CN112195238A

CN112195238A - Primer group and kit for amplifying PKD1 gene

Info

Publication number: CN112195238A
Application number: CN202011294989.3A
Authority: CN
Inventors: 杨敬敏; 朱学萍; 王彬; 唐嘉婕; 高鹏飞; 林健
Original assignee: Shanghai Wickham Biomedical Technology Co ltd
Current assignee: Shanghai Wickham Biomedical Technology Co ltd
Priority date: 2020-11-18
Filing date: 2020-11-18
Publication date: 2021-01-08
Anticipated expiration: 2040-11-18
Also published as: CN112195238B

Abstract

The invention relates to the field of genetic disease gene detection, in particular to a PCR primer set for amplifying PKD1 gene, which comprises one or more of a first primer pair, a second primer pair, a third primer pair or a fourth primer pair. The primer group prolongs the length of an amplicon covering the No. 1 exon, successfully realizes the stable amplification of the No. 1 exon region, and the amplification product covers all exon regions of PKD1 and most intron regions; the PKD1 gene sequence is obtained specifically, and the pseudogene sequence of PKD1 can not be amplified completely; the mutation of the PKD1 gene, including both known and unknown, was detected more accurately, with complete exclusion of pseudogene interference.

Description

Primer group and kit for amplifying PKD1 gene

Technical Field

The invention relates to the field of genetic disease gene detection, in particular to a primer group and a kit for amplifying PKD1 gene.

Background

Polycystic kidney (polycystic kidney), also known as Potter (I) syndrome, Perlmann syndrome, congenital renal cystic tumor disease, cystic kidney, bilateral renal hypoplasia syndrome, etc., is a common hereditary disease. The main manifestations are that the pathological changes of the two kidneys are asymmetric in progress and different in size, the two kidneys can occupy the whole abdominal cavity till the late stage, and a plurality of cysts are distributed on the surfaces of the kidneys, so that the kidneys are irregular in shape and uneven in shape, and finally end-stage renal diseases are caused. The polycystic kidney can be divided into Autosomal Dominant Polycystic Kidney Disease (ADPKD) and Autosomal Recessive Polycystic Kidney Disease (ARPKD) according to the genetic mode, and the morbidity of the polycystic kidney disease is 1/400-1/1000 and 1/10000-1/40000 respectively. ADPKD is inherited in an autosomal dominant manner. The adult polycystic kidney is mainly caused by PKD1 and PKD2 gene mutation, the gene mutation pathogenic rate in PKD1 is about 85%, the gene mutation pathogenic rate in PKD2 is about 15%, PKD1 is the main pathogenic gene of adult polycystic kidney, and the protein coded by PKD1 gene is polycystic protein 1(PC 1). The PKD1 gene is located on the short arm of chromosome 16, the gene length is 52kb, and its total length is 46 exons, and on chromosome 16 the PKD1 gene has 6 pseudogenes which are homologous with it, and the homology of the pseudogene and the sequence of exons 1-33 of PKD1 gene is up to 97.7%, and about 80% of pathogenic mutation is occurred in said region, and the conventional methods of PCR or second-generation sequencing, etc. are difficult to specifically target-enrich and detect PKD1 true gene, and the accuracy of detection result is often interfered by the pseudogene. Moreover, the GC content of the partial DNA sequence of the PKD1 is high, for example, the GC content of the No. 1 exon region is up to 85%, the difficulty of detecting the sequence with high GC content by using methods such as PCR amplification or NGS and the like is higher, and a plurality of kits for detecting the PKD1 gene by using the PCR technology only amplify the No. 2-46 exons and cannot detect the variation in the No. 1 exon. PKD1 has no specific mutation site, and mutation may occur at any position, so that detection of PKD1 gene variation comprehensively requires detection of all exon regions.

Existing detection methods have drawbacks. For example, there are 46 exons in PKD1, and each exon in PKD1 is amplified separately and then subjected to sequencing by one generation, which consumes high workload and cost, and it is difficult to specifically amplify PKD1 true gene, and the accuracy of the result is interfered by the sequence of the pseudogene; in some articles, although each exon does not need to be amplified separately, the number of primer sets required in the process of amplifying the PKD1 gene is too large, the method is too complicated, and the detection efficiency is low. Or the nested PCR is utilized to enrich the PKD1 true gene, usually, a plurality of sections of long-fragment PCR are used for amplifying the PKD1 gene, and then the long-fragment PCR product is used as a template to enrich the PKD1 true gene, so that the operation is relatively complex; or the PKD1 is detected by using a next-generation sequencing method, the PKD1 true gene is difficult to be captured specifically, the read length of the next-generation sequencing is short, and the homology of the true gene and the false gene is high, so that the data cannot be aligned specifically; or the PKD1 is detected by using a third-generation sequencing method, and the cost is relatively high.

Disclosure of Invention

In view of the above-mentioned disadvantages of the prior art, the present invention aims to provide a primer set and a kit for amplifying PKD1 gene, which are used to solve the problems in the prior art.

In order to achieve the above and other related objects, the present invention provides a PCR primer set for amplifying PKD1 gene, wherein the PCR primer set comprises one or more of the following primer pairs:

1) a first primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 1 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 2;

2) a second primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 3 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 4;

3) a third primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 5 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 6;

4) a fourth primer pair: comprises an upstream primer with a nucleotide sequence shown as SEQ ID NO. 7 and a downstream primer with a nucleotide sequence shown as SEQ ID NO. 8.

The kit for amplifying the PKD1 gene comprises any one or more of a first primer pair, a second primer pair, a third primer pair or a fourth primer pair.

The amplification system for amplifying the PKD1 gene comprises a first amplification system, a second amplification system, a third amplification system and a fourth amplification system, wherein the first amplification system comprises the first primer pair, the second amplification system comprises the second primer pair, the third amplification system comprises the third primer pair, and the fourth amplification system comprises the fourth primer pair.

The PCR primer group for amplifying the PKD1 gene and/or the amplification system are/is used for preparing a product for detecting the PKD1 gene variation.

As described above, the primer set and the kit for amplifying the PKD1 gene according to the present invention have the following advantageous effects:

1) the length of the amplicon covering the No. 1 exon is prolonged, the stable amplification of the No. 1 exon region with extremely high GC content is successfully realized, and the amplification product covers all exon regions of PKD1 and most intron regions;

2) the PKD1 gene sequence is obtained in one time and specifically, and the pseudogene sequence of PKD1 can not be amplified completely;

3) the mutation of the PKD1 gene, including both known and unknown, was detected more accurately, with complete exclusion of pseudogene interference.

Drawings

FIG. 1 is an electrophoresis quality inspection chart of PCR amplification products of four amplicon long segments of PKD1, note: m is 1kb extended DNA Ladder, the fragment length is 48.5kb, 20kb, 15kb, 10kb, 8kb, 6kb, 5kb, 4kb, 3kb, 2kb, 1.5kb, 1kb and 0.5kb from top to bottom; no. 1 represents a PKD1-F1/R1 amplification product, the size is 14693bp, No. 2 represents a PKD1-F3/R3 amplification product, the size is 13453bp, No. 3 represents a PKD1-F2/R2 amplification product, No. 14394bp and No. 4 represent a PKD1-F4/R4 amplification product, and the size is 3930 bp.

FIG. 2 is a library quality inspection diagram corresponding to four amplicons of PKD1, wherein M is a 2000bp Marker, the lengths of the fragments are 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom, and the

numbers

1, 2, 3 and 4 correspond to the library quality inspection diagrams of

amplicons

1, 2, 3 and 4 respectively.

FIG. 3 shows the sequence alignment of the true and pseudogenes at the upstream and downstream sites of chr16:2148504 in amplicon # 1.

FIG. 4 shows that in the original bam file, the chr16:2148504 site (first box from left) is mutated from A to G, and the site where the upstream two true and false genes are inconsistent (marked by second box from left and then third box, respectively) is not mutated.

FIG. 5 shows a schematic representation of the true-false gene alignment in the chr16:2163303-2178540 region.

FIG. 6 shows the original bam sequence in the chr16:2163303-2178540 region, with boxes indicating pseudogene specific sites.

FIG. 7 shows a schematic representation of the alignment of true and false genes in the region of chr16: 2177877-2186230.

FIG. 8 shows the original bam sequence in the chr16:2177877-2186230 region, with the positions marked in boxes being pseudogene specific sites.

Detailed Description

The invention provides a PCR primer set for amplifying PKD1 gene, which comprises one or more of the following primer pairs:

Wherein the region amplified by the first primer pair comprises exons 24 to 46 of the PKD1 gene. The region amplified by the second primer pair comprises exons 15 to 33 of the PKD1 gene. The region amplified by the third primer pair comprises exons 2 to 15 of the PKD1 gene. The region amplified by the fourth primer pair comprises a PKD1 gene exon 1.

Specifically, the PKD1 gene is a human PKD1 gene.

The PCR primer group is a long-fragment PCR primer group.

Specifically, the number of bases amplified by the first primer pair is 14693 bp; the number of the amplified bases of the second primer pair is 14394 bp; the number of the amplified bases of the third primer pair is 13453 bp; the number of the amplified bases of the fourth primer pair is 3930 bp.

Specifically, hg19 is used as a gene reference sequence: the genome region covered by the first primer pair is 2138216-2152908 of the PKD1 gene in human chromosome 16; the genome region covered by the second primer pair is 2147317-2161710 of the PKD1 gene in human chromosome 16; the genomic region covered by the third primer pair is 2160176-2173628 of PKD1 gene in human chromosome 16; the genomic region covered by the fourth primer pair is 2184767-2188696 of the PKD1 gene in human chromosome 16.

In one embodiment, the PCR primer set includes a first primer pair, a second primer pair, a third primer pair, and a fourth primer pair. The PCR primer set can be used to amplify the entire exon region of human PKD 1.

The specific base sequence of the primer pair exemplified above may be replaced with 1 or more bases or 1 or more bases may be added to the 3 'end or 5' end, as long as the specific recognition region can be specifically recognized under the conditions for carrying out PCR (preferably, annealing and self-annealing do not occur between primers used in a single reaction vessel). The number of the plurality is, for example, 2 to 3. When 1 or more bases are added to the primer, it is preferable to add the base to the 5' end of the primer.

The identity of a nucleotide sequence obtained by substituting 1 or more nucleotides in a specific nucleotide sequence of the primer set exemplified above for other nucleotides is preferably 70% or more, more preferably 75% or more, more preferably 80% or more, more preferably 85% or more, more preferably 90% or more, and more preferably 95% or more, with the nucleotide sequence before substitution (i.e., the nucleotide sequence represented by the sequence number).

The length of each primer is not particularly limited as long as it can specifically recognize the corresponding specific recognition region and hybridization does not occur between the primers, and is preferably 15 bases or more and 40 bases or less. The lower limit of the length of the primer is more preferably 16 bases or more, still more preferably 17 bases or more, and still more preferably 18 bases or more. More preferably, the upper limit of the length of the primer is 39 bases or less, still more preferably 38 bases or less, and still more preferably 37 bases or less.

The invention also provides a kit for amplifying the PKD1 gene, wherein the kit comprises any one or more of a first primer pair, a second primer pair, a third primer pair or a fourth primer pair.

In one embodiment, the kit comprises a first primer pair, a second primer pair, a third primer pair, and a fourth primer pair.

In one embodiment, the kit further comprises reagents for extracting genomic DNA from a sample; and reagents for performing long-fragment PCR reactions using the primers.

In one embodiment, the reagent for extracting genomic DNA from a sample may be an existing kit. For example: tiangen blood extraction kit.

In one embodiment, the reagents for performing a long fragment PCR reaction using the primers include a DNA polymerase, a PCR buffer, a dNTP mix, and an aqueous medium.

The DNA polymerase is suitable for long-fragment PCR amplification. For example, the DNA polymerase may be NEB

Hot start Taq DNA polymerase, TaKaRa LA

Hot StartVersion、TaKaRa

GXL DNA Polymerase, SD Polymerase, TOYOBO KOD-Plus-Neo, and the like.

The buffer may generally provide the most suitable conditions for the enzymatic reaction to the PCR system. The buffer solution may be any buffer solution as long as it has the above-described effects. For example, the Buffer can be 2x PCR Buffer for KOD FX Neo.

The dNTP mixture is usually used as a raw material for DNA synthesis, and specifically may include dATP, dGTP, dTTP, dCTP, and the like.

The aqueous medium may be used to adjust the concentration of the components of the PCR system, and may generally act as a dilution solvent. In one embodiment, the aqueous medium is selected from the group consisting of nucleic-free ddH₂O。

Other various reagents required for nucleic acid amplification may also be included in the kit. For example, an amplification accelerator, magnesium ion may be included. Suitable amplification promoters may further improve non-specific amplification. For example, the amplification enhancer may be selected from a combination of one or more of betaine, SSB, DMSO, and the like. As another example, the concentration of the amplification enhancer may be 0.5-2.5M, 0.5-1M, 1-1.5M, 1.5-2M, or 2-2.5M. The magnesium ions can be generally used as a catalyst in a PCR system, can form dNTP-Mg with dNTP to interact with a nucleic acid skeleton, and can influence the activity of the Polymerase.

The invention also provides an amplification system for amplifying the PKD1 gene, wherein the amplification system comprises a first amplification system, a second amplification system, a third amplification system and a fourth amplification system, the first amplification system comprises the first primer pair, the second amplification system comprises the second primer pair, the third amplification system comprises the third primer pair, and the fourth amplification system comprises the fourth primer pair.

The region amplified by the first amplification system comprises exons 24 to 46 of a PKD1 gene, the region amplified by the second amplification system comprises exons 15 to 33 of a PKD1 gene, the region amplified by the third amplification system comprises exons 2 to 15 of a PKD1 gene, and the region amplified by the fourth amplification system comprises an exon 1 of a PKD1 gene.

In one embodiment, the fourth amplification system comprises a DNA template, a fourth primer pair, a DNA polymerase, a PCR buffer, a dNTP mix, and an aqueous medium.

The DNA template is preferably human genomic DNA. Human genomic DNA can be easily obtained from blood or other arbitrary tissues collected from a subject using a commercially available DNA extraction kit or the like. The subject is not particularly limited, and preferably includes a person suspected of suffering from polycystic kidney disease or a person considered to have a relatively high possibility of genetically mutating the PKD1 gene.

The DNA polymerase is suitable for long-fragment PCR amplification. For example, it may be NEB

Hot start Taq DNA polymerase, TaKaRa LA

Hot StartVersion、TaKaRa

GXL DNA Polymerase, SD Polymerase, TOYOBO KOD-Plus-Neo, and the like.

In one embodiment, the DNA polymerase is KOD FX Neo DNA polymerase.

In one embodiment, the fourth amplification system comprises the following components: 50-150 ng of DNA template, 150-300 nM of fourth primer pair, 0.5-2.5U of DNA polymerase and 400-500 mu M of dNTP mixture.

In one embodiment, the fourth amplification system is 25 μ L, comprising the following components: mu.L of 50 ng/. mu.L DNA template, 0.375. mu.L total of 10. mu.M forward and reverse primers, 12.5. mu.L of 2 XKOD Buffer, 5. mu.L of 2mM dNTPs, 0.5. mu.L of 1U/. mu.L KOD FX Neo enzyme.

The PCR cycling conditions are not particularly limited as long as the amplification of the exon of the target PKD1 gene can be achieved. For example, the temperature of thermal denaturation may be set to 92 to 100 ℃, preferably 94 to 98 ℃. The thermal denaturation time is set to, for example, 5 to 180 seconds, preferably 10 to 130 seconds. The annealing temperature for hybridizing the primer may be set to, for example, 60 to 80 ℃ and preferably 60 to 70 ℃. The annealing time may be set to, for example, 10 to 60 seconds, preferably 20 to 30 seconds. The temperature of the elongation reaction is set to, for example, 62 to 80 ℃ and preferably 64 to 78 ℃. The temperature of the elongation reaction may be set to, for example, 4 to 15 minutes, preferably 7 to 15 minutes. The annealing and extension reactions may be performed under the same conditions. The operation of combining the thermal denaturation, annealing and extension reactions was performed in 1 cycle, and this cycle was repeated until a desired amount of amplification product was obtained. For example, the number of cycles may be set to 30 to 40, preferably about 25 to 35. In the present specification, the term "PCR cycling conditions" includes any one, any combination, or all of conditions and cycle numbers relating to the temperature and time of thermal denaturation, annealing, and extension reaction of PCR.

In one embodiment, the PCR reaction procedure for the fourth amplification system is: hot start at 94 ℃ and pre-denaturation for 2 min; denaturation at 98 ℃ for 10s, annealing at 60 ℃ for 30s and extension at 68 ℃ for 15min for 27 cycles; final extension at 68 ℃ for 20 min; storing at 4 ℃. The fourth amplification system can be scaled up or down in the same manner as the above system.

In one embodiment, the first amplification system comprises a first primer pair, a DNA template, a DNA polymerase, a PCR buffer, a dNTP mix, and an aqueous medium.

In one embodiment, the second amplification system comprises a second primer pair, a DNA template, a DNA polymerase, a PCR buffer, a dNTP mix, and an aqueous medium.

In one embodiment, the third amplification system comprises a third primer pair, a DNA template, a DNA polymerase, a PCR buffer, a dNTP mix, and an aqueous medium.

The first amplification system, the second amplification system and the third amplification system comprise the following components: 50-200 ng of DNA template, 150-300 nM of first, second or third primer pairs, 0.5-2.5U of DNA polymerase, and 400-500 muM of dNTP mixture.

In one embodiment, the first, second, and third amplification systems are each 25 μ L, and comprise the following components: mu.L of the forward and reverse primers of the 10. mu.M primer pair, 0.375. mu.L of KOD FX Neo enzyme 1U/. mu.L, 12.5. mu.L of 2 XKOD Buffer, 5. mu.L of 2mM dNTPs, 2. mu.L of 50 ng/. mu.L DNA template.

The first amplification system, the second amplification system, and the third amplification system may be scaled up or down in the same manner as described above.

The PCR reaction programs of the first amplification system, the second amplification system and the third amplification system are as follows: hot start at 94 ℃ and pre-denaturation for 2 min; denaturation at 98 ℃ for 10s, annealing at 66 ℃ for 30s and extension at 68 ℃ for 15min for 30 cycles; final extension at 68 ℃ for 20 min; storing at 4 ℃.

The invention also provides application of the PCR primer group and/or the amplification system for amplifying the PKD1 gene in preparing products for detecting PKD1 gene variation.

The product for detecting PKD1 gene variation is used for detecting the variation of PKD1 gene, judging the pathogenesis of polycystic kidney, selecting a treatment scheme, evaluating prognosis and/or guiding good prenatal and postnatal care.

For people who do not suffer from diseases, the risk of polycystic kidney diseases can be prompted, and early prevention can be realized; for the people with the disease, the method is helpful for judging the disease cause of polycystic kidney, selects an effective treatment scheme, can guide the good prenatal and postnatal care, and blocks the continuation of PKD1 pathogenic variation in offspring.

The invention also provides a method for detecting mutations in the PKD1 gene in vitro, comprising the steps of:

1) preparing the amplification system for amplifying the PKD1 gene, and performing PCR amplification;

2) sequentially carrying out library construction and high-throughput sequencing on the PCR amplification product;

3) data quality control and analysis: comparing the sequence of the PKD1 gene obtained by sequencing with a PKD1 pseudogene locus database; if no pseudogene pollution exists in the data, continuing to perform PKD1 true gene variation detection; if the data has false gene pollution, the amplification system is proved to be unqualified, and the amplification is carried out again after the reason is checked.

In one embodiment, the product obtained after the PCR reaction in step 1) is subjected to agarose gel electrophoresis and/or magnetic bead purification before performing step 2).

In one embodiment, the method for constructing the pseudogene locus database in step 3) comprises: and comparing the sequence of the PKD1 gene with 6 pseudogene sequences to obtain site information with inconsistent true and pseudogene sequences, and constructing a PKD1 pseudogene site database by using the site information. The PKD1 pseudogene locus database refers to the summary of information of loci with inconsistent true and pseudogene sequences.

And 3) performing quality control by calculating the pseudogene frequency of sites with inconsistent true and pseudogene sequences. The pseudogene frequency of the locus refers to the ratio of pseudogene bases in the locus to the coverage depth of all bases.

Furthermore, the quality control is carried out by calculating the average frequency of the pseudogene specific sites. The average pseudogene-specific site frequency is the average of the frequencies of all pseudogene-specific sites detected in the region.

In the step 3), possible reasons for the unqualified amplification system include primer degradation or contamination, template quality and input amount, primer concentration, annealing temperature, extension time, unqualified amplification cycle number and the like.

The in vitro methods for detecting mutations in the PKD1 gene include in vitro methods for non-diagnostic purposes and diagnostic purposes.

The method for detecting the PKD1 gene mutation in vitro for non-diagnostic purposes comprises the steps of researching the disease occurrence and development mechanism of polycystic kidney, constructing a disease animal model and screening a polycystic kidney prevention or treatment drug.

By analyzing the nucleotide sequence of the PCR amplification product, the presence or absence of a mutation (gene polymorphism) in the PKD1 gene of the specimen can be determined. The analysis of the base sequence can be carried out using known sequencing techniques. As a result of the nucleotide sequence analysis, when a gene polymorphism is detected, it can be judged that the subject is at high risk of developing polycystic kidney disease.

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments, and is not intended to limit the scope of the present invention; in the description and claims of the present application, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

EXAMPLE 1 Long fragment PCR amplification

1. Genomic DNA extraction

Human peripheral blood is collected, whole genome gDNA is extracted by using a Tiangen blood extraction kit, DNA concentration is measured by using a Nanodrop and a qubit3.0 instrument, and corresponding concentration and ratios of 260/280 and 260/230 are recorded.

2. Long fragment PCR amplification

All the genes of PKD1 were amplified using the extracted whole-genome gDNA as a template according to the primer set shown in Table 1, the reaction systems shown in tables 2 and 3, and the amplification procedures shown in tables 4 and 5. In the primer names in Table 1, F denotes an upstream primer (forward primer) and R denotes a downstream primer (reverse primer). The kit used for the long fragment PCR amplification was KFX-201(200 U.times.1), and the product consisted of KOD FXNoe (1.0U/. mu.L), 2 XPCR Buffer for KOD FXneo, 2mM dNTPs, manufacturer: TOYOBO. The reaction system 1 in Table 2 is suitable for the amplification of PKD1-F1/R1, PKD1-F2/R2 and PKD1-F3/R3 fragments. The reaction system 2 in Table 3 is suitable for the amplification of the PKD1-F4/R4 fragment.

Table 1 shows a primer list

TABLE 2 composition of reaction System 1

TABLE 3 composition of reaction System 2

PCR Components	Volume (μ L)
		gDNA(50ng/μL)	1
2×KOD Buffer	12.5
		2mM dNTP(400μM)	5
Upstream and downstream primers, 10. mu.M	0.375
		KOD FX	0.5
Nuclease-free ddH₂O	5.625
		total	25

Table 4 shows the long-fragment PCR amplification procedure of reaction System 1

Table 5 Long fragment PCR amplification procedure for reaction System 2

3. Electrophoresis quality inspection

After the amplification of the long fragment was completed, 2. mu.L of the amplification product was taken, and 6 XLoading Buffer was diluted to 2 Xloading Buffer plus 2. mu.L, and mixed well and subjected to 0.5% agarose gel electrophoresis, and the amplification results were observed, and the results are shown in FIG. 1.

Example 2 library construction

1. Long fragment PCR product purification

PCR products were purified using DNA purification beads of Oxi san or Noroxan 1.0X sample volume, washed twice with 80% ethanol, 30. mu.L of nucleic-free ddH₂And (4) eluting, and measuring the concentration of the product by a Qubit dye method.

2. Library construction of purified products using the assist holy construction kit

(1) DNA fragmentation: 120ng of the purified PKD1 quadruplicate were separately collected.

The DNA fragmentation reaction system was prepared according to Table 6 using assist in san assist in rapid fragmentation/end repair/end-of-A addition modular reagents, and after the preparation was completed, the PCR reaction procedure of Table 7 was performed.

TABLE 6 DNA fragmentation reaction System

Name of reagent	Volume (μ L)
		Purification of product DNA (120ng)	x
Smearase Mix	10
		Nuclease-free ddH₂O	(50-x)
Total	60

TABLE 7 PCR reaction procedure

(2) Connecting: the ligation system was prepared using the assist ligation reagent in accordance with Table 8, and then ligated in accordance with the PCR reaction protocol shown in Table 9.

TABLE 8 connection System

Name of reagent	Volume (μ L)
		DNA	60
Connection buffer	20
		T4 ligase	5
Long Y joint (10 mu M)	1.5
		Nuclease-free ddH₂O	13.5
Total	100

TABLE 9 PCR reaction procedure

Temperature (. degree.C.)	Time (min)
		20	15
4	Hold

(3) Fragment screening: purification of Oxin DNA magnetic beads 1.0 Xvolume purification, two washes with 80% ethanol, 100. mu.L of nucleic-free ddH₂After O elution, adding 70. mu.L of magnetic bead supernatant PEG, mixing uniformly, discarding magnetic beads, reserving all supernatant, adding into a new prepared 20. mu.L magnetic bead tube, discarding magnetic beads, washing twice with 80% ethanol, and obtaining 23. mu.L of nucleic-free ddH₂And (4) eluting with O.

(4) Amplification: the eluates were used to prepare a PCR amplification system according to Table 10, and the PCR amplification was carried out according to the PCR reaction procedure of Table 11.

TABLE 10 amplification System

Name of reagent	Volume (μ L)
		2×Kapa HiFi Mix	25
P5/P7(10μM)	2
		DNA	23
Total	50

TABLE 11PCR reaction procedure

(5) And (3) electrophoretic quality inspection: mu.L of the amplified product was collected, and the library was checked by electrophoresis on a 2% agarose gel, and the results of the observation are shown in FIG. 2.

(6) And (3) purifying an amplification product: the amplification product was purified with 1.2 × assist san-in-Saccharum beads, washed twice with 80% ethanol, and 30 μ L of nucleic-free ddH₂O elute.

(7) Quantification: the library was quantified using Qubit3.0 and concentration information was recorded.

(8) Qsep100 quality inspection: the size of the library fragments was examined.

3. Sequencing

Sequencing the library by using an Illumina CN500 second-generation sequencing platform, and performing data resolution after sequencing is completed.

Example 3 data analysis

Firstly, filtering an original fastq file (fastq file: data returned by sequencing, mainly sequence information and a corresponding quality value) of a PKD1 gene, removing data with poor quality, comparing the data with a pseudogene locus library, detecting pseudogene specific sites of each amplicon library in four amplicon regions respectively, if the pseudogene specific sites are detected, calculating the ratio of pseudogene bases in the sites to all base coverage depths, namely the pseudogene frequency of the sites, and calculating the mean value of the pseudogene frequency of all the pseudogene specific sites in each amplicon.

The results of the pseudogene-specific site analysis are shown in Table 12 as information on the pseudogene-specific sites detected in the database of the different amplicons.

TABLE 12 results of pseudogene-specific site analysis

As shown in the above table, 1 pseudogene-specific site was detected in the amplicon library No. 1, 4 pseudogene-specific sites were detected in the amplicon library No. 2, 3 pseudogene-specific sites were detected in the amplicon library No. 3, and no pseudogene-specific site was detected in the amplicon library No. 4.

Due to the presence of SNPs in the true gene of PKD1, some SNP sites were mutated to correspond exactly to the pseudogene-specific sites, resulting in the detection of pseudogene-specific sites in the data. Long fragment PCR will amplify the whole region at one time, if there is pseudogene contamination, most pseudogene specific sites should be detected in the data, and it is impossible to detect only individual sites. Specifically, with regard to the upstream and downstream sequences of these sites, if other pseudogene specific sites in the upstream and downstream sequences are not detected, it can be determined that the site is not a specific site on the pseudogene sequence, but a variation occurs in the true gene sequence of the sample, and the base after the variation is exactly the same as the base of the pseudogene specific site. Specific information on these pseudogene-specific sites is shown in Table 13:

TABLE 13 pseudogene-specific site details

Taking the chr16:2148504 site in the No. 1 amplicon as an example, the site is an SNP site (rs4018131), is recorded in a gnomAD database, and the mutation frequency in east Asia population is as high as 99.09%. Specifically, referring to the sequence alignment of the true gene and the pseudogene at the upstream and downstream of the site, as shown in fig. 3, the first sequence is the PKD1 gene sequence, i.e., the true gene sequence, and the following six sequences are sequentially 6 pseudogene sequences. Sites marked in gray are the chr16:2148504 sites, and sites marked in boxes are pseudogene-specific sites. As shown in FIG. 3, the position chr16:2148504 has base inconsistent with the true pseudogenes of the two pseudogenes PKD1P2 and PKD1P4, and the upstream of the position has other base inconsistent with the two pseudogenes PKD1P2 and PKD1P 4. The mutation of the site from A to G is detected in the data, and the mutation frequency is up to more than 90%. If it is due to pseudogene contamination, two pseudogene-specific sites upstream thereof should also be detected with high frequency. However, these two sites are not detected in the data, as shown in fig. 4, in the original bam file [ binary compressed version of sam (sequence alignment/map format) file ], it can be seen that the chr16:2148504 site (first box mark from left) is mutated from a to G, and the sites where the upstream two true and false genes are inconsistent (second box mark from left and third box mark respectively) are not mutated.

In conclusion, the primer set and the reaction system thereof can specifically amplify the PKD1 gene, and the pseudogene is not amplified at all, so that the mutation in the PKD1 true gene can be directly analyzed without being interfered by any pseudogene in data analysis.

Comparative example 1

If the primer sequence of the amplified PKD1 is not specially screened and designed, a pseudogene sequence is mixed in the PCR product after amplification, and the data analysis is seriously interfered. Such as with PKD 1-F5: GAATGGTGTCAGCCTGGGCTCTGTGGAGGACTC and PKD 1-R5: TTCATCAGCATGCTCTGGGGCAGACCCCTGCAG the common primers are used to amplify the exon regions 2-12 of PKD1 gene, the genome coordinate of the amplified region is chr16:2163303-2178540, then the long fragment amplification product is constructed by the second generation sequencing library, the false gene pollution ratio in the final data is higher, and the accuracy of detecting true gene variation is influenced. The pseudogene proportion information in the second generation sequencing data of the amplified products of the common primers is shown in Table 14. The alignment of true and false genes in this region is shown in FIG. 5, and the grey-marked points in the box are the specific sites of the false genes. The original bam sequence of the region sequencing data is shown in FIG. 6, and the positions marked by the boxes are pseudogene specific sites which correspond to the pseudogene specific sites in the above comparison chart one by one according to colors. It can be seen that there is a higher proportion of pseudogene sequences in the data.

TABLE 14 pseudogene fraction information in the second generation sequencing data of amplification products amplified with common primers

Comparative example 2

Such as with PKD1-F6: AGAGAAGGGACACAGCAGGGATGAGCCAGGGAG and PKD1-R6:

GCTTCCCGCCCACGCACTTTAGCCTGCAG amplifies the No. 1 exon region of PKD1 gene in the common primer region, the genome coordinate of the amplified region is chr16:2177877-2186230, and then the long fragment amplification product is subjected to second-generation sequencing library construction, so that the pseudogene pollution ratio in the final data is high, and the accuracy of detecting true gene variation is influenced. The pseudogene proportion information in the second generation sequencing data of the amplified products of the common primers is shown in Table 15. The alignment of true and false genes in this region is shown in FIG. 7, and the grey-marked points in the box are the specific sites of the false genes. The original bam sequence of the region sequencing data is shown in figure 8, the positions marked by the boxes are pseudogene specific sites, and the pseudogene specific sites in the comparison graph correspond to the pseudogene specific sites one by one according to the color. It can be seen that there is a higher proportion of pseudogene sequences in the data.

TABLE 15 pseudogene fraction information in the second generation sequencing data of amplification products amplified with common primers

The above examples are intended to illustrate the disclosed embodiments of the invention and are not to be construed as limiting the invention. In addition, various modifications of the invention set forth herein, as well as variations of the methods of the invention, will be apparent to persons skilled in the art without departing from the scope and spirit of the invention. While the invention has been specifically described in connection with various specific preferred embodiments thereof, it should be understood that the invention should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described embodiments which are obvious to those skilled in the art to which the invention pertains are intended to be covered by the scope of the present invention.

Sequence listing

<110> Shanghai Wehn biomedical science and technology, Inc

<120> primer group and kit for amplifying PKD1 gene

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ctacgtcccc agatggcctc aca 23

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccaatgagca caactgctcg g 21

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cacctgatgc tgagaaggat tt 22

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cgcctggggg tgttctttac 20

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

gtaggagacg ttggtgccat 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

gggcatcaga cagcggcgat g 21

<210> 7

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

agcgtctcca taaaggccac 20

<210> 8

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ggtatcaata ctggcacact t 21

Claims

1. A PCR primer set for amplification of PKD1 gene, wherein the PCR primer set comprises one or more of the following primer pairs:

2. The PCR primer set according to claim 1, wherein the PCR primer set further comprises one or more of the following features:

1) the region amplified by the first primer pair comprises exons 24 to 46 of the PKD1 gene;

2) the region amplified by the second primer pair comprises exons 15 to 33 of the PKD1 gene;

3) the region amplified by the third primer pair comprises a PKD1 gene No. 2-15 exon;

4) the region amplified by the fourth primer pair comprises a PKD1 gene exon 1.

3. The PCR primer set according to claim 1, wherein the PKD1 gene is a human PKD1 gene.

4. An amplification system for amplifying the PKD1 gene, wherein the amplification system comprises a first amplification system, a second amplification system, a third amplification system, and a fourth amplification system, wherein the first amplification system comprises the first primer pair, the second amplification system comprises the second primer pair, the third amplification system comprises the third primer pair, and the fourth amplification system comprises the fourth primer pair.

5. The amplification system of claim 4, further comprising one or more of the following features:

1) the fourth amplification system comprises the following components: 50-150 ng of DNA template, 150-300 nM fourth primer pair, 0.5-2.5U of DNA polymerase and 400-500 mu M dNTP mixture;

2) the first amplification system, the second amplification system and the third amplification system comprise the following components: 50-200 ng of DNA template, 150-300 nM of first, second or third primer pairs, 0.5-2.5U of DNA polymerase, and 400-500 muM of dNTP mixture.

6. A kit for amplifying PKD1 gene, comprising the PCR primer set of any one of claims 1-3.

7. The kit of claim 6, further comprising reagents for extracting genomic DNA from a sample, and reagents for performing a long-fragment PCR reaction using the primer set.

8. The kit of claim 6, wherein the reagents for performing long fragment PCR reaction using the primers comprise DNA polymerase, PCR buffer, dNTP mix, and aqueous medium.

9. Use of the PCR primer set for amplification of PKD1 gene according to any one of claims 1-3 and/or the amplification system according to any one of claims 4-5 for the preparation of a product for detecting a variation in PKD1 gene.

10. The use of claim 9, wherein the detection of the PKD1 gene variant product is used for detecting the PKD1 gene variant, diagnosis of the cause of polycystic kidney disease, selection of treatment regimens, and/or guiding good prenatal and postnatal care.

11. A method for detecting mutations in PKD1 gene in vitro, comprising the steps of:

1) preparing the amplification system for amplifying the PKD1 gene according to claim 4 or 5, and performing PCR amplification;

3) data quality control and analysis: comparing the sequence of the PKD1 gene obtained by sequencing with a PKD1 pseudogene locus database; if no pseudogene pollution exists in the data, carrying out PKD1 true gene variation detection; if the data has false gene pollution, the amplification system is proved to be unqualified, and the amplification is carried out again after the reason is checked.