forth herein.

In another embodiment, the invention provides polynucleotide fragments comprising sequences of various lengths of contiguous stretches that are identical or complementary to one or more sequences disclosed herein. For example, the invention provides polynucleotides comprising at least about 10, 15, 20, 30, 40, 50, 75, 100, 150, 200, 300, 400, 500 or 1000 or more consecutive nucleotides of one or more sequences disclosed herein and all intermediate lengths therebetween and including any lengths between the recited values, such as 16, 17, 18, 19, etc.; 21. 22, 23, etc.; 30. 31, 32, etc.; 50. 51, 52, 53, etc.; 100. 101, 102, 103, etc.; 150. 151, 152, 153, etc.; and includes all integers between 200-500, 500-1000.

In another embodiment of the invention, there is provided a polynucleotide composition capable of hybridizing under moderate to high stringency conditions to a polynucleotide sequence provided herein or a fragment thereof or a complement thereof. Hybridization techniques are well known in the art of molecular biology. For purposes of illustration, suitable moderately stringent conditions for testing hybridization of polynucleotides of the invention to other polynucleotides include pre-washing in a solution of 5 XSSC, 0.5% SDS, 1.0mM EDTA (pH 8.0); hybridization at 50-60deg.C under 5 XSSC overnight; the sample was washed twice with SSCs of 2X, 0.5X and 0.2X containing 0.1% SDS at 65℃for 20 minutes. Those skilled in the art will appreciate that the stringency of hybridization can be readily manipulated, for example, by varying the salt content of the hybridization solution and/or the temperature at which hybridization is performed. For example, in another embodiment, suitable high stringency hybridization conditions include those described above, except that the hybridization temperature is increased, e.g., to 60-65℃or 65-70 ℃.

In some embodiments, the polypeptide encoded by the polynucleotide variant or fragment has the same binding specificity (i.e., specifically or preferentially binds to the same epitope or HIV strain) as the polypeptide encoded by the native polynucleotide. In some embodiments, the polynucleotides, polynucleotide variants, fragments, and hybrid sequences encode polypeptides having a binding activity level of at least about 50%, at least about 70%, and at least about 90% with the polypeptide sequences specifically listed herein.

The polynucleotides of the invention, or fragments thereof, can be combined with other DNA sequences such as promoters, polyadenylation signals, additional restriction endonuclease sites, multiple cloning sites, other coding fragments, etc., regardless of the length of the coding sequence itself, such that the overall length can vary widely. Almost any length of nucleic acid fragment can be used. For example, illustrative polynucleotide segments have total lengths of about 10000, about 5000, about 3000, about 2000, about 1000, about 500, about 200, about 100, about 50 base pairs, which lengths (also include all intermediate lengths), are included in many embodiments of the invention.

In some embodiments, the polynucleotide sequences provided herein can be used as probes or primers for nucleic acid hybridization, such as PCR primers. Such nucleic acid probes have the ability to specifically hybridize to a target sequence, enabling them to detect the presence or absence of complementary sequences in a given sample. However, the invention also includes other uses, such as the use of sequence information to prepare primers for mutants, or for preparing other genetic constructs. Thus, the nucleic acid fragments of the invention are particularly useful, comprising a sequence region of a contiguous sequence of at least about 15 nucleotides in length, the contiguous sequence having a sequence identical to or complementary to the 15 base-long contiguous sequence disclosed herein. Longer contiguous identical or complementary sequences, such as those (including full length sequences) that are longer (including all intermediate lengths) of about 20, 30, 40, 50, 100, 200, 500, 1000, and all lengths between these values, are also used in some embodiments.

The polynucleotide molecules have a sequence region consisting of a contiguous stretch of nucleotides of about 10-14, 15-20, 30, 50 or even 100-200 nucleotides (also including intermediate lengths) that is identical or complementary to the polynucleotide sequences disclosed herein, particularly in view of their use as hybridization probes, e.g., for Southern and Northern blotting, and/or as primers for e.g., PCR. The total length of the fragment and the size of the complementary stretch (strech) ultimately depend on the intended use or application of the particular nucleic acid fragment. Smaller fragments are generally used in hybridization embodiments, where the length of the contiguous complementary region may vary, such as between about 15 and about 100 nucleotides, although larger contiguous complementary stretches may be used depending on the length of the complementary sequence desired to be detected.

The use of hybridization probes about 15-25 nucleotides long can form double-stranded molecules that are both stable and selective. However, in order to increase the stability and selectivity of the hybrid, and thus the quality and extent of the resulting specific hybrid molecule, molecules having consecutive complementary sequences of more than 12 bases in length may be utilized. Nucleic acid molecules having stretches of 15 to 25 consecutive nucleotides or even longer gene complementarity if desired can be utilized.

Hybridization probes are selected in any portion of any of the sequences disclosed herein. All that is required is to review the sequences or any contiguous portion of sequences listed herein, from about 15-25 nucleotides long up to and including the length of the full length sequence, with the hope that they will be used as probes or primers. The choice of probe and primer sequences is limited by various factors. For example, it may be desirable to select primers from the ends of the entire sequence.

Also included within the scope of the invention are vectors, such as expression vectors, comprising the nucleic acid sequences of the invention. Cells transformed with these vectors are also included within the scope of the invention.

The invention also provides vectors and host cells comprising the nucleic acids of the invention and recombinant techniques for producing the polypeptides of the invention. Vectors of the invention include vectors that can replicate in any type of cell or organism, including, for example, plasmids, phages, cosmids, and mini-chromosomes. In some embodiments, the vector comprising a polynucleotide of the invention is a vector suitable for propagation or replication of the polynucleotide, or a vector suitable for expression of a polypeptide of the invention. Such vectors are known in the art and are commercially available.

"vectors" include shuttle vectors and expression vectors. In general, plasmid constructs also include an origin of replication (e.g., the ColE1 origin of replication) and a selectable marker (e.g., ampicillin or tetracycline resistance) for plasmid replication and selection, respectively, in bacteria. "expression vector" refers to a vector comprising the control sequences or regulatory elements necessary for expression of an antibody of the invention, including antibody fragments, in a bacterial or eukaryotic cell.

The term "cell" as used herein may be any cell, including but not limited to eukaryotic, multicellular species (as opposed to single cell yeast cells), such as but not limited to mammalian cells or human cells. The cells may exist as a single entity or as part of a larger population of cells. Such "larger cell populations" may include, for example, cell cultures (mixed or pure), tissues (e.g., endothelial tissue, epithelial tissue, mucosal tissue, or other tissues), organs (e.g., lung, liver, muscle, and other organs), organ systems (e.g., circulatory system, respiratory system, gastrointestinal system, urinary system, nervous system, skin system, or other organ systems), or organisms (e.g., birds, mammals, etc.).

The polynucleotides of the invention may be wholly or partially synthesized and then combined and inserted into vectors using conventional molecular and cellular biological techniques including, for example, subcloning the polynucleotides into linearized vectors using appropriate restriction sites and restriction enzymes. The polynucleotides of the invention are amplified by polymerase chain reaction using oligonucleotide primers complementary to each strand of the polynucleotide. These primers also include restriction sites to facilitate subcloning into the vector. Replicable carrier members generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more markers or a selection gene.

For expression of the polypeptides of the invention, the nucleotide sequences encoding the polypeptides or functional equivalents thereof may be inserted into a suitable expression vector, i.e.a vector containing the elements necessary for transcription and translation of the inserted coding sequence. Methods well known to those skilled in the art can be used to construct expression vectors containing sequences encoding the polypeptide of interest and appropriate transcriptional and translational control elements. These methods include recombinant DNA technology in vitro, synthetic technology, and genetic recombination in vivo. Such techniques are described, for example, in Sambrook, j et al, (1989) Molecular Cloning, A Laboratory Manual, cold Spring Harbor Press, planview, n.y. and Ausubel, f.m. et al, (1989) Current Protocols in Molecular Biology, john Wiley & Sons, new york.n.y.

The invention also provides kits for diagnostic and prognostic assays using the antibodies, polypeptides and nucleic acids of the invention. Kits of the invention comprise suitable containers containing the HIV antibodies, polypeptides or nucleic acids of the invention, in labeled or unlabeled form. In addition, when antibodies, polypeptides or nucleic acids are used in an indirect binding assay in a labeled form suitable for performing an indirect assay, the kit also includes reagents for performing the suitable indirect assay. For example, depending on the nature of the label, the kit may include one or more suitable containers containing the enzyme substrate or derivatizing reagent. Control samples and/or instructions for use may also be included. The invention also provides a kit for detecting the presence or absence of an HIV antibody or nucleic acid sequence of an HIV antibody of the invention in a biological sample by PCR or mass spectrometry.

As used herein, a "tag" (label) refers to a detectable compound or composition that is directly or indirectly attached to an antibody so as to produce a "labeled" antibody. Tags may also be attached to polypeptides and/or nucleic acid sequences disclosed herein. The tag may be detectable by itself (e.g., radioisotope labels or fluorescent labels), or in the case of an enzyme tag, may catalyze chemical alteration of a substrate compound or composition which is detectable. Antibodies and polypeptides of the invention may also be modified to include epitope tags (tags) or labels, for example, for purification or diagnostic applications. Suitable detection means include the use of labels such as, but not limited to, radionucleotides, enzymes, coenzymes, fluorescent agents, chemiluminescent agents, chromogens, enzyme substrates or cofactors, enzyme inhibitors, prosthetic compounds, free radicals, particles, dyes, and the like.

According to another embodiment, the present invention provides a diagnostic method. Diagnostic methods generally involve contacting an HIV antibody with a biological sample obtained from a patient, such as blood, serum, saliva, urine, sputum, a cell swab sample, or a tissue biopsy, and determining whether the antibody preferentially binds to the sample as compared to a control sample or a predetermined threshold, thereby proving the presence or absence of HIV virus.

According to another embodiment, the invention provides a method of detecting the presence or absence of an HIV antibody of the invention in a biological sample from a patient. The detection method generally comprises obtaining a biological sample, such as a blood, serum, saliva, urine, sputum, cell swab sample or tissue biopsy, from a patient and isolating the HIV antibody or fragment thereof, or nucleic acid encoding the HIV antibody, and analyzing the biological sample for the presence of the HIV antibody. Furthermore, the present invention provides a method for detecting the nucleotide sequence of an HIV antibody in a cell. The nucleotide sequence of an HIV antibody can also be detected by using the primers disclosed herein. Known recombinant techniques and/or mass spectrometry can also be used to determine whether HIV antibodies are present in a biological sample from a patient.

In another embodiment, the invention provides a method for detecting an HIV antibody in a biological sample, wherein the HIV antibody comprises a heavy chain comprising a highly conserved consensus sequence and a light chain comprising a highly conserved consensus sequence, the method comprising obtaining an immunoglobulin-containing biological sample from a mammalian subject, isolating the HIV antibody from the sample, and identifying the highly conserved consensus sequences of the heavy and light chains. The biological sample may be blood, serum, saliva, urine, sputum, a cell swab sample or a tissue biopsy. The amino acid sequence may be determined by methods known in the art including, for example, PCR and mass spectrometry.

The term "evaluating" includes any form of measurement and includes determining whether an element (elements) is present. The terms "determining," "measuring," "evaluating," "assessing," and "analyzing" are used interchangeably and include quantitative and qualitative determinations. The evaluation may be relative or absolute. "assessing whether there is" includes determining the amount of something present, and/or determining the presence or absence. The terms "assay," "measuring," and "assessing" and "analyzing" are used interchangeably herein and include quantitative and qualitative assays.

Methods for reducing viral replication

Further provided are methods for reducing HIV viral titer, viral replication, viral proliferation, or increased amount of HIV viral protein in a subject. According to another aspect, a method comprises administering to a subject an amount of an HIV antibody effective to reduce HIV titer, viral replication, or increased amount of HIV protein of one or more HIV strains or isolates in the subject.

According to another embodiment, the invention provides a method of reducing viral replication or reducing transmission of HIV infection to other host cells or tissues comprising contacting mammalian cells with an antibody or portion thereof that binds to an epitope of gp 120.

III methods of treatment

According to another embodiment, the present invention provides a method for treating a mammal having a viral infection, such as HIV, comprising administering to said mammal a pharmaceutical composition comprising an HIV antibody disclosed herein. According to one embodiment, a method for treating a mammal infected with HIV comprises administering to the mammal a pharmaceutical composition comprising an antibody or fragment thereof of the present invention. The compositions of the invention may include more than one antibody (e.g., multiple antibodies or a population of antibodies) having the disclosed characteristics. It may also include other HIV neutralizing antibodies known in the art such as, but not limited to, VRC01, PG9, and b12.

Passive immunization has proven to be an effective and safe strategy for the prevention and treatment of viral diseases. (see, e.g., keller et al, clin. Microbiol. Rev.13:602-14 (2000); casadevall, nat. Biotechnol.20:114 (2002); shibata et al, nat. Med.5:204-10 (1999); and Igarashi et al, nat. Med.5:211-16 (1999), each of which is incorporated herein by reference). Passive immunization with human monoclonal antibodies provides an immediate therapeutic strategy for the urgent prevention and treatment of HIV.

Subjects at risk of infection with an HIV-associated disease or disorder include patients in contact with an infected person or who are exposed to HIV by some other route. The prophylactic agent may be administered before the occurrence of a symptom characteristic of an HIV-associated disease or disorder, to prevent the disease or disorder, or to delay its progression.

For the in vivo treatment of human and non-human patients, a pharmaceutical formulation comprising an HIV antibody of the present invention is administered or provided to the patient. When used in vivo treatment, a therapeutically effective amount (i.e., a dose that eliminates or reduces viral load in a patient) of an antibody of the invention is administered to the patient. Antibodies are administered to a human patient in a known manner, for example by intramuscular, intraperitoneal, intracerebroventricular, subcutaneous, intra-articular, intrasynovial, intrathecal, oral, topical or inhalation routes, by intravenous administration such as bolus injection or continuous infusion over a period of time. The antibodies may be administered parenterally or intravenously, if possible, at the target cell site. In some embodiments, the antibody is administered by intravenous or subcutaneous administration. The therapeutic compositions of the invention may be administered to a patient or subject systemically, parenterally or topically. The parameters above for assessing successful disease treatment and improvement can be readily measured by routine procedures familiar to physicians.

For parenteral administration, antibodies may be formulated in unit dosage injectable forms (solutions, suspensions, emulsions) with pharmaceutically acceptable parenteral media. Examples of such media include, but are not limited to, water, saline, ringer's solution, dextrose solution, and 5% human serum albumin. Nonaqueous media include, but are not limited to, fixed oils and ethyl oleate. Liposomes can be used as carriers (carriers). The medium may contain minor amounts of additives such as substances that enhance isotonicity and chemical stability, such as buffers and preservatives. Antibodies may be formulated in such media at a concentration of about 1mg/ml to 10 mg/ml.

The dosage and dosage regimen will depend on a variety of factors that can be readily determined by the physician, such as the nature of the infection, its therapeutic index, the patient and the patient's medical history. Typically, a therapeutically effective amount of the antibody is administered to a patient. In some embodiments, the amount of antibody administered is in the range of about 0.1mg/kg to about 50mg/kg, based on the weight of the patient. Depending on the type and severity of the infection, administration of about 0.1mg/kg to about 50mg/kg (e.g., about 0.1-15 mg/kg/dose) of antibody to the patient, whether administered, for example, by one or more separate administrations or by continuous infusion, is the initial candidate dose. The progress of such therapy can be readily monitored by conventional methods and analysis and based on criteria known to the physician or other person skilled in the art. The above parameters for assessing successful treatment and improvement of a disease can be readily measured by routine procedures familiar to physicians.

Other therapeutic regimens may be combined with the administration of an HIV antibody of the present invention. Combination administration includes co-administration, use of separate formulations or single pharmaceutical formulations, and sequential administration in any order, wherein it is preferred that both (or all) active agents exert their biological activity simultaneously for a period of time. Such combination therapy may result in a synergistic therapeutic effect. The above parameters for assessing successful treatment and improvement of a disease can be readily measured by routine procedures familiar to physicians.

The terms "treatment" or "alleviation" are used interchangeably and refer to both therapeutic treatment and prophylactic or preventative measures, wherein the object is to prevent or slow down (lessen) the pathological condition or disorder being addressed. Those in need of treatment include those already with the disorder or those prone to develop the disorder or those in which the disorder needs to be prevented. If, after receiving a therapeutic amount of antibody according to the methods of the invention, the patient exhibits an observable and/or measurable decrease or disappearance of one or more of the following: infected cells decrease or infected cells disappear; the percentage of infected cells to total cells is reduced; and/or one or more symptoms associated with a particular infection are alleviated to some extent; morbidity and mortality, and quality of life problems are ameliorated, the infection of the subject or mammal is successfully "treated". The above parameters for assessing successful treatment and improvement of a disease can be readily measured by routine procedures familiar to physicians.

The term "therapeutically effective amount" refers to an amount of an antibody or drug effective to treat a disease or disorder in a subject or mammal.

Administration "in combination" with one or more other therapeutic agents includes simultaneous (concurrent) and sequential administration in any order.

As used herein, a "carrier" includes a pharmaceutically acceptable carrier, excipient, or stabilizer that is non-toxic to the cells or mammals to which it is exposed at the dosages and concentrations employed. Typically, the physiologically acceptable carrier is an aqueous pH buffered solution. Examples of physiologically acceptable carriers include, but are not limited to, buffers such as phosphates, citrates and other organic acids; antioxidants, including but not limited to ascorbic acid; a low molecular weight (less than about 10 residues) polypeptide; proteins such as, but not limited to, serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as, but not limited to, polyvinylpyrrolidone; amino acids such as, but not limited to, glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including, but not limited to, glucose, mannose, or dextrins; chelating agents such as, but not limited to, EDTA; sugar alcohols such as, but not limited to, mannitol or sorbitol; salt-forming counterions such as, but not limited to, sodium; and/or nonionic surfactants such as, but not limited to, tween; polyethylene glycol (PEG) and Pluronic (PLURONICS).

Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the preferred methods and materials are now disclosed. All publications mentioned herein are incorporated by reference in their entirety.

As used herein and in the claims, the singular forms "a", "and" the "include plural referents unless the context clearly dictates otherwise.

The publications disclosed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such publication by virtue of prior invention. In addition, the dates provided in the publications may be different from the actual publication dates, which may need to be independently confirmed.

Each of the applications and patents cited herein, as well as each of the documents or references cited in each application and patent, the documents of patients or non-patients (including in each patented patent prosecution; "documents cited in the application"), and each of the PCT and foreign applications or patents corresponding to any of these applications and patents and/or claiming priority from any of these applications and patents, and each of the documents cited or referenced in each application, are expressly incorporated herein in their entirety by reference. More generally, the documents or references cited herein are presented either in the list of references preceding the claims or in the text itself; also, each such document or reference ("the references cited herein"), as well as each document or reference cited in each reference cited herein (including any manufacturer's specifications, instructions, etc.), is expressly incorporated herein by reference.

The following non-limiting examples serve to further illustrate the invention.

Example 1

Materials, methods and apparatus

And (3) a sample. Human samples were collected by all participating institutions after signing informed consent according to the protocol assessed by the ethical review board (Institutional Review Board, IRB). Patient 1 was selected from a group of long-term non-progressors from New York Allen Dai Meng AIDS research center (Aaron Diamod Aids Research Center). Patients 3 and 8 were selected from a group of elite controllers at boston radicle Institute (Ragon Institute). Patients 1, 3 and 8 were selected based on their broad spectrum neutralizing serum activity on the standard group of HIV isolates. Patient 12 was selected from protocol G cohort (Protocol G Cohort) of the international aids vaccine initiative (International Aids Vaccine Initiative) based on broad spectrum serum neutralization activity.

Staining, single cell sorting, and antibody cloning. Staining and single cell sorting of 2CC nuclear and gp140 specific ig+ memory B cells were performed (j.f.scheid et al, nature 458,636 (Apr 2,2009)). Briefly, CD19+ B cells were enriched from peripheral blood mononuclear cells with anti-human CD19 magnetic MACS beads (Miltenyi Biotec) and subsequently stained with anti-human CD20 and anti-human IgG antibodies (Becton Dickinson) and biotinylated 2CC nuclei (B.Dey et al, PLoS Pathog 5, e1000445 (May, 2009)) or YU2-gp140 trimer (R.Diskin, P.M.Marcovecchio, P.J.Bjorkman, nat Struct Mol Biol 17,608 (May, 2010)) and then detected with streptavidin-conjugated phycoerythrin (PE, beckton Dickinson). Single cells were sorted on a FACSaria III cell sorter (Becton Dickinson) into 96-well PCR plates (Denville) containing 4. Mu.l/well ice-cold 0.5 Xphosphate buffered saline (PBS) containing 10mM DTT, 8U, excluding cell doublets (Promega)、0.4U 5′-3′Prime RNAse Inhibitor ^TM (Eppendorf). For plates->The `F` membrane (BioRad) was sealed, immediately frozen in dry ice and stored at-80 ℃.

Both cDNA synthesis and Ig amplification were performed in the following modified manner (H.Wardemann et al, science 301,1374 (Sep 5,2003)):

instead of using the original primer set, the first and second immunoglobulin-specific PCR were performed in a semi-nested approach using the primers described in table 1. The heavy and light chain PCR products were cloned into their respective expression vectors and the cloned expression plasmid with the original PCR product was determined to have 100% identity by sequencing prior to expression of the antibody in HEK 293 cells.

ELISA. Highly binding 96-well ELISA plates (Costar) were purified with 100 ng/well antigen (gp 140, gp120, gp41, gp 120) in PBS ^Nuclear And 2 CC-core) (B.Dey et al, PLoS Pathog 5, e1000445 (month 5 2009)) and muteins (gp 120D368R, gp I420R) were coated overnight. After washing, the plates were blocked with 2% BSA, 1. Mu.M EDTA, 0.05% Tween-PBS (blocking buffer) for 2 hours and incubated with IgG antibodies diluted to 4. Mu.g/ml and several consecutive 1:4PBS dilution antibodies for 2 hours. After washing, the plates were incubated with goat HRP-conjugated anti-mouse IgG (Jackson ImmunoReseach) (0.8 μg/ml in blocking buffer) and 100 μl of HRP chromogenic substrate (ABTS solution, invitrogen) for 1h for development. Optical Density at 405nm (OD) using ELISA plate reader (Molecular Devices) _405nm ) Measurements were made. The background value obtained by incubation with PBS alone in coated wells was subtracted. IgG antibodies were tested for multiple reactivity (h.mouquet et al, nature 467,591 (Sep 30,2010)) and when they recognized four structurally distinct antigens tested: ssDNA, dsDNA, insulin, and LPS are considered to be multi-reactive. The threshold for reactivity was determined by using control antibodies mGO (negative), eiJB40 (weak positive) and ED38 (high positive).

Neutralization analysis: neutralization screening was performed (d.c. montefiori Curr Protoc Immunol Chapter, unit 12 11 (Jan, 2005)). Briefly, neutralization was detected as a decrease in luciferase reporter gene expression after a single round of infection of Tzm-bl cells. To exclude non-specific antiviral activity in antibody samples, muLV (murine leukemia virus) was used as a negative control.

Clone-specific recognition of bone marrow plasma cells. After purification of monocytes from bone marrow aspirate Ficoll with Ficoll-Paque (GE Healthcare), bone marrow plasma cells were stained with anti-human CD138 and anti-CD 19 antibodies (Becton Dickinson). Cd138+cd19+ human plasma cells were mass-sorted on a FACSAria III cell sorter (Becton Dickinson) and RNA isolated on 100.000 cells with Trizol LS reagent (Invitrogen) with reference to manufacturer's instructions. RNA was reverse transcribed using Superscript III reverse transcriptase (Invitrogen) with reference to the manufacturer's instructions. The cDNA was subjected to immunoglobulin specific PCR with the following modifications: 1 μl of cDNA was amplified with 2 rounds of nested immunoglobulin heavy chain clone-specific PCR and using the first round of forward leader (forward leader) and constant region reverse primers listed in Table 1, followed by clone-specific forward and reverse primers designed based on sequencing results obtained from single cell analysis. The PCR products were gel purified and cloned into TOPO TA vector (Invitrogen) according to the manufacturer's instructions. Colonies were screened by PCR with clone-specific primers and sequenced.

Surface plasmon resonance. As with the previously disclosed method (mouque 2010), all experiments were performed at 25 ℃ in HBS-ep+ running buffer (Biacore, inc) using Biacore T100 (Biacore, inc). 12.5 μg/mL of YU-2gp140 and 2CC nucleoprotein were immobilized on CM5 chip (Biacore, inc) by amino coupling at pH 4.5, yielding an immobilization level of 100 RU. For kinetic measurements of gp 140-and 2CC core-derived chips, igG was injected at a concentration of 700nM through a flow cell (flow cell) and 4 consecutive 1:2 dilutions in HBS-EP+ running buffer (Biacore, inc) at a flow rate of 40. Mu.L/min with 3min correlation and 5min dissociation. The sensor surface was regenerated with 30 seconds of injection of 10mM glycine-HCl, pH 2.5, at a flow rate of 50. Mu.L/min between each experiment. Dissociation rate (k) _d (s ^-1 ) Rate of binding (k) _a (M ^-1 s ^-1 ) And binding constant (K) _D (M) or K _A (M ^-1 ) After subtraction of the background (binding to control flow cell and signal of HBS-ep+ running buffer), calculations were performed using kinetic analysis and 1:1 binding model by using Biacore T100 evaluation software. The sensor patterns shown in FIGS. 2 and 8 are obtained by processing Biac with the Scubber 2 software (Center for Biomolecular Interaction Analysis, university of Utah) ore data were obtained.

CD4i site induction. By Fugene ^TM 6 (Roche) gp160 in the construct of pMX-IRES-GFP was used in a 1:2 plasmid to Fugene ratio ^BAL.26 Δc or gp160 ^YU.2 Delta c was transfected into 293T cells. After 48 hours, 293T cells were washed with PBS and isolated with trypsin-free cell dissociation buffer (Gibco) and treated with 10 ⁷ The cells/ml concentration was resuspended in FACS buffer (1 XPBS, 2% FBS, 2mM EDTA). sCD4 (Progenics Pharmaceuticals, inc) and mAb were added to gp160 expressing 293T cells in a 1:4 dilution series starting at a final concentration of 40 μg/ml. mGO is a negative control antibody that does not bind to gp160 Δc (h.mouquet et al, nature 467,591 (9/30/2010)). After 15min incubation on ice, cells were separated and either induced on ice with Alexa 647-labeled CD4 site mAb (3-67; (J. F. Scheid et al, nature 458,636 (2 nd day of 2009)) or Alexa 647-labeled control mAb (i.e. PG16; L. M. Walker et al, science 326,285 (9 th month of 2009)) or against gp160 ^YU.2 2G12 and against gp160 ^BAL.26 2G 12) for 25 minutes. By using Alexa647 micro protein labelling kit (Invitrogen) for antibody labelling. Cells were analyzed on a LSRFortessa cell analyzer (BD Bioscience).

And (5) crystallizing. Preparation of Fab fragments by transient expression of 3BNC60IgG in HEK 293-6E cells and cleavage by papain (R.Diskin, P.M.Marcovecchio, P.J.Bjorkman, nat Struct Mol Biol 17,608 (month 5 2010.) crystallization screening was performed by the nL sitting drop (sitting drop) method by vapor diffusion at 20 ℃ and using the Mosquito ^TM (TTP LabTech) crystallization robot on MRC crystallization plate (Jena Bioscience). 3BNC60Fab at a concentration of 9.5mg/ml was mixed with stock solution (reservoir solution) at a ratio of 1:1 to produce 400nL droplets. With PEGRx HT ^TM (Hampton Research) crystallization screening an initial crystallization point (Initial crystallization hits) was obtained and further optimized manually. Crystals suitable for data collection were at 11.7% polyethylene glycol 20000, 0.1M sodium acetate pH 5.0, 100mM potassium/sodium tartrateMonoclinic space group P2 of 2 Fab having asymmetric units in 20mM lithium sulfate, 10mM N-cyclohexyl-2-aminoethanesulfonic acid (CHES) pH 9.5 ₁ Is grown for several weeks. The crystals were immersed in a 15% glycerol-supplemented stock for 2 hours, and then immersed in a 30% glycerol-supplemented stock and flash cooled in liquid nitrogen. Diffraction data were collected using a pitantus 6M detector with a stent synchrotron radiation source (Stanford Synchrotron Radiation Lightsource, SSRL) beam line 12-2 at 100K. The data were indexed, integrated and measured using XDS w.kabsch, acta Crystallogr D Biol Crystallogr 66,125 (Feb, 2010) (table 8). Molecular replacement by using a phase shifter with V from the anti-tumor antibody CTM01 (PDB code 1AD 9) _H And C _H 1 domain and V from an anti-gp 120b13 antibody (PDB code 3 IDX) _L And C _L The domain is performed as a search model. Repeated use of Phenix P.Emsley, B.Lohkamp, W.G.Scott, K.Cowtan, acta Crystallogr D Biol Crystallogr 66,486 (month 4 2010) and Coot (P.Emsley, B.Lohkamp, W.G.Scott, K.Cowtan, acta Crystallogr D Biol Crystallogr 66,486 (month 4 2010)) for model construction and refinementIs a single-layer structure. The structure was improved using a maximum likelihood objective function (maximum-likelihood target function) and an amorphous symmetry constraint (non-crystallogaphic symmetry restraints). Final model (R) _{Work of} ＝20.7％；R _{Free of} =25.7%) included 6478 protein atoms, 146 water molecules and 28 glycogen atoms (table 8). Residues (residues) of 91.9%, 7.6% and 0.5% are located in the favored, allowed and forbidden regions of the Lawster diagram (Ramachandran plot), respectively. Structural analysis and visualization were performed using PyMol (The PyMOL Molecular Graphics System, version 1.3, < >>LLC). The 3BNC60 structure consists of residues 3-205 for the light chain (including the first N-acetylglucosamine in the N-linked carbohydrate linked to Asn 72) and 2-217 for the heavy chain. At the terminal residueResidues of radicals and C _H Residues 133-140 of the 1 domain are disordered.

And (5) mass spectrometry. IgG was purified from serum using ProteinG Sepharose (GE Healthcare) according to manufacturer's instructions. The IgG was then digested with immobilized papain (Pierce) and the digested Fab-Fc fragment mixture was incubated with a saturated amount of biotinylated 2 CC-nucleoprotein. After 15 min incubation at room temperature, streptavidin-coupled magnetic beads (Dynabeads) (Invitrogen) were added and 10 rounds of washing were performed with phosphate buffered saline (Gibco). The bound Fab fragments were eluted with lithium dodecyl sulfate buffer (Invitrogen) at 95C, and samples were determined for purity by SDS-polyacrylamide gel electrophoresis, silver or coomassie staining prior to mass spectrometry.

Isolated Fab fragments were reduced with dithiothreitol, alkylated with iodoacetamide, resolved by 1D gel electrophoresis on a 4-12% NuPAGE Novex Bis-Tris gel (Invitrogen) and stained with Coomassie blue (Thermo Fisher). Fab fragments were excised from the gel and digested with 200ng trypsin (Promega). The resulting peptide was isolated with reverse phase resin (PORS 20R2,Applied Biosystem) and eluted with an aliquot of 40% acetonitrile in 0.5% acetic acid and a second aliquot of 80% acetonitrile in 0.5% acetic acid. Acetonitrile was removed with a vacuum centrifuge (speedvac, thermo Fisher Scientific) and an aliquot of the remaining solution was loaded under pressure onto a self-loading with an integrated emitter tip (tip) (360 μm o.d.,50 μm i.d.,10 μm tip) On a column (New Objective, woburn, mass.) 6cm of reversed phase C18 material (ReproSil-Pur C18-AQ,3 μm beads from Dr. Maisch GmbH) was loaded and connected to a micro-electro-spray source with LTQ Orbitrap ^TM XL mass spectrometer or LTQ Orbitrap Velos ^TM Agilent 1200 series HPLC system (Agilent) of mass spectrometer (Thermo Fisher Scientific). The peptides were eluted to the mass spectrometer by the following gradient: 5min 0-5% B,125min 40% B,150min 60% B,165min 100% B (a=0.1M acetic acid, b=70% acetonitrile in 0.1M acetic acid, flow rate 90 nL/min). Both instruments operate in a data dependent mode and pairIn both mass spectrometers, the target value was set at 5e5 ions and the resolution was 60000 (at 400 m/z). In order to use LTQ Orbitrap ^TM XL, after the full scan, 8MS/MS scans were performed on the 8 most abundant ions in this full scan. Peptides (charge-only state)>1) Separation was performed by a 2Da window, a target window for 1e4 ions, and by mass analysis in CAD (normalized collision energy=35, activation q=0.25, activation time 30 msec) and LTQ. In order to use LTQ Orbitrap ^TM Analysis was performed on Velos, after which 10MS/MS scans were performed at 7500 resolution for the 10 most abundant ions in the full scan. Peptides (charge-only state) >2) Separation was performed by 3Da window, target window of 2e5 ions, by mass analysis in HCD (normalized collision energy=40, activation time 0.100 msec) and Orbitrap. For any instrument, the ions selected for MS/MS were set on the exclusion list for 30 seconds. The resulting MS/MS spectrum was recorded using an Xtandem-! Retrieval of human IPI and internal (in house) patient-specific IgG databases peptides were automatically compared to tryptic peptides in the human IPI and internal patient-specific databases. The peptide hits (hit) corresponding to patient-specific IgG were confirmed manually.

Multiple sequence alignment. All multiple sequence alignments were performed using the default parameters with CLUSTAL W2 (weight matrix: ginnet for protein and UIB for DNA, gap open = 10, gap extension 0.1). A contrasting shadow is generated with the texshadow software package (Alignments shading).

Alignment of the consensus region. Multiple aligned consensus sequences were generated based on identity and similarity between residues (> = 70%). Amino acids were grouped based on similarity as follows: FYW, ILVM, RK, DE, GA, ST and NQ.

Phylogenetic tree. The relationship between the sequences was generated by the Neighbor-Joining method. A self-expanding common tree (bootstrap consensus tree) inferred from 1000 replicates was employed to represent its relationship. Branches corresponding to partitions generated with less than 50% self-expanding repetition are truncated. Wherein the percentage of the repeat tree in the self-expanding test (1000 repeats) is shown on the side branches. The tree is drawn to scale with the units of branch lengths being the same as the units used to infer the evolutionary distance of the phylogenetic tree. The evolutionary distance in units of the number of amino acid differences per sequence was calculated using a number of different methods. All ambiguous locations for each sequence pair are removed. The evolution analysis was performed in MEGA 5.

And (3) calculating the R/S ratio. The DNA sequences were superimposed on the protein alignment for substitution/replacement calculations. All notch positions were removed from the analysis. R/S ratio analysis was performed using Perl script.

Example 2

Isolation of HIV antibodies

To determine if HIV antibody clones were restricted by somatic mutation, a series of new primers were designed to remove this potential problem (table 1). The new primer set was assayed by sorting B cells that bind HIV-gp120 nucleoprotein (2 CC nucleus) lacking a V1-3 loop and containing a pair of stable disulfide bonds. In contrast to the reoccurring baits (re-surfaced baits) used for cloning VRC01, 2CC nuclear baits also allow the capture of antibodies to the CD 4-induced co-receptor binding site (CD 4 i).

In comparison together, the new primer set increases recovery of IgH chains when compared to the original primer set (FIG. 4 (a)). The antibodies obtained with the new primer set had more mutations (average 35.6 to 19.8 p= <0.0001 and maximum 85 to 50 for IgH) and contained clones not found with the original primer set (fig. 4 (a)). To determine if new primers can rescue (rescue) VRC 01-like antibodies from cells that have been sorted with YU2gp140, frozen cDNA samples from individuals who have been fully examined with the original primer set without producing any VRC 01-related clones were examined. Of the 80 wells, 3 antibodies corresponding to VRC01 variants determined by IgH and IgL sequences were found (fig. 5A and B). The conclusion was that VRC 01-like antibodies were captured by gp140 trimer and that this primer, specifically designed to clone highly mutated antibodies, captured a greater proportion of anti-HIV antibodies derived from memory B cells of patients with high titer broad spectrum neutralizing antibodies.

Four unrelated HIV-infected individuals showing high titers of broad-spectrum neutralizing antibodies, including 2 caucasians, 1 spanish and 1 African donor, were treated with 2CC core baits were examined, where 2 individuals were not able to interpret their serological activity with previously cloned antibodies (table 2 and fig. 6A and B). 576 antibodies representing 201 different unique and diverse clones were raised from 1.5X10 ⁵ IgG of (2) ⁺ Initial population obtained from memory B cells (table 3).

Example 3

Binding specificity of HIV antibodies

Antibody clones captured by 2CC nuclear baits varied widely in size, ranging from 2-76 different members (table 3). To determine whether antibodies captured by the 2CC core could bind to HIV spikes, ELISA was performed on representative members of each amplified clone using YU2gp 120. All test antibodies bound to gp120 (table 3).

The binding sites of antibodies to HIV spikes were located using muteins that interfered with either the CD4bs (gp 120 (D368R)) or the CD 4-induced co-receptor binding sites (CD 4I, gp120 (I420R)). As reported by x.wu et al, science329,856 (13, 8, 2010), VRC01 was listed as a CD4bs antibody because it is sensitive to the D368R mutation, but it also showed some sensitivity to the I420R mutation because of the proximity to the CD4I site. The ELISA patterns of antibodies 3BNC60, 8ANC131 and 12A12, belonging to NIH45-46 of VRC01 variant, were similar to VRC01 (selection of these clone members based on neutralization activity, table 3). Other clones, including 1B2530 and 8ANC195, were equally sensitive to both mutations and could not be precisely classified based on ELISA alone.

To determine if the antibodies were multi-reactive, ELISA was performed on purified ssDNA, dsDNA, insulin and LPS. 63% of the anti-2 CC nuclear antibodies detected were multi-reactive. It was concluded that most antibodies captured by 2 CC-baits recognize the CD4bs or CD4i sites on gp120 and many are also multi-reactive.

Example 4

Somatic hypermutation

Somatic hypermutation is required to develop high affinity antigens that bind anti-HIV antibodies and in some cases contribute to the multi-reactivity of anti-HIV antibodies. To test whether the highly mutated 2CC core-specific antibodies were so, 4 representative antibodies were reversed into the corresponding germline. Reversion resulted in complete loss of antigen binding and loss of polyreactivity for all 4 clones tested in ELISA.

Example 5

Neutralization of HIV

HIV neutralization activity was measured by standard in vitro assays with an initial set of 8 viruses, where 8 viruses included 3 layer 1 clades A, B and C, and 5 layer 2 clade B Env pseudovirus variants (m.s. seaman et al, J Virol 84,1439 (month 2 2010)). The neutralizing activity of the antibodies was compared to VRC01 and purified serum IgG from the donor (fig. 1A, table 4 and fig. 6). Antibodies exhibiting high levels of neutralizing activity were further tested on a set of 15 other layer 2 clade A, B, C, D, G, AG and AE Env pseudovirus variants (fig. 1B, table 5), including 5 VRC01 resistant viruses (fig. 1B and table 5).

90% of all antibodies tested showed some neutralizing activity and 6 clones contained antibody variants that showed high levels of potency and breadth (fig. 1A, B and C and tables 4 and 5). These clones were also the most abundant of those antibodies captured by 2 CC-baits in each of the four patients studied (table 3). The most impressive novel antibody 3BNC117 belongs to a clone with 76 members, which shows an average IC of 0.5 μg/ml for the 14 layer 2 virus combined group compared to 1.8 μg/ml for VRC01 ₈₀ (FIG. 1C, tables 4 and 5).

Only 4 of the 20 viruses tested were more sensitive to VRC01 than 3BNC117, whereas 14 were more sensitive to 3BNC117, including DU172.17, which was fully resistant to VRC01 but sensitive to 3BNC117 (fig. 1B and C). NIH45-46 is a new variant of VRC01 that is more potent than VRC01 for 15 out of 20 viruses tested, but still less potent than 3BNC117 (fig. 1B and C and tables 4 and 5).

The breadth and potency of neutralization vary substantially among the 5 most potent neutralizing antibody clone members. For example, 3BNC156 is a variant of 3BNC117, only neutralizing 2 of the original group viruses and required at a much higher concentration than 3BNC117 (FIG. 1A and Table 4), and 3BNC55 is another variant with an activity against 6 viruses of between 2, average IC ₅₀ 4. Mu.g/ml (FIG. 1 and Table 4).Finally, the most active antibodies are highly hypermutated. Average number of mutations for the first 10 antibodies versus V _H Is 72 and for V _L 45, which is related to their breadth and efficacy (tables 4 and 5). Reversing the mutated residues to germline resulted in complete loss of neutralizing activity for all antibodies tested.

Example 6

Identification of diagnostic peptides

The cloning strategy described above captures antibodies produced by antigen-binding memory B cells, whereas circulating antibodies are not produced by these cells but originate from plasma cells in the bone marrow. However, due to the lack of expression of surface Ig a, homologous antigens cannot be used as baits to capture plasma cells. (radburuch et al, nat Rev Immunol 6,741 (Oct, 2006)). Furthermore, the relationship between plasma cells and circulating memory B cells in bone marrow has not been precisely defined. To determine if antibodies cloned from memory B cells are also found in the bone marrow plasma cell compartment, CD138 expressing plasma cells were purified from paired bone marrow samples derived from two of 4 study individuals and IgV of more potent antibodies cloned from memory B cells of these individuals were specifically amplified by PCR _H And (3) a gene. The following are listed as clone-specific primers for RU 01:

CTGCAACCGGTGTACATTCTCAAGTGCAACTGGTGC (FWRD) (SEQ ID NO. 584), CTGCAACCGGTGTACATTCTCAGGTCCATTTGTCACAG (FWRD) (SEQ ID NO. 585) TGCGAAGTCGACGCTGACGAGACAGTGACCTGC (REV) (SEQ ID NO. 586), TGCGAAGTCGACGCTGAAGAGACAATAATTTG (REV) (SEQ ID NO. 587), TGCGAAGTCGACGCTGACGAGACAATAACT (REV) (SEQ ID NO. 588), and for RU 10: CTGCAACCGGTGTACATTTTCAGGGGCACTTGGTG (FWRD) (SEQ ID NO. 589), TGCGAAGTCGACGCTGAGGTGACGATGACCGTG (REV) (SEQ ID NO. 590). Members of selected clones and numerous other variants were readily identified in both patients.

To verify that these antibodies were also found in serum, igG purified from serum of the same 2 and one other individuals was adsorbed to 2CC core baits and mass-spectrum was performed on the eluted IgG (fig. 1D, fig. 7 and fig. 10A-C). Diagnostic peptides directed against the highly active antibody variants were found in all cases (fig. 7, fig. 10A-C). It was concluded that broad-spectrum and potent anti-HIV antibodies cloned from memory B cells were also found in the bone marrow plasma cell compartment and circulating IgG of patients with broad-spectrum neutralizing antibodies with high serum titers.

Example 7

HIV antibody binding Properties

To determine if the affinity of the antibodies for gp120 correlates with neutralizing activity, surface Plasmon Resonance (SPR) was used to compare binding of highly active antibodies, selected clonal relatives, and germ line reversed progenitors (fig. 2A and B, fig. 8 and table 6).

The top neutralizing antibodies showed affinity on YU2gp140 trimer (K _A ) In the range ofOn the 2CC nucleus +.>(FIGS. 2A and B and Table 6). Consistent with its reduced neutralization potency and breadth, 3BNC66, 3BNC156, and 3BNC55 showed lower affinity on YU2gp140 trimer than 3BNC117, but unexpectedly, affinity for the 2CC core was not correlated with neutralization activity (fig. 1, 8, table 4, and table 6). No binding was detected by SPR for any of the germline reverse antibodies tested (fig. 2B, table 6). It was concluded that anti-HIV antibodies captured by YU2 2 CC-cores tended to show higher affinity for gp140 trimer than for 2 CC-cores.

When VRC01 binds to HIV spike, it produces a large conformational change that resembles CD4 binding and exposing the CD4i site. In contrast, b12 and most other known anti-CD 4bs antibodies are absent.

To determine if this is a shared feature of the highly active antibodies, HIV-bal.26 Δc or-YU 2gp160 Δc was expressed on HEK 293T cell surface and binding of CD4i antibodies was determined in the presence or absence of CD4 or anti-CD 4bs antibodies (fig. 2C). With one exception, all the highly active antibodies tested were similar to CD4 and VRC01 in that they both promoted binding of the anti-CD 4i antibodies to one or both of HIV-bal.26 and YU2gp160 ac (fig. 2C).

The only highly active antibody, 8ANC195, which does not have this property, is not the traditional anti-CD 4bs antibody, as it is equally sensitive to the D368R and I420R mutants (table 3). Furthermore, it differs from other highly active antibodies in neutralization pattern: it was unable to neutralize any layer 1 virus and showed strong activity against H086.8, H086.8 was a clade B virus that was resistant to all other antibodies tested, including 3BNC117, VRC01 and B12 (fig. 1A and B and tables 4 and 5).

Example 8

HIV antibody sequence identity

To determine whether the highly active anti-CD 4bs antibodies have common sequence characteristics, the 10 best antibodies were aligned: 2 variants were selected from 5 antibody clones each independently derived from 5 different patients (fig. 3). IgV (Igv) _H Comparison of the regions reveals that 68 IgV are covered _H Highly conserved consensus sequences of residues (FIG. 3A). The IgV _H The consensus sequence includes 6 VRC01-gp120 contact residues, including VRC01-Arg 71, which mimics Arg59 _CD4 And Asp368 _gp120 Key interactions of (a) are shown (figure 3A). Furthermore, igV comprising a consensus sequence of 6 contact residues in two closely related germlines _H Gene (V) _H 1-2 and V _H 1-46) are fully conserved, igV _H The genes produced all antibodies in this class (fig. 3A and B).

Codons encoding consensus residues were highly somatically mutated in the 10 antibodies selected, whereas the amino acid sequence was conserved (fig. 9). The substitution ratio of silent mutations in consensus residues ranged from 0.7 to 1.7, whereas in non-consensus residues, the range was 3.5 to 22, indicating that conservation of the consensus sequence was strongly selective (table 7). In contrast to the heavy chain, the light chain of VRC01 has only 8 out of a total of 32 contacts with gp 120. Consistent with its more limited role, comparison of identical antibody light chain sequences found coverage of 53 IgV _L Residues are less extensive consensus sequences, including 3 VRC01-gp120 contact residues (FIG. 3B). Finally, as with the heavy chain, the light chain is due to a restricted set of germline genes: 2 from IgK1D-33, 2 from IgK3-11 and one from IgL1-47 (FIG. 3B and Table 3). Antibody 8ANC195Unlike other antibodies in several important respects, they do not completely coincide with the consensus sequence and are not due to the associated heavy or light chains (fig. 3A and B). It was concluded that there was significant sequence convergence in the highly active, competitive anti-CD 4bs antibodies (HAADs).

Example 9

Crystal structure of 3BNC60Fab

To determine if the antibody structure is also conserved in different patients, the crystal structure of 3BNC60Fab was resolvedResolution and compare it to VRC 01. The structure reveals four domains V of a standard Fab _H 、C _H 1、V _L And C _L V (V) _H And V _L Complementarity Determining Regions (CDRs) within which antigen binding sites are formed. The two fabs in the 3BNC60 asymmetric unit are nearly identical, but the conformation of residues 74-78 in the loop connecting chains D and E varies slightly due to the different chemical environment created by the lattice contact.

Superposition of V from 3BNC60 and VRC01 in the Co-crystalline structure of VRC01-gp120 _H The domain (T.Zhou et al Science 329,811 (Aug 13,2010)) providesRoot mean square deviation (rmsd) (111 ca atoms calculated) with major differences confined to CDR2 residues 58-65 (3 BNC60 numbering). The stacked structure indicates conservation of the recognition interface with gp 120. For example Arg72 _3BNC60 Using Arg71 _VRC01 Similar conformation, which is similar to that normally formed at Arg59 _CD4 And Asp368 _gp120 Important salt bridges between them. In addition, trp47 _3BNC60 Adopts Trp47 _VRC01 The same conformation, the residue contacts gp120 and involves a complex network of aromatic and aliphatic residues that stabilize CDRH3 and CDRL3 conformations. Gln65 _3BNC60 Which corresponds to Gln64 _VRC01 Located in a fragment of residues (residues 58-65) that are structurally different from VRC 01. The conformation of this region on 3BNC60 relates to the crystalLattice contact in the body may be altered by binding gp120, as it may interfere with the CD4 binding loop on gp 120.

V of superposition of 3BNC60 and VRC01 _L Domain providesIs calculated for 95C alpha atoms) and shows that certain gp120 contact residues are structurally conserved; tyr91 _3BNC60 And Glu91a _3BNC60 With Tyr91 _VRC01 And Glu96 _VRC01 A similar conformation, which is linked to loop D of gp120 by polar interactions. Taken together, these structural comparisons demonstrate that the architecture of 3BNC60 binding to gp120 is identical to that observed when binding to VRC 01.

Example 10

HIV antibody consensus sequences

The above experiments define a class of competitive anti-CD 4bs antibodies, HAAD, which share IgV _H And IgV _L A consensus sequence comprising 8 contact residues between VRC01 and HIV spike (fig. 3A and B). Of the five different donors selected for their high level of serum anti-HIV activity, these antibodies were derived from only 2 closely related IgVs _H And 3 IgV _L A germline gene that conforms to the consensus sequence of HAAD: v (V) _H 1-2 and V _H 1-46 differ by only 7 amino acids, none of which belong to the consensus sequence portion (FIG. 3A). Despite extensive somatic mutations, consensus residues remain in their germline form.

The only exception consensus sequence was 8ANC195, which differs from others in a number of ways, suggesting that it may have a unique antigen recognition pattern: lack of mimicking key Arg59 in the heavy chain _CD4 And Asp368 _gp120 Arg at the contact site; a unique neutralization mode; and fails to promote anti-CD 4i antibody binding. The antibody is one of two different highly active antibodies produced in one patient, providing additional evidence that supports the notion that serum neutralization activity is combined.

/>

TABLE 1

TABLE 2

TABLE 3A

Table 3A continuation

TABLE 3b

Table 3b continuation

TABLE 3c

Table 3c continuation

/>

Table 3c continuation

/>

TABLE 3d

Table 3d continuation

TABLE 3e

Table 3e continuation

TABLE 3f

Table 3f continuation

TABLE 4a

Patient 3, clone RU01

3BNC62

3BNC176

3BNC60

3BNC117

3BNC95

3BNC104

MW965.26

＜0.09

＜0.10

＜0.04

＜0.09

＜0.07

＞50

BaL.26

＜0.09

＜0.10

＜0.04

＜0.09

＜0.07

0.025

DJ263.8

＜0.09

＜0.10

＜0.04

＜0.09

＜0.07

0.054

6535.3

0.68

0.46

0.54

0.55

1.0

＞50

RHPA4259.7

＜0.09

＜0.10

＜0.05

0.041

＜0.07

0.0252

TRO.11

＜0.09

＜0.10

＜0.05

0.077

＜0.07

3.791

PVO.4

＜0.09

＜0.10

0.09

＜0.09

＜0.07

0.348

YU2.DG

＜0.09

＜0.10

＜0.05

0.054

＜0.07

0.034

Patient 3, clone RU01 (follow-up)

3BNC91

3BNC55

3BNC89

3ANC3

3BNC53

3BNC72

MW965.26

＜0.08

0.04

＞0.05

0.18

0.09

＜0.06

BaL.26

＞178

＞30

＞110

＞50

＞30

＞139

DJ263.8

＞178

＞30

＞110

＞50

＞30

＞139

6535.3

1

2.6

1.7

＞50

13.6

8.49

RHPA4259.7

＜0.08

2.2

12.4

7.66

100.6

＞139

TRO.11

3.06

18.4

52.4

10.76

＞155

＞139

PVO.4

0.44

3.9

2.7

36.77

＞155

＞139

YU2.DG

＜0.08

0.9

0.39

35.01

＞155

＞139

Table 4a continuation

Patient 3, clone RU01

	3BNC156	3BNC158	3BNC153	3BNC108
					MW965.26	0.08	0.11	0.15	ND
BaL.26	＞111	＞109	＞100	20.6
					DJ263.8	＞111	＞109	＞100	＞55
6535.3	11.1	9.9	28.9	＞55
					RHPA4259.7	＞111	＞109	＞100	45.91
TRO.11	＞111	＞109	＞100	＞55
					PVO.4	＞111	＞109	＞100	＞55
YU2.DG	＞111	＞109	＞100	25.5

Patient 3, clone RU01

Patient 3 clone RU02-07

3A67

3A383

3BNC8

3ANC44

3A576

3ANC38

MW965.26

0.1

0.5

0.74

25.49

＞50

BaL.26

19.2

5.3

＞50

27.91

27

＞50

DJ263.8

＞50

6535.3

＞50

ND

＞50

RHPA4259.7

＞50

ND

＞50

TRO.11

＞50

ND

＞50

PVO.4

＞50

ND

＞50

YU2.DG

＞50

ND

＞50

B12 and NIH45 clones

TABLE 4b

Patient 1, clone RU08

	1B2640	1B2530	1B2364	1NC2	1NC9	1B2490
							MW965.26	41.76	0.762	1.85	＞50	＞50	＞50
BaL.26	0.08	＞50	＞25	0.11	1.37	0.058
							DJ263.8	＞50	2.71	3.75	＞50	＞50	＞50
6535.3	＞50	＞50	＞25	＞50	＞50	＞50
							RHPA4259.7	0.04	3.6	2.18	0.59	0.09	0.414
TRO.11	0.23	0.516	0.27	0.17	0.2	1.06
							PVO.4	1.05	0.275	0.161	0.37	0.34	2.97
YU2.DG	02	0.209	2.46	0.12	0.13	0.125

Patient 1, clone RU08 continued

	1NC108	1B2644	1B2339	1NC123
					MW965.26	＞50	＞25	＞25	＞50
BaL.26	＞50	＞25	＞25	＞50
					DJ263.8	＞50	＞25	＞25	＞50
6535.3	＞50	＞25	＞25	＞50
					RHPA4259.7	＞50	＞25	＞25	＞50
TRO.11	19.37	＞25	＞25	＞50
					PVO.4	3.13	＞25	＞25	＞50
YU2.DG	＞50	＞25	＞25	＞50

Patient 1, clone RU09

	1B218
		MW965.26	＞119
BaL.26	1.1
		DJ263.8	＞119
6535.3	3.6
		RHPA4259.7	＞100
TRO.11	＞100
		PVO.4	＞100
YU2.DG	＞100

TABLE 4c

Patient 8, clone RU10

	8ANC192	8ANC134	8ANC13	8ANC131	8ANC182	8ANC50	8ANC45
								MW965.26	＞73	＞50	＞50	＞50	＞115	＞50	＞50
BaL.26	0.08	0.02	0.04	0.06	0.08	0.17	0.296
								DJ263.8	＜0.03	0.003	0.008	0.004	＜0.05	0.04	0.041
6535.3	0.34	0.06	0.27	0.2	0.89	2.27	0.813
								RHPA4259.7	＞50	＞50	＞50	＞50	＞100	＞50	＞50
TRO.11	＞100	＞50	＞50	＞50	＞100	＞50	＞50
								PVO.4	0.89	0.46	0.63	0.81	1.2	3.89	4.259
YU2.DG	0.09	0.15	0.21	0.18	0.22	0.42	0.499

Patient 8, clone RU11-15

	8ANC57	8ANC195	8ANC24	8ANC14	8ACN5
						MW965.26	24.1	＞50	0.29	2.01	＞50
BaL.26	4.35	＞50	47.53	＞50	＞50
						DJ263.8	30.19	＞50	＞50	＞50	＞50
6535.3	＞103	0.2	＞50	＞50	＞50
						RHPA4259.7	1.65	0.34	＞50	＞50	＞50
TRO.11	32.07	0.18	＞50	＞50	＞50
						PVO.4	101.15	0.52	＞50	＞50	＞50
YU2.DG	27.52	0.79	＞50	＞50	＞50

TABLE 4d

Patient 12, clone RU16

	12A12	12A21	12A4	12A37	12A22	12A16
							MW965.26	0.042	0.075	0.098	0.056	0.06	0.167
BaL.26	0.017	＜0.001	＜0.001	0.005	0.04	0.042
							DJ263.8	0.002	0.035	0.017	0.013	0.08	0.012
6535.3	21.97	＞50	＞50	＞50	＞25	15.44
							RHPA4259.7	0.086	0.038	0.041	0.042	0.04	0.207
TRO.11	0.288	0.164	0.257	0.827	0.56	0.751
							PVO.4	0.928	0.584	0.819	0.516	0.45	2.44
YU2.DG	0.084	0.015	0.018	0.019	0.11	0.234

Patient 12, clone RU16

	12A20	12A6	12A23	12A46	12A55
						MW965.26	0.192	0.112	5.1	＞50	0.58
BaL.26	0.035	0.072	0.57	0.013	2.87
						DJ263.8	0.05	0.004	0.63	5.79	＞50
6535.3	48.73	＞24	14.73	48.85	＞50
						RHPA4259.7	0.109	0.227	0.496	＞50	＞50
TRO.11	0.689	1.52	2.88	＞50	21.45
						PVO.4	3.04	3.32	2.24	2.18	0.99
YU2.DG	0.142	0.222	0.053	0.49	0.1

Table 4d continuation

B12 and NIH45 clones

TABLE 4e

Patient 3, clone RU01

	3BNC62	3BNC176	3BNC60	3BNC117	3BNC95	3BNC104
							MW965.26	＜0.09	＜0.10	0.09	＜0.09	＜0.07	＞50
BaL.26	＜0.09	＜0.10	＜0.04	＜0.09	＜0.07	0.09
							DJ263.8	0.1	＜0.10	0.1	0.1	0.1	0.187
6535.3	2.24	1.7	1.77	2.44	4.5	＞50
							RHPA4259.7	＜0.09	＜0.10	0.07	0.137	＜0.07	0.06
TRO.11	＜0.09	＜0.10	0.12	0.077	＜0.07	30.847
							PVO.4	0.23	0.16	0.27	0.19	0.23	0.901
YU2.DG	＜0.09	＜0.10	0.07	0.054	＜0.07	0.097

Patient 3, clone RU01

3BNC91

3BNC55

3BNC89

3ANC3

3BNC53

3BNC72

3BNC156

MW965.26

＜0.08

0.15

0.16

0.64

0.61

0.37

0.47

BaL.26

＞178

＞30

＞110

＞50

＞30

＞139

＞111

DJ263.8

＞178

＞30

＞110

＞50

＞30

＞139

＞111

6535.3

6.7

5.53

5.92

＞50

73.38

133.665

69.66

RHPA4259.7

0.52

8.03

＞110

＞50

＞155

＞139

＞111

TRO.11

32.31

41.67

＞110

＞50

＞155

＞139

＞111

PVO.4

2.65

6.5

10.18

＞50

＞155

＞139

＞111

YU2.DG

＜0.08

1.07

1.49

＞50

＞155

＞139

＞111

Patient 3, clone RU01

3BNC158

3BNC153

3BNC108

3BNC142

3BNC66

3BNC42

3BNC102

MW965.26

0.6

0.63

ND

0.8

29.98

ND

＞50

BaL.26

＞109

＞100

＞55

＞172

＞189

＞26

＞50

DJ263.8

＞109

＞100

＞55

＞172

＞189

＞26

＞50

6535.3

97.75

＞100

＞55

＞172

＞189

＞26

＞50

RHPA4259.7

＞109

＞100

＞55

＞172

＞189

＞26

＞50

TRO.11

＞109

＞100

＞55

＞172

＞189

＞26

＞50

PVO.4

＞109

＞100

＞55

＞172

＞189

ND

＞50

YU2.DG

＞109

＞100

＞55

＞172

＞189

＞26

＞50

Table 4e continuation

Patient 3 clone RU02-07

3A67

3A383

3BNC8

3ANC44

3A576

3ANC38

MW965.26

16

＞25

0.74

＞50

BaL.26

＞50

＞25

＞50

DJ263.8

＞50

＞25

＞50

6535.3

＞50

ND

＞50

RHPA4259.7

＞50

ND

＞50

TRO.11

＞50

ND

＞50

PVO.4

＞50

ND

＞50

YU2.DG

＞50

ND

＞50

B12 and NIH45 clones

	B12	VRC01	45-46
				MW965.26	ND	＜0.08	0.21
BaL.26	ND	0.1	0.06
				DJ263.8	ND	0.553	0.06
6535.3	ND	2.7	0.28
				RHPA4259.7	0.39	0.185	0.146
TRO.11	＞50	0.832	9.56
				PVO.4	＞50	1.2	0.47
YU2.DG	7.8	0.372	0.08

TABLE 4f

Patient 1, clone RU08

	1B2640	1B2530	1B2364	1NC2	1NC9	1B2490	1B2351
								MW965.26	＞50	＞50	＞25	＞50	＞50	＞50	＞50
BaL.26	0.32	＞50	＞25	0.51	19.92	0.3	＞50
								DJ263.8	＞50	＞50	＞25	＞50	＞50	＞50	＞50
6535.3	＞50	＞50	＞25	＞50	＞50	＞50	＞50
								RHPA4259.7	0.25	＞50	＞25	4.33	0.4	1.97	＞50
TRO.11	1.62	2.46	1.77	0.55	0.65	3.58	1.13
								PVO.4	2.97	1.25	0.65	1.08	1.32	10.57	0.88
YU2.DG	0.7	7.74	＞25	0.39	0.56	0.59	0.48

Patient 1, clone RU08 continued

Table 4f continuation

TABLE 4g

Patient 8, clone RU10

	8ANC192	8ANC134	8ANC13	8ANC131	8ANC182	8ANC50	8ANC45
								TRO.11	＞73	＞50	＞50	＞50	＞115	＞50	＞50
BaL.26	0.43	0.11	0.18	0.31	0.73	0.77	7.45
								DJ263.8	0.1	0.044	0.069	0.046	0.11	0.15	0.166
6535.3	1.43	2	2.3	1.9	3.93	13.65	10.473
								RHPA4259.7	＞100	＞50	＞50	＞50	＞100	＞50	＞50
TRO.11	＞100	＞50	＞50	＞50	＞100	＞50	＞50
								PVO.4	3.94	2.5	3.7	4.9	4.43	14.99	17.315
YU2.DG	0.51	0.616	1.07	0.92	1.46	1.59	2.942

Patient 8, clone RU11-15

	8AN57	8AN195	8AN24	8AN14	8AN5
						TRO.11	＞103	＞50	0.76	6.64	＞50
BaL.26	24.76	＞50	＞50	＞50	＞50
						DJ263.8	＞103	＞50	＞50	＞50	＞50
6535.3	＞103	0.91	＞50	＞50	＞50
						RHPA4259.7	14.44	1.56	＞50	＞50	＞50
TRO.11	＞103	0.89	＞50	＞50	＞50
						PVO.4	＞103	1.87	＞50	＞50	＞50
YU2.DG	91.49	2.77	＞50	＞50	＞50

TABLE 4h

Patient 12, clone RU16

	12A12	12A21	12A4	12A37	12A22	12A16
							MW965.26	0.2	0.85	1.24	0.3	0.21	0.58
BaL.26	0.08	0.004	0.007	0.03	0.14	0.25
							DJ263.8	0.31	0.42	1.06	0.57	1.86	0.12
6535.3	＞50	＞50	＞50	＞50	＞25	＞42
							RHPA4259.7	0.4	0.13	0.19	0.19	0.13	0.93
TRO.11	0.98	0.57	1.12	3.81	1.94	2.57
							PVO.4	3.15	2.09	2.95	1.8	1.49	8.72
YU2.DG	0.31	0.06	0.1	0.07	0.36	1.13

Patient 12, clone RU16

	12A20	12A6	12A23	12A46	12A55
						MW965.26	2.2	0.52	＞50	＞50	4.49
BaL.26	0.23	0.47	3.47	0.08	＞50
						DJ263.8	ND	0.08	30.81	＞50	＞50
6535.3	ND	＞24	＞50	＞50	＞50
						RHPA4259.7	0.49	1.02	1.69	＞50	＞50
TRO.11	2.41	5.15	10.11	＞50	＞50
						PVO.4	11.2	17.34	7.81	797	4.3
YU2.DG	0.67	1.2	0.19	0.25	0.29

B12 and NIH45 clones

TABLE 5a

In vitro Tzm-bl neutralization assay, expansion Panel IC50 values

In vitro Tzm-bl neutralization analysis, extension panel IC50 value continuation

	1NC9	1B2530	8ANC131	8ANC134	8ANC195	12A12	12A21
								Q842.d12	0.02	0.249	0.053	0.061	＞30	0.014	0.015
3415.v1.c1	0.266	0.065	0.299	0.323	2.404	0.121	0.82
								3365.v2.c20	0.329	4.357	＞30	＞30	＞30	0.068	0.045
H086.8 ^＊	＞30	＞30	＞50	＞50	0.095	＞30	＞30
								ZM53M.PB12	0.705	0.912	＞30	＞30	9.626	0.593	0.42
Du172.17 ^＊	＞30	＞30	＞30	＞30	10.797	0.196	0.126
								ZM109F.PB4	0.023	＞30	＞30	＞30	＞30	0.148	2.104
3016.v5.c45	＞30	＞30	＞30	＞30	0.195	1.163	0.097
								231965.c1	0.393	0.168	6.346	＞30	0.514	2.217	＞30
X1254_c3	＞30	＞30	＞30	＞30	1.524	1.032	26.793
								250-4 ^＊	＞30	＞30	＞50	＞50	＞50	＞30	＞30
251-18	1.234	9.847	0.968	1.56	0.284	2.622	1.713
								278-50 ^＊	＞30	＞30	＞50	＞50	＞50	＞30	＞30
620345.c1 ^＊	＞30	＞30	＞50	＞50	＞50	＞30	＞30
								R1166.c1	0.651	0.119	＞30	＞30	0.986	0.342	0.292

TABLE 5b

In vitro Tzm-bl neutralization assay, expansion Panel IC80 values

	B12	VRC01	45-46	3BNC60	3BNC62	3BNC117	3BNC55
								Q842.d12	＞50	0.096	0.026	0.03	0.03	0.01	0.062
3415.v1.c1	14.1	0.15	0.069	0.37	0.4	0.47	0.388
								3365.v2.c20	＞50	0.17	0.114	0.08	0.09	0.1	2.341
H086.8 ^＊	＞50	＞50	＞30	＞15	＞15	＞15	＞30
								ZM53M.PB12	＞50	4	0.652	0.76	1.1	0.85	＞30
Du172.17 ^＊	2.6	＞50	＞30	＞15	12.18	8.9	＞30
								ZM109F.PB4	＞50	0.754	0.22	1.23	0.78	0.88	0.396
3016.v5.c45	4	0.42	＞30	7.38	2.35	＞15	＞30
								231965.c1	0.16	1.2	0.1	0.25	0.22	0.22	2.78
X1254_c3	＞50	0.19	0.078	0.29	0.27	0.27	0.571
								250-4 ^＊	＞50	＞50	＞30	＞15	＞15	＞15	1.922
251-18	＞50	11.2	5.255	0.96	1	0.82	＞30
								278-50 ^＊	＞50	＞50	＞30	＞15	＞15	＞15	＞30
620345.c1 ^＊	＞50	＞50	＞30	＞15	＞15	＞15	＞30
								R1166.c1	＞50	4.6	1.679	0.51	0.89	0.64	2.351

In vitro Tzm-bl neutralization analysis, extension panel IC80 value continuation

1NC9

1B2530

8ANC131

8ANC134

8ANC195

12A12

12A21

Q842.d12

0.133

2.191

0.179

0.205

＞30

0.06

0.066

3415.v1.c1

1.002

0.35

1.555

2.643

17.743

0.418

0.296

3365.v2.c20

2.163

＞30

0.192

0.166

H086.8 ^＊

＞30

＞50

5.328

＞30

ZM53M.PB12

2.771

4.022

＞30

2.069

1.458

Du172.17 ^＊

＞30

0.992

0.637

ZM109F.PB4

0.146

＞30

0.698

13.686

3016.v5.c45

＞30

0.872

11.864

0.358

231965.c1

2.276

0.963

＞30

2.355

15.102

＞30

X1254_c3

＞30

6.949

5.777

＞30

250-4 ^＊

＞30

＞50

＞30

251-18

6.291

＞30

5.55

6.281

1.511

9.39

6.063

278-50 ^＊

＞30

＞50

＞30

620345.c1 ^＊

＞30

＞50

＞30

R1166.c1

2.669

0.684

＞30

4.83

1.85

2.137

TABLE 6

Determination of the affinity of IgG antibodies for YU-2 gp140 and 2 CC-Nuclear ligand by surface plasmon resonance

gp140

2CC-Core

k _a (M ^-1 s ^-1 )

k _d (s ^-1 )

K _D (M)

ka(M ^-1 s ^-1 )

k _d (s ^-1 )

K _D (M)

12A12

4.59E+04

1.44E-05

3.15E-10

6.33E+04

1.70E-06

2.69E-11

12A21

9.18E+04

3.44E-07

3.75E12

1.82E+05

3.30E-04

1.81E-09

12AGL

/

3BNC60

2.73E+04

1.86E-04

6.81E-09

3.02E+04

1.64E-03

5.45E-08

3BNC117

3.04E+04

1.99E-04

6.54E-09

1.49E-03

4.05E+04

3.68E-08

3BNC55

1.31E+04

7.55E-04

5.78E-08

8.15E-04

3.16E+04

2.57E-08

3BNC66

1.60E+04

1.41E-03

8.81E-08

3.96E+04

1.33E-03

3.36E-08

3BNC156

1.13E+04

1.98E-03

1.75E-07

1.88E+04

1.53E-03

8.12E-08

3BNC108

/

3BNC60GL

/

8ANC131

6.59E+04

1.09E-03

1.65E-08

4.88E+04

3.23E-03

6.61E-08

8ANC134

1.55E+04

1.74E-03

1.13E-07

2.08E+04

9.57E-04

4.61E-08

8AGL

/

8ANC195

4.88E+04

1.67E-03

3.43E-08

2.41E+04

1.32E-03

5.47E-08

1NC9

4.83E+04

5.81E-04

1.20E-08

5.11E+04

2.36E-04

4.61E-09

1B2530

4.74E+04

1.62E-03

3.42E-08

6.83E+04

4.02E-04

5.90E-09

1GL

/

4546

4.26E+04

2.87E-04

6.75E-09

1.12E+05

4.94E-04

4.40E-09

VRC01

1.83E+04

8.08E-06

4.41E-10

2.84E+04

3.25E-05

1.15E-09

TABLE 7a

Substitution/silent mutation Rate for heavy chain sequences of selected 10 antibodies

	All nucleotides	Consensus nucleotides	Non-consensus nucleotide
				3BNC117HC	1.8	1.0	3.5
3BNC60HC	2.0	1.1	4.4
				12A12HC	2.8	1.7	6.3
12A21HC	2.6	1.5	4.8
				NIH4546HC	1.7	0.9	5.5
VRCO1HC	2.2	1.1	22.0
				8ANC131HC	2.7	1.3	8.0
8ANC134HC	2.2	1.5	3.7
				1B2530HC	2.0	0.9	11.0
1NC9HC	1.9	0.7	12.0

TABLE 7b

Substitution/silent mutation Rate for light chain sequences of selected 10 antibodies

	All nucleotides	Consensus nucleotides	Non-consensus nucleotide
				3BNC117KC	1.7	0.8	2.8
3BNC60KC	1.7	0.7	4.0
				12A12KC	1.7	0.6	4.0
12A21KC	2.5	1.4	4.3
				NIH4546KC	1.7	0.9	3.0
VRC01KC	1.8	0.8	4.0
				8ANC131KC	1.5	0.5	4.2
8ANC134KC	1.5	0.5	4.2
				1B2530LC	1.9	2.0	1.8
1NC9LC	1.2	0.9	1.8

TABLE 8

Crystallization data collection and perfecting statistics

/>

Claims

1. A kit for preventing or treating HIV infection or an HIV-associated disease, comprising:

an isolated anti-HIV antibody, or antigen-binding fragment thereof, or HIV gp-120-derived antigen-binding fragment thereof, comprising:

CDR1, CDR2, and CDR3 regions of the sequence of SEQ ID No. 892 and CDR1, CDR2, and CDR3 regions of the sequence of SEQ ID No. 906, wherein the CDR1, CDR2, and CDR3 regions of the sequence of SEQ ID No. 892 are DYFIH, WINPKTGQPNNPRQFQG and QRSDYWDFDV, respectively, and the CDR1, CDR2, and CDR3 regions of the sequence of SEQ ID No. 906 are QANGYLN, DGSKLER and QVYE, respectively; or (b)

A nucleic acid molecule encoding said isolated anti-HIV antibody or antigen-binding fragment thereof or HIV gp-120-derived antigen-binding fragment thereof; or (b)

A cell comprising at least one nucleic acid encoding said isolated anti-HIV antibody or antigen-binding fragment thereof or HIV gp-120-derived antigen-binding fragment thereof.

2. The kit of claim 1, wherein the isolated anti-HIV antibody comprises a heavy chain variable region and a light chain variable region, each comprising the sequences set forth in the sequence combinations of SEQ ID NOs 892 and 906.

3. The kit of claim 1 or 2, wherein the isolated anti-HIV antibody comprises a heavy chain variable region and a light chain variable region comprising the sequences set forth in the sequence combinations of SEQ ID NOs 387 and 558, respectively.

4. The kit of any one of claims 1 to 3, wherein the isolated anti-HIV antibody is a chimeric, humanized, recombinant or human antibody.

5. The kit of any one of claims 1 to 4, wherein the isolated anti-HIV antibody is a recombinant antibody.

6. The kit of any one of claims 1 to 5, wherein the antigen-binding fragment or HIV gp-120 derived antigen-binding fragment is selected from the group consisting of Fab fragments, F (ab') 2 fragments, fv fragments, and single chain Fv fragments.

7. The kit of any one of claims 1 to 6, comprising a pharmaceutically effective amount of a pharmaceutically acceptable dosage unit of the isolated anti-HIV antibody or antigen-binding fragment thereof, or HIV gp-120-derived antigen-binding fragment thereof.

8. The kit of any one of claims 1 to 7, further comprising a pharmaceutically acceptable dosage unit of a pharmaceutically effective amount of an anti-HIV agent, wherein the two pharmaceutically acceptable dosage units can optionally take the form of a single pharmaceutically acceptable dosage unit.

9. The kit of claim 8, wherein the anti-HIV agent comprises a second anti-HIV antibody.

10. The kit of claim 8, wherein the anti-HIV agent is selected from the group consisting of a non-nucleoside reverse transcriptase inhibitor, a protease inhibitor, an entry or fusion inhibitor, and an integrase inhibitor.

11. A kit for diagnosing, prognosing or monitoring HIV treatment in a subject comprising one or more detection reagents that specifically bind to anti-HIV antibodies in a biological sample from the subject, wherein the anti-HIV antibodies comprise:

CDR1, CDR2 and CDR3 regions of the sequence of SEQ ID No. 892 and CDR1, CDR2 and CDR3 regions of the sequence of SEQ ID No. 906, wherein the CDR1, CDR2 and CDR3 regions of the sequence of SEQ ID No. 892 are DYFIH, WINPKTGQPNNPRQFQG and QRSDYWDFDV, respectively, and the CDR1, CDR2 and CDR3 regions of the sequence of SEQ ID No. 906 are QANGYLN, DGSKLER and QVYE, respectively.

12. The kit of claim 11, wherein the anti-HIV antibody comprises a heavy chain variable region and a light chain variable region, each comprising the sequences set forth in the sequence combinations of SEQ ID NOs 892 and 906.

13. The kit of claim 11 or 12, wherein the anti-HIV antibody comprises a heavy chain variable region and a light chain variable region comprising the sequences set forth in the sequence combinations of SEQ ID NOs 387 and 558, respectively.

14. The kit of any one of claims 11 to 13, wherein the anti-HIV antibody is a chimeric, humanized, recombinant or human antibody.

15. The kit of any one of claims 11 to 14, wherein the anti-HIV antibody is a recombinant antibody.

16. The kit of any one of claims 11 to 15, further comprising reagents for performing PCR or mass spectrometry.